LAMP (Loop-Mediated Isothermal Amplification) and CRISPR / BrCas12b mediated one-pot nucleic acid molecule detection method for detecting Escherichia coli O157: H7

Abstract

The invention belongs to biology, relates to Escherichia coli O157: H7 gene detection, and discloses an LAMP (Loop-Mediated Isothermal Amplification) and CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) / BrCas12b mediated one-pot nucleic acid molecule detection method for detecting Escherichia coli O157: H7. The method comprises the following steps: designing an LAMP primer, a small guide RNA (Ribonucleic Acid) and a transcription template overlapping PCR (Polymerase Chain Reaction) primer, carrying out loop-mediated isothermal amplification, carrying out CRISPR / Cas shearing recognition (Cas-LAMP), carrying out single-tube one-pot detection reaction on the CRISPR / Cas shearing recognition (Cas-LAMP), carrying out Cas-LAMP amplification specificity and sensitivity detection and the like. In order to solve the problem that amplification and shearing recognition cannot be carried out synchronously, a Cas-LAMP technology for simultaneously connecting two-step reaction of amplification and shearing recognition is adopted, and nucleic acid molecules are accurately, sensitively and rapidly detected in an in-vitro single reaction tube system. Compared with a traditional nucleic acid molecule detection method, the method has the following advantages that one-pot detection is directly carried out, step-by-step reaction is not needed, the sensitivity is high, the specificity is high, and rapid field detection can be achieved; the method can provide technical method support for conventional nucleic acid detection, and has a wide field instant detection application prospect.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biology and relates to a highly sensitive nucleic acid molecule detection method for detecting Escherichia coli O157:H7 in the field of foodborne epidemic detection, and in particular to a loop-mediated isothermal amplification and CRISPR / BrCas12b-mediated one-pot highly sensitive detection method for detecting Escherichia coli O157:H7 and its related primer probes and small guide RNA (sgRNA) sequences. Background Art

[0002] Escherichia coli is also known as Escherichia coli. The specific strain O157:H7 is a very harmful intestinal pathogen and a major strain of enterohemorrhagic Escherichia coli (EHEC). It has similar morphology and biochemical characteristics to general Escherichia coli. O157:H7 can cause diarrhea, hemorrhagic colitis (HC), and easily induce serious complications such as hemolytic uremic syndrome (HUS) and thrombotic thrombocytoprnic purpura (TTP), so it has a high mortality rate. Escherichia coli O157:H7 is the main epidemic strain among the many serotypes of EHEC. Its infection rate and transmission efficiency are much higher than those of ordinary Escherichia coli. It has been listed as a mandatory pathogen in many countries. Its sources of infection are mainly infected animals, infected patients and asymptomatic carriers. The bacteria can be transmitted through food, drinking water and contact. Infection is often accompanied by serious complications. In recent years, it has caused epidemics of varying degrees in many parts of the world, posing a huge threat to human health and attracting widespread attention. Therefore, research on effective prevention and control strategies for this strain has become an urgent issue to be solved.

[0003] EHEC O157:H7 infection has become a global public health and food safety issue. Rapid and specific detection is essential for the early diagnosis of the disease and effective control of the epidemic. The development of biotechnology has provided many effective means and methods for the laboratory diagnosis of EHEC O157:H7. Among the commonly used detection methods for O157:H7, traditional diagnostic methods such as histopathology and electron microscopy are time-consuming, labor-intensive, and cumbersome to operate. They cannot accurately diagnose the infectious pathogen and have poor practicality. Immunological methods have the problems of difficult acquisition of antibodies and high cost, making it difficult to promote and apply them in production. With the development of molecular biology technology, polymerase chain reaction (PCR) and real-time fluorescence quantitative PCR have been applied to the detection and identification of EHEC O157:H7. These technologies overcome the limitations of microbial culture cycles and increase the accuracy of identification to a certain extent. However, these methods require expensive and sophisticated instruments such as PCR instruments and gel imaging systems, are easily exposed to carcinogens such as ethidium bromide (EB), and require high professional knowledge of the test personnel. In recent years, the newly developed nucleic acid amplification technology based on isothermal conditions, represented by loop-mediated isothermal amplification (LAMP), has overcome the complexity of instruments caused by thermal cycling, etc., and has shown certain application prospects in the instant and rapid detection of microorganisms.

[0004] Prokaryotes such as bacteria and archaea use clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated proteins (Cas) as important parts of their own adaptive immune systems. The CRISPR-Cas system formed by the two works together to protect prokaryotes from foreign genetic material. CRISPR-Cas was originally used as a gene editing system and has been widely studied and applied in the field of synthetic biology. According to the biological functions and characteristics of different proteins, a large number of new gene editing elements and tools have been developed and designed. In 2015, Zhang Feng's team reported that CRISPR-Cas12a has nuclease activity and proposed that CRISPR-Cas12a will play an important role in future gene editing and biotechnology fields. The powerful gene editing ability of the CRISPR-Cas system originates from the specific or nonspecific cutting activity of the Cas protein. Therefore, this characteristic has greatly stimulated people's interest in using it to develop new detection tools. In 2016, Abudayyeh et al. found that Cas12 has "incidental cutting" activity, that is, after recognizing and binding to the target sequence, the Cas protein can not only specifically remove the target sequence, but also non-specifically cut the single-stranded fluorescent reporter probe to release the fluorescent signal to achieve the purpose of detection. Since then, nucleic acid detection technology based on CRISPR-Cas has become one of the important research directions. In the same year, the CRISPR-Cas system was first applied to nucleic acid detection, and in subsequent research and development, it showed efficient and accurate pathogen nucleic acid detection performance. Among the two types of Cas effector proteins, Cas9 is widely used as the best protein in genome modification, editing and regulation, while Cas12 has higher specificity and can be combined with nucleic acid amplification methods, or as a separate signal amplification method, showing great application potential in nucleic acid detection and disease monitoring. Nowadays, the CRISPR-Cas system has been widely used as a powerful detection and diagnostic tool in the fields of nucleic acid and microbial detection and molecular imaging. The various characteristics of the CRISPR-Cas system can be used to detect different targets specifically and at low cost. Therefore, the application of CRISPR-Cas technology will help to further explore the boundaries of disease diagnosis. However, since the optimal enzyme activity temperature of most Cas12 does not match the optimal reaction temperature of Bst DNA polymerase in the LAMP reaction, amplification and shearing are difficult to perform in a one-pot reaction, and dividing the reaction into two steps will complicate the operation steps, and aerosol contamination will often occur due to repeated opening of the lid, thereby increasing the difficulty of successful diagnosis. Summary of the invention

[0005] The technical problem to be solved by the present invention is to realize the compatibility of LAMP and Cas shearing system, and provide a kind of fast detection speed, high detection sensitivity and accuracy for Escherichia coli O157: One-pot nucleic acid molecule detection method and its related primer probe and small guide RNA (sgRNA) sequence mediated by LAMP and CRISPR / Cas for H7. It is related to the amplification of DNA and CRISPR / Cas12b shearing signal amplification detection, and is specifically related to under the action of Bst DNA polymerase, by the combination and amplification of 4-6 specific primers, it is realized that the amplification for the target, at the same time BrCas12b, sgRNA and amplified product form a ternary complex, activate the "incidental cutting" activity of BrCas12b, cut the single-stranded fluorescent reporter probe, release the fluorescent signal, and make the amplification and detection reaction proceed simultaneously. At the same time, the present invention is cleverly designed by primers, and the adjacent motif (PAM, protospacer adjacent motif) of the prototype spacer is inserted into the double-stranded DNA product, and the design of sgRNA is freed from the dependence on the target sequence PAM site. The present invention optimizes the reaction system and reaction conditions so that amplification and shearing reactions can be performed in the same system, and the detection of Escherichia coli O157:H7 samples is achieved in a single system. The method has the advantages of high sensitivity, strong specificity, fast detection speed, etc., and is also highly adaptable to other single-stranded and double-stranded DNA targets.

[0006] The objective of the present invention is achieved through the following technical solutions:

[0007] <First aspect>

[0008] The present invention provides a Cas-LAMP one-pot nucleic acid molecule detection method for Escherichia coli O157:H7, the method comprising the following steps:

[0009] S1. Extracting nucleic acid samples from samples to be tested;

[0010] S2. Design synthetic primers and probes; design 5 specific oligonucleotide LAMP primers according to the rfbE gene sequence of Escherichia coli O157:H7: upstream internal primer FIP, downstream internal primer BIP, upstream external primer F3, downstream external primer R3 and downstream loop primer LB; random TA-rich single-stranded DNA reverse cleavage probe; LAMP product-specific small guide RNA (sgRNA) sequence and its transcription template overlapping PCR synthetic primers, the base sequence is as SEQ ID No: 1-13;

[0011]

[0012] S3. Prepare a reaction mixture system, wherein the mixture system includes: a single-stranded DNA reverse-cleavage probe, 5 oligonucleotide LAMP primers, a small (single) guide RNA (sgRNA) or a derivative thereof, a CRISPR-related Cas protein or a variant thereof, a Cas-LAMP one-pot reaction buffer, and a Bst DNA polymerase or a variant thereof; wherein the small guide RNA or a derivative thereof contains a sequence complementary to the oligonucleotide LAMP primer rfbE-FIP-2; and the oligonucleotide LAMP primer rfbE-FIP-2 sequence is complementary to a partial sequence of one chain of the target molecule and a partial sequence of the small guide RNA or a derivative thereof, and also introduces a PAM site sequence;

[0013] S4, adding the nucleic acid sample extracted in step 1 to the reaction system of step 3, and performing a constant temperature reaction. Under the action of Bst DNA polymerase, 5 specific primers bind to and amplify the nucleic acid target, and at the same time, BrCas12b, sgRNA and the amplified product form a ternary complex; activating the "incidental cutting" activity of BrCas12b, cutting the single-stranded DNA trans-cutting fluorescent reporter probe, and releasing a fluorescent signal;

[0014] S5. Use a fluorescence detector to collect, read and record the fluorescence signal generated by the Cas-LAMP one-pot reaction, and use the fluorescence signal to determine the presence or absence of the target nucleic acid molecule in the sample to be tested. The reaction result is presented in real time in the form of a fluorescence curve. The temperature of the Cas-LAMP one-pot reaction is 63°C and the reaction time is 20 minutes.

[0015] The technical principles of the present invention are as follows:

[0016] The target gene amplification of the LAMP reaction is divided into two stages: the initial stage and the cycle stage. The initial stage starts from the forward inner primer FIP. The inner primer rfbE-FIP-2 consists of two regions, F2 and F1c. In order to make the CRISPR-BrCas12b system independent of the target PAM site, we added TTT-PAM sites to the linker between F2 and F1c to modify FIP, introduce the PAM site into the LAMP product, and cleverly avoid the dependence of BrCas12b on the target sequence PAM site sequence; the F2 region is complementary to F2c on the rfbE gene, and the primer is extended using Bst chain displacement DNA polymerase to start the DNA chain displacement reaction. At the same time, the outer primer rfbE-F3-2 is complementary to the target F3c region. Under the action of the Bst enzyme, the synthesized DNA chain is displaced after extension; the displaced single-stranded 5' end contains F1c and F1 regions, and the bases in these two regions can amplify the target fragment to form a ring structure. Similarly, another inner primer rfbE-BIP-2 is composed of B2 and B1c, the B2 region is complementary to B2c on the rfbE gene sequence, the outer primer rfbE-F3-2 is complementary to F3c on the rfbE gene sequence, and the outer primer rfbE-R3 is complementary to B3c on the rfbE gene sequence. The rfbE gene primer set has a total of 5 primers, and an additional loop primer LB is added on the basis of the inner and outer primers to accelerate the LAMP amplification efficiency. Under the action of Bst DNA enzyme, the extension of the new DNA chain begins, and the single-stranded BIP that is displaced, including the B1c and B1 regions, will also form a ring structure. Finally, through the action of extension and chain displacement, a dumbbell-shaped structure is formed at both ends of the target sequence, which is the starting structure of the LAMP amplification cycle. In the cycle stage, starting from the F1 loop at the 3' end, the F2 end and the circular F2c region are synthesized and extended, and then the initial single strand of F1 is displaced by chain displacement to form a circular structure; similarly, starting from the B1 end, the primer B2 end and the B2c end region are synthesized and extended, and the single strand of B1 end is displaced by the Bst enzyme to finally form a circular structure. After cyclic amplification, the final product is a mixture of circular structure and polycyclic cauliflower-like structure DNA.

[0017] At the same time, rfbE-sgRNA is specially designed to target LAMP products with a given PAM site. BrCas12b forms a ternary complex of BrCas12b-sgRNA-dsDNA with the target DNA under the guidance of sgRNA, activating the trans-cleavage activity of BrCas12b, resulting in the shearing of the single-stranded DNA trans-cleavage fluorescent reporter probe. The shearing of LAMP and BrCas12b is achieved simultaneously in the same system. When there is no target, BrCas12b does not work, and the FAM fluorescent group attached to the fluorescent probe is quenched by BHQ1, and no fluorescent signal is generated. When the target is present, LAMP amplifies, and at the same time, sgRNA recognizes the target sequence to form a ternary complex of BrCas12b-sgRNA-dsDNA, and then the fluorescent probe is sheared, the fluorescent group is separated from the quenching group, and fluorescence is released.

[0018] The fluorescence signal generated by the Cas-LAMP one-pot reaction can be collected, read, recorded and analyzed by a fluorescence detector to determine the presence or absence of target nucleic acid molecules in the sample to be tested.

[0019] The Cas-LAMP one-pot reaction is a DNA nucleic acid detection platform, which is highly adaptable to the detection of different single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA) targets. The detection system proposed by the present invention is simple to operate, can simultaneously amplify and detect targets in a single reaction tube, reduce the contamination risk of open tube reactions, has low requirements for temperature control, can reduce laboratory equipment requirements, shorten detection time, has a high degree of automation, has high sensitivity, strong specificity, and is suitable for simple and rapid nucleic acid detection.

[0020] The CRISPR-associated Cas protein or its variant is a nuclease with single-stranded or double-stranded DNA recognition and cleavage functions and single-stranded DNA cleavage functions. It is a CRISPR-Cas protease that can tolerate a reaction temperature above 55°C and can specifically recognize target DNA under the guidance of sgRNA, and has cis- and trans-cleavage activity, including but not limited to any one or any variant of AapCas12b, BrCas12b, and AacCas12b proteins. The enzyme may include a mixture of wild-type, modified, codon-optimized, evolved, thermophilic, chimeric, engineered and / or more than one Cas protein. The CRISPR-Cas protease is preferably BrCas12b. The CRISPR-Cas nuclease combined with sgRNA can be specifically activated by the target nucleic acid sequence to have non-specific DNA nuclease activity, thereby achieving the cleavage of the DNA fluorescent probe.

[0021] The Bst chain displacement DNA polymerase is a DNA polymerase with chain displacement effect, which can displace the downstream DNA chain without template denaturation. The DNA polymerase or its variant can be any one or any variant of Bst 2.0 DNA polymerase, Bst 3.0 DNA polymerase, Warmstar Bst 2.0 DNA polymerase, Bst LF DNA polymerase, OmniAmp DNA polymerase, etc. The enzyme can include a mixture of wild-type, modified, codon-optimized, evolved, thermophilic, chimeric, engineered and / or more than one chain displacement DNA polymerase. The Bst chain displacement DNA polymerase is preferably Bst 3.0 DNA polymerase. The DNA polymerase has 5'-3' DNA polymerase activity and chain displacement activity, which can automatically dissociate from the hydrogen bond of the template double-stranded DNA and then synthesize a new DNA chain. Due to its characteristics, the Bst enzyme can synthesize DNA at a constant temperature without the double-strand dissociation of DNA, and the synthesis is not affected by the secondary structure of DNA.

[0022] The single-stranded DNA trans-cleavage probe is a single-stranded DNA, the 5' end of which is labeled with a fluorescent group including but not limited to FAM, HEX, VIC, CY5, CY3, ROX, TAMRA, TET, FITC, and JOE, and the 3' end is labeled with a quenching group including but not limited to TAMRA, BHQ1, MGB, BHQ2, etc. that can be combined with any fluorescent group at the 5' end.

[0023] The random TA-rich single-stranded DNA sequence may be TTATTATT or TTTTT or TTTTTTTT or other TA-rich single-stranded DNA sequences, and the preferred sequence is TTATTATT; the sequence can be recognized and cut by the CRISPR-Cas protein.

[0024] The spacer sequence of the small guide RNA (sgRNA) or its derivative is complementary to the LAMP product nucleic acid molecule sequence.

[0025] The main components of the Cas-LAMP one-pot reaction buffer include dNTPs, Tris-HCl, MgSO 4 , KCl, ATP, DTT, (NH 4 ) 2 SO 4 , Triton X-100 and mannitol. The preferred reaction buffer includes: 0.18mM-1.62mM dNTPs, 10mM-40mM Tris-HCl, 1.8mM-16.2mM MgSO 4, 5mM-20mM KCl, 0.01mM-10mM ATP, 0.5mM-10mDTT, 5mM-20mM (NH 4 ) 2 SO 4 , 0.1%-0.4% Triton X-100 and 100mM-400mM mannitol, pH between 6.5-8.0.

[0026] In the above technical solution of the present invention, the nucleic acid sample of Escherichia coli O157:H7 to be detected can be extracted from food samples or clinical samples such as blood, saliva, tissue, urine, sputum, etc. by magnetic bead method or column method.

[0027] The temperature of the isothermal reaction is 61°C-68°C, preferably 63°C, and the isothermal reaction time is 10min-80min, preferably 20min; during the isothermal reaction, under the action of the Bst enzyme, the inner primer and the outer primer perform LAMP amplification on the target gene fragment to produce DNA fragments of different lengths, thereby achieving target enrichment. At the same time, the CRISPR-BrCas12b system starts working, and the sgRNA targets the LAMP product with a given PAM site. Under the guidance of the sgRNA, a ternary complex of BrCas12b-sgRNA-dsDNA is formed, which activates the trans-cleavage activity of BrCas12b, resulting in the shearing of the single-stranded DNA probe, thereby generating a detectable fluorescent signal.

[0028] <Second Aspect>

[0029] Furthermore, the present invention also provides a reaction system for the detection of Escherichia coli O157:H7 nucleic acid, comprising a single-stranded DNA trans-cleavage fluorescent reporter probe, 5 oligonucleotide LAMP primers, a small (single) guide RNA (sgRNA) or its derivatives, a CRISPR-associated Cas protein or its variants, a Cas-LAMP one-pot reaction buffer, and a Bst DNA polymerase or its variants.

[0030] A kit including the reaction system also belongs to the protection scope of the present invention. It can realize accurate, rapid and highly sensitive detection of Escherichia coli O157:H7 DNA molecules under isothermal conditions.

[0031] The present invention can quickly complete the detection of Escherichia coli O157:H7 nucleic acid molecules under isothermal conditions. First, the nucleic acid of the sample to be detected is obtained by rapid nucleic acid extraction; then, a chain displacement DNA polymerase, a combination enzyme of CRISPR-related proteins, sgRNA, a single-stranded DNA fluorescent probe and an oligonucleotide primer are used to react with the nucleic acid to be detected under isothermal conditions; finally, by detecting the fluorescent signal, it is determined whether the target nucleic acid molecule exists in the sample to be detected.

[0032] The CRISPR-associated Cas protein or its variant and sgRNA form a binary complex, which specifically binds to the amplified product to form a ternary complex, thereby activating nonspecific trans-cleavage activity and ultra-sensitively cutting single-stranded DNA molecules in the reaction system; the CRISPR-associated Cas protein or its variant may include wild-type, modified, codon-optimized, evolved, thermophilic, chimeric, engineered and / or a mixture of more than one Cas protein.

[0033] Preferably, the kit comprises an enzyme mixture, a single-stranded DNA probe, a small guide RNA, a fluorescently labeled single-stranded DNA probe, an oligonucleotide primer and a Cas-LAMP reaction buffer; the enzyme mixture comprises CRISPR-Cas nuclease and a strand-displacing DNA polymerase.

[0034] Furthermore, the CRISPR-Cas nuclease is preferably BrCas12b. In the oligonucleotide primer, in order to achieve the independence of the CRISPR / BrCas12b system on the target PAM site, we added a TTT-PAM site to the connecting region between F2 and F1c to modify the primer FIP; the strand displacement DNA polymerase is Bst DNA polymerase; the DNA fluorescent probe is a single-stranded DNA with a fluorescent group labeled at the 5' end and a fluorescent quenching group labeled at the 3' end.

[0035] In a specific embodiment, the buffer comprises 0.18 mM-1.62 mM dNTPs, 10 mM-40 mM Tris-HCl, 1.8 mM-16.2 mM MgSO 4 , 5mM-20mM KCl, 0.01mM-10mM ATP, 0.5mM-10mM DTT, 5mM-20mM (NH 4 ) 2 SO 4 , 0.1%-0.4% Triton X-100 and 100mM-400mM mannitol, pH value between 6.5-8.0. Primer FIP / BIP 10μM-100μM, primer F3 / R3 2.5μM-25μM, primer LF / LB 0μM-50μM; FAM-labeled fluorescent probe 3μM-12μM; small guide RNA 20nM-100nM, enzyme mixture (Bst DNA polymerase, 8U-32U; Cas12b protein, 75nM-300nM).

[0036] In the kit of the present invention, the target DNA, the small guide RNA and the Cas12b protein form a complex, which can cut other single-stranded DNA molecules in the system.

[0037] The present invention also provides a reaction system, which comprises: a single-stranded DNA probe, an oligonucleotide primer, a strand-displacing DNA polymerase and its variants, a small guide RNA (sgRNA) or its derivatives, a CRISPR-associated (Cas) protein or its variants, and a Cas-LAMP reaction buffer.

[0038] The present invention can quickly complete the detection of Escherichia coli O157:H7 DNA molecules under isothermal conditions. First, the DNA of the sample to be detected is obtained by nucleic acid extraction; then, the amplification enzyme, the combined enzyme of CRISPR-related proteins, and the single-stranded DNA probe are used to react with the nucleic acid to be detected under isothermal conditions. Finally, by detecting the fluorescent signal, it is determined whether the target nucleic acid exists in the sample to be detected.

[0039] The detection method and kit of the present invention is a rapid detection platform, which can quickly complete the detection of Escherichia coli O157:H7 nucleic acid molecules.

[0040] Compared with the prior art, the present invention has the following beneficial effects:

[0041] (1) High sensitivity: The present invention can detect nucleic acid molecules at the single copy level;

[0042] (2) Rapid: The present invention can complete the detection in as little as 20 minutes;

[0043] (3) Convenience: The present invention realizes isothermal reaction in a single tube with a single buffer solution, which is easy to operate and has simple steps;

[0044] (4) Low false positives: Although the reaction system of the present invention includes an amplification step, based on the specific recognition of the pre-amplification primer and the highly targeted specific recognition of the pre-amplification product by sgRNA, such a bispecific recognition system overcomes the problem of easy contamination of traditional molecular detection methods. At the same time, this method is a closed-tube reaction, which avoids the risk of aerosol contamination caused by secondary opening of the lid, and physically isolates it, minimizing the possibility of contamination;

[0045] (5) Isothermal detection: Two engineered enzymes and chemical components together create an environment that simulates nucleic acid amplification in vivo to the greatest extent possible, and each engineered enzyme performs its own function and works at its optimal reaction temperature, so the working efficiency is the highest;

[0046] (6) One-step method: Two reaction-compatible buffers were constructed, and the target amplification and Cas12b cleavage detection reactions were placed in the same reaction tube. The sample detection was completed by a one-time addition, achieving a one-step method. Therefore, the operation is simpler, and the reaction efficiency is further improved and the reaction time is shortened. It is more suitable for rapid on-site detection, especially in areas with limited resources;

[0047] (7) Universality: The present invention can be used to detect any DNA target and distinguish point mutations. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Other features, objects and advantages of the present invention will become more apparent from the detailed description of non-limiting embodiments made with reference to the following drawings:

[0049] Figure 1 It is a schematic diagram of the process of detecting samples of the present invention;

[0050] Figure 2 is the detection sensitivity of the method for Escherichia coli O157:H7 samples;

[0051] Figure 3 for the detection specificity of the method for Escherichia coli O157:H7 samples;

[0052] Figure 4 This is a comparison chart of one-pot methods with different additives;

[0053] Figure 5 Batch sample testing of Escherichia coli O157:H7 samples in this method. DETAILED DESCRIPTION

[0054] The present invention is described in detail below in conjunction with the accompanying drawings and specific examples. The following examples will help those skilled in the art to further understand the present invention, but are not intended to limit the present invention in any form. It should be noted that, for those of ordinary skill in the art, some adjustments and improvements can also be made without departing from the concept of the present invention. These all belong to the protection scope of the present invention.

[0055] The present invention is a one-pot nucleic acid molecule detection method mediated by LAMP and CRISPR / BrCas12b for detecting Escherichia coli O157:H7, the process is as follows Figure 1 shown.

[0056] The sequences of primers, probes, etc. used in the examples are listed as follows:

[0057]

[0058] Example 1: A method for detecting Escherichia coli O157:H7

[0059] Escherichia coli O157:H7 dsDNA (Target) was selected as the target sequence. The Target sequence is shown in SEQ ID NO.1, which is:

[0060] AAATATCAACAGTCTTGTACAAGTCCACAAGGAAAGTAAAGATGTTTTTCACACTTATTGGATGGTCTCAATTCTAACTAGGACCGCAGAGGAAAGAGAGGAATTAAGGAATCACCTTGCAGATAAACTCATCGAAACAAGGCCAGTTTTTTACCCTGTCCACACGATGCCAATGTACTCGGAAAAATATCAAAAGCACCCTATAGCTGAGGATCTTGGTTGGCGTGGAATTAAT

[0061] Preparation of small guide RNA: Synthesize forward primer BrCas12b-sgRNA-F1 including T7 as SEQ ID NO.2, as follows:

[0062] TTCTTAATACGACTCACTATAGGGGAAGGTGGTTAGCTACAGGCTG ACCAGTGCAGTTG;

[0063] The forward primer BrCas12b-sgRNA-F2 of T7 is as shown in SEQ ID NO.3, which is:

[0064] GGCTGACCAGTGCAGTTGTGTCATGTGCTACGGTGACCTAACACGT CACTCAGTCACAA;

[0065] The forward primer BrCas12b-sgRNA-F3 of T7 is as shown in SEQ ID NO.4, which is:

[0066] CACGTCACTCAGTCACAACGGCTATCTATATTTCCACTAACCAAAGT TAGTGGAAATGT;

[0067] The forward primer rfbE2-sgRNA-F4 of T7 is as shown in SEQ ID NO.5, which is:

[0068] ACCAAAGTTAGTGGAAATGTAGATGGTTAGCACCTCTCTTTCCCTCTG CGGTCC;

[0069] The reverse complementary long primer rfbE2-sgRNA-R containing the T7 sequence is shown in SEQ ID NO.6, which is: GGACCGCAGAGGAAAGAGAGGTGCT;

[0070] The sgRNA transcription template was prepared by overlapping PCR, and the reaction was carried out overnight at 37 degrees using T7 transcriptase. The sgRNA was then purified using the RNAClean&Concentrator 100 kit and stored at -20 degrees or -80 degrees.

[0071] The LAMP reaction primer sequence of Target, rfbE-F3-2, is shown in SEQ ID NO.7, which is: AACAGTCTTGTACAAGTCCA;

[0072] The LAMP reaction primer sequence of Target, rfbE-R3-2, is shown in SEQ ID NO. 8, which is: GGTGCTTTTGATATTTTTCCG;

[0073] The LAMP reaction primer sequence of Target, rfbE-FIP-2, is shown in SEQ ID NO.9, which is: CTCTCTTTCCTCTGCGGTCCTTTGATGTTTTTCACACTTATTGGAT;

[0074] The LAMP reaction primer sequence of Target, rfbE-BIP-2, is shown in SEQ ID NO. 10, which is: TAAGGAATCACCTTGCAGATAAACT-AGTACATTGGCATCGTGT;

[0075] The LAMP reaction primer sequence of Target, rfbE-LB-2, is shown in SEQ ID NO. 11, which is: CGAAACAAGGCCAGTTTTTTACCC;

[0076] like Figure 1 As shown in the figure, amplification and shearing reaction: first, double-stranded DNA was extracted from the Escherichia coli O157:H7 sample to be tested, and the concentration was diluted from 10 6 copies / μL-10 -1 copies / μL; added to the reaction system, the reaction system includes, 0.54mM dNTPs, 40mM Tris-HCl, 12.6mM MgSO 4 , 10mM KCl, 0.5mM ATP, 10mM DTT, 20mM (NH 4 ) 2 SO 4, 0.2% Triton X-100 and 400mM mannitol, pH 7.5. Primer FIP / BIP 10μM, primer F3 / R3 2.5μM, primer LF / LB 5μM; FAM-labeled fluorescent probe 12μM; small guide RNA 80nM, enzyme mixture (Bst DNA polymerase, 24U; Cas12b protein, 150nM).

[0077] Fluorescence detection: After the reaction is mixed, the temperature is set to 63 degrees in the fluorescence real-time quantitative PCR instrument (7900HT Fast Real-Time PCR), the fluorescent group of the fluorescence detection probe is FAM, the TTA-reporter sequence is as shown in SEQ ID NO.12: FAM-TTATTATT-BHQ1, the fluorescence signal collection time interval is 1 minute, and the detection time is 20-80 minutes.

[0078] The specific reaction process is as follows: add the double-stranded DNA to be tested into the integrated system of amplification and reaction, react at 63°C for 20-80 minutes, and simultaneously use the 7900HT Fast Real-Time RCR system for fluorescence signal detection. The fluorescence signal collection time interval is 1 minute, and the detection time is 20-80 minutes.

[0079] Results: Figure 2 As shown in the figure, this method can be used to detect Escherichia coli O157:H7 double-stranded DNA, and this method can detect as low as 10 copies / μL of Escherichia coli O157:H7 double-stranded DNA within 20 minutes and as low as 10 within 80 minutes. -1 copies / μL of Escherichia coli O157:H7 double-stranded DNA.

[0080] Example 2: Characterization of detection specificity using this method

[0081] Escherichia coli O157:H7 dsDNA (Target) was selected as the target sequence. The Target sequence is shown in SEQ ID NO.1, which is:

[0082] AAATATCAACAGTCTTGTACAAGTCCACAAGGAAAGTAAAGATGTTTTTCACACTTATTGGATGGTCTCAATTCTAACTAGGACCGCAGAGGAAAGAGAGGAATTAAGGAATCACCTTGCAGATAAACTCATCGAAACAAGGCCAGTTTTTTACCCTGTCCACACGATGCCAATGTACTCGGAAAAATATCAAAAGCACCCTATAGCTGAGGATCTTGGTTGGCGTGGAATTAAT

[0083] Preparation of small guide RNA: Synthesize forward primer BrCas12b-sgRNA-F1 including T7 as SEQ ID NO.2, as follows:

[0084] TTCTTAATACGACTCACTATAGGGGAAGGTGGTTAGCTACAGGCTG ACCAGTGCAGTTG;

[0085] The forward primer BrCas12b-sgRNA-F2 of T7 is as shown in SEQ ID NO.3, which is:

[0086] GGCTGACCAGTGCAGTTGTGTCATGTGCTACGGTGACCTAACACGT CACTCAGTCACAA;

[0087] The forward primer BrCas12b-sgRNA-F3 of T7 is as shown in SEQ ID NO.4, which is:

[0088] CACGTCACTCAGTCACAACGGCTATCTATATTTCCACTAACCAAAGT TAGTGGAAATGT;

[0089] The forward primer rfbE2-sgRNA-F4 of T7 is as shown in SEQ ID NO.5, which is:

[0090] ACCAAAGTTAGTGGAAATGTAGATGGTTAGCACCTCTCTTTCCCTCTG CGGTCC;

[0091] The reverse complementary long primer rfbE2-sgRNA-R containing the T7 sequence is shown in SEQ ID NO.6, which is: GGACCGCAGAGGAAAGAGAGGTGCT;

[0092] The sgRNA transcription template was prepared by overlapping PCR, and the reaction was carried out overnight at 37 degrees using T7 transcriptase. The sgRNA was then purified using the RNAClean&Concentrator 100 kit and stored at -20 degrees or -80 degrees.

[0093] The LAMP reaction primer sequence of Target, rfbE-F3-2, is shown in SEQ ID NO.7, which is: AACAGTCTTGTACAAGTCCA;

[0094] The LAMP reaction primer sequence of Target, rfbE-R3-2, is shown in SEQ ID NO. 8, which is: GGTGCTTTTGATATTTTTCCG;

[0095] The LAMP reaction primer sequence of Target, rfbE-FIP-2, is shown in SEQ ID NO.9, which is: CTCTCTTTCCTCTGCGGTCCTTTGATGTTTTTCACACTTATTGGAT;

[0096] The LAMP reaction primer sequence of Target, rfbE-BIP-2, is shown in SEQ ID NO. 10, which is: TAAGGAATCACCTTGCAGATAAACT-AGTACATTGGCATCGTGT;

[0097] The LAMP reaction primer sequence of Target, rfbE-LB-2, is shown in SEQ ID NO. 11, which is: CGAAACAAGGCCAGTTTTTTACCC;

[0098] like Figure 1 As shown in the figure, amplification and shearing reaction: first, double-stranded DNA was extracted from the samples of Escherichia coli O157:H7, Salmonella, Listeria monocytogenes, Vibrio parahaemolyticus and Staphylococcus aureus to be tested, and the concentration was diluted to 10 3 copies / μL; added to the reaction system, the reaction system includes, 0.54mM dNTPs, 40mM Tris-HCl, 12.6mM MgSO 4 , 10mM KCl, 0.5mM ATP, 10mM DTT, 20mM (NH 4 ) 2 SO 4, 0.2% Triton X-100 and 400mM mannitol, pH 7.5. Primer FIP / BIP 10μM, primer F3 / R3 2.5μM, primer LF / LB 5μM; FAM-labeled fluorescent probe 12μM; small guide RNA 80nM, enzyme mixture (Bst DNA polymerase, 24U; Cas12b protein, 150nM).

[0099] Fluorescence detection: After the reaction is mixed, the temperature is set to 63 degrees in the fluorescence real-time quantitative PCR instrument (7900HT Fast Real-Time PCR), the fluorescent group of the fluorescence detection probe is FAM, the TTA-reporter sequence is as shown in SEQ ID NO.12: FAM-TTATTATT-BHQ1, the fluorescence signal collection time interval is 1 minute, and the detection time is 20 minutes.

[0100] The specific reaction process is as follows: add the double-stranded DNA to be tested into the integrated system of amplification and reaction, react at 63°C for 20 minutes, and simultaneously use the 7900HT Fast Real-Time RCR system for fluorescence signal detection. The fluorescence signal collection time interval is 1 minute and the detection time is 20 minutes.

[0101] Results: Figure 3 As shown, this method can detect Escherichia coli O157:H7 double-stranded DNA with high specificity, and this method will not cross-react with other common foodborne pathogens, and there will be no false positives.

[0102] Example 3: Optimization of the detection stability of the method using different additives

[0103] Escherichia coli O157:H7 dsDNA (Target) was selected as the target sequence. The Target sequence is shown in SEQ ID NO.1, which is:

[0104] AAATATCAACAGTCTTGTACAAGTCCACAAGGAAAGTAAAGATGTTTTTCACACTTATTGGATGGTCTCAATTCTAACTAGGACCGCAGAGGAAAGAGAGGAATTAAGGAATCACCTTGCAGATAAACTCATCGAAACAAGGCCAGTTTTTTACCCTGTCCACACGATGCCAATGTACTCGGAAAAATATCAAAAGCACCCTATAGCTGAGGATCTTGGTTGGCGTGGAATTAAT

[0105] Preparation of small guide RNA: Synthesize forward primer BrCas12b-sgRNA-F1 including T7 as SEQ ID NO.2, as follows:

[0106] TTCTTAATACGACTCACTATAGGGGAAGGTGGTTAGCTACAGGCTG ACCAGTGCAGTTG;

[0107] The forward primer BrCas12b-sgRNA-F2 of T7 is as shown in SEQ ID NO.3, which is:

[0108] GGCTGACCAGTGCAGTTGTGTCATGTGCTACGGTGACCTAACACGT CACTCAGTCACAA;

[0109] The forward primer BrCas12b-sgRNA-F3 of T7 is as shown in SEQ ID NO.4, which is:

[0110] CACGTCACTCAGTCACAACGGCTATCTATATTTCCACTAACCAAAGT TAGTGGAAATGT;

[0111] The forward primer rfbE2-sgRNA-F4 of T7 is as shown in SEQ ID NO.5, which is:

[0112] ACCAAAGTTAGTGGAAATGTAGATGGTTAGCACCTCTCTTTCCCTCTG CGGTCC;

[0113] The reverse complementary long primer rfbE2-sgRNA-R containing the T7 sequence is shown in SEQ ID NO.6, which is: GGACCGCAGAGGAAAGAGAGGTGCT;

[0114] The sgRNA transcription template was prepared by overlapping PCR, and the reaction was carried out overnight at 37 degrees using T7 transcriptase. The sgRNA was then purified using the RNAClean&Concentrator 100 kit and stored at -20 degrees or -80 degrees.

[0115] The LAMP reaction primer sequence of Target, rfbE-F3-2, is shown in SEQ ID NO.7, which is: AACAGTCTTGTACAAGTCCA;

[0116] The LAMP reaction primer sequence of Target, rfbE-R3-2, is shown in SEQ ID NO. 8, which is: GGTGCTTTTGATATTTTTCCG;

[0117] The LAMP reaction primer sequence of Target, rfbE-FIP-2, is shown in SEQ ID NO.9, which is: CTCTCTTTCCTCTGCGGTCCTTTGATGTTTTTCACACTTATTGGAT;

[0118] The LAMP reaction primer sequence of Target, rfbE-BIP-2, is shown in SEQ ID NO. 10, which is: TAAGGAATCACCTTGCAGATAAACT-AGTACATTGGCATCGTGT;

[0119] The LAMP reaction primer sequence of Target, rfbE-LB-2, is shown in SEQ ID NO. 11, which is: CGAAACAAGGCCAGTTTTTTACCC;

[0120] like Figure 1 As shown in the figure, amplification and shearing reaction: first, double-stranded DNA was extracted from the Escherichia coli O157:H7 sample to be tested, and the concentration was gradiently diluted to 10 3 copies / μL; betaine, sucrose, and mannitol were diluted to 150mM-450mM, 100mM-300mM, and 100mM-400mM, respectively; the reaction system was added according to the gradient, and the reaction system included 0.54mM dNTPs, 40mM Tris-HCl, and 12.6mM MgSO 4 , 10mM KCl, 0.5mM ATP, 10mM DTT, 20mM (NH 4 ) 2 SO 4 , 0.2% Triton X-100, pH 7.5. Primer FIP / BIP 10μM, primer F3 / R3 2.5μM, primer LF / LB 5μM; FAM-labeled fluorescent probe 12μM; small guide RNA 80nM, enzyme mixture (Bst DNA polymerase, 24U; Cas12b protein, 150nM).

[0121] Fluorescence detection: After the reaction is mixed, the temperature is set to 63 degrees in the fluorescence real-time quantitative PCR instrument (7900HT Fast Real-Time PCR), the fluorescent group of the fluorescence detection probe is FAM, the TTA-reporter sequence is as shown in SEQ ID NO.12: FAM-TTATTATT-BHQ1, the fluorescence signal collection time interval is 1 minute, and the detection time is 80 minutes.

[0122] The specific reaction process is as follows: add the double-stranded DNA to be tested into the integrated system of amplification and reaction, react at 63°C for 80 minutes, and simultaneously use the 7900HT Fast Real-Time RCR system for fluorescence signal detection. The fluorescence signal collection time interval is 1 minute and the detection time is 80 minutes.

[0123] Results: Figure 4 As shown, the addition of 400 mM mannitol can greatly reduce the curve fluorescence fluctuation when the method is used to detect Escherichia coli O157:H7 double-stranded DNA, thereby further improving the stability of the results.

[0124] Example 4: Batch sample testing of the method for detecting Escherichia coli O157:H7

[0125] Escherichia coli O157:H7 dsDNA (Target) was selected as the target sequence. The Target sequence is shown in SEQ ID NO.1, which is:

[0126] AAATATCAACAGTCTTGTACAAGTCCACAAGGAAAGTAAAGATGTTTTTCACACTTATTGGATGGTCTCAATTCTAACTAGGACCGCAGAGGAAAGAGAGGAATTAAGGAATCACCTTGCAGATAAACTCATCGAAACAAGGCCAGTTTTTTACCCTGTCCACACGATGCCAATGTACTCGGAAAAATATCAAAAGCACCCTATAGCTGAGGATCTTGGTTGGCGTGGAATTAAT

[0127] Preparation of small guide RNA: Synthesize forward primer BrCas12b-sgRNA-F1 including T7 as SEQ ID NO.2, as follows:

[0128] TTCTTAATACGACTCACTATAGGGGAAGGTGGTTAGCTACAGGCTG ACCAGTGCAGTTG;

[0129] The forward primer BrCas12b-sgRNA-F2 of T7 is as shown in SEQ ID NO.3, which is:

[0130] GGCTGACCAGTGCAGTTGTGTCATGTGCTACGGTGACCTAACACGT CACTCAGTCACAA;

[0131] The forward primer BrCas12b-sgRNA-F3 of T7 is as shown in SEQ ID NO.4, which is:

[0132] CACGTCACTCAGTCACAACGGCTATCTATATTTCCACTAACCAAAGT TAGTGGAAATGT;

[0133] The forward primer rfbE2-sgRNA-F4 of T7 is as shown in SEQ ID NO.5, which is:

[0134] ACCAAAGTTAGTGGAAATGTAGATGGTTAGCACCTCTCTTTCCCTCTG CGGTCC;

[0135] The reverse complementary long primer rfbE2-sgRNA-R containing the T7 sequence is shown in SEQ ID NO.6, which is: GGACCGCAGAGGAAAGAGAGGTGCT;

[0136] The sgRNA transcription template was prepared by overlapping PCR, and the reaction was carried out overnight at 37 degrees using T7 transcriptase. The sgRNA was then purified using the RNAClean&Concentrator 100 kit and stored at -20 degrees or -80 degrees.

[0137] The LAMP reaction primer sequence of Target, rfbE-F3-2, is shown in SEQ ID NO.7, which is: AACAGTCTTGTACAAGTCCA;

[0138] The LAMP reaction primer sequence of Target, rfbE-R3-2, is shown in SEQ ID NO. 8, which is: GGTGCTTTTGATATTTTTCCG;

[0139] The LAMP reaction primer sequence of Target, rfbE-FIP-2, is shown in SEQ ID NO.9, which is: CTCTCTTTCCTCTGCGGTCCTTTGATGTTTTTCACACTTATTGGAT;

[0140] The LAMP reaction primer sequence of Target, rfbE-BIP-2, is shown in SEQ ID NO. 10, which is: TAAGGAATCACCTTGCAGATAAACT-AGTACATTGGCATCGTGT;

[0141] The LAMP reaction primer sequence of Target, rfbE-LB-2, is shown in SEQ ID NO. 11, which is: CGAAACAAGGCCAGTTTTTTACCC;

[0142] like Figure 1As shown, amplification and shearing reaction: first, double-stranded DNA was extracted from 10 groups of Escherichia coli O157:H7 positive samples and 10 groups of negative samples to be tested; reaction systems were added respectively, and the reaction system included 0.54mM dNTPs, 40mM Tris-HCl, 12.6mM MgSO 4 , 10mM KCl, 0.5mM ATP, 10mM DTT, 20mM (NH 4 ) 2 SO 4 , 0.2% Triton X-100 and 400mM mannitol, pH 7.5. Primer FIP / BIP 10μM, primer F3 / R3 2.5μM, primer LF / LB 5μM; FAM-labeled fluorescent probe 12μM; small guide RNA 80nM, enzyme mixture (Bst DNA polymerase, 24U; Cas12b protein, 150nM).

[0143] Fluorescence detection: After the reaction is mixed, the temperature is set to 63 degrees in the fluorescence real-time quantitative PCR instrument (7900HT Fast Real-Time PCR), the fluorescent group of the fluorescence detection probe is FAM, the TTA-reporter sequence is as shown in SEQ ID NO.12: FAM-TTATTATT-BHQ1, the fluorescence signal collection time interval is 1 minute, and the detection time is 40 minutes.

[0144] The specific reaction process is as follows: the target to be detected is added to the integrated system of amplification and reaction, the reaction is carried out at a constant temperature of 63°C for 40 minutes, and the 7900HT Fast Real-Time RCR system is used for fluorescence signal detection simultaneously. The fluorescence signal collection time interval is 1 minute and the detection time is 40 minutes.

[0145] Results: Figure 5 As shown, the accuracy of using this method to detect Escherichia coli O157:H7 is 100%, and no false positive or false negative events will occur.

[0146] The reaction process of this method includes LAMP target pre-amplification, CRISPR-related Cas protein or its variant recognition and shearing, and single-tube one-pot detection reaction. In view of the problem that target amplification, product recognition and shearing are difficult to be performed simultaneously in a single reaction system, the present invention establishes a Cas-LAMP technology that integrates these two steps of reaction at the same time. Nucleic acid molecules are enriched, amplified and identified at a constant temperature in a single reaction tube system in vitro to achieve accurate, ultra-sensitive and rapid detection of nucleic acid molecules.

[0147] Compared with the traditional nucleic acid molecule detection method, the present invention has the following advantages: no PAM site is required, the detection time is extremely short, the specificity is high, the method is stable, and it is applicable to any DNA nucleic acid molecule target. The present invention has a wide range of application prospects in the field of rapid nucleic acid molecule detection.

[0148] The above describes the specific embodiments of the present invention. It should be understood that the present invention is not limited to the above specific embodiments, and those skilled in the art may make various modifications or variations within the scope of the claims, which do not affect the essence of the present invention.

[0149] Sequence Listing

[0150] <110> Shanghai Jiao Tong University

[0151] <120> A one-pot nucleic acid molecular detection method mediated by LAMP and CRISPR / BrCas12b for detecting Escherichia coli O157:H7

[0152] <130> KAG

[0153] <160> 13

[0154] <170> SIPOSequenceListing 1.0

[0155] <210> 1

[0156] <211> 235

[0157] <212> DNA

[0158] <213> Artificial Sequence

[0159] <400> 1

[0160] aaatatcaac agtcttgtac aagtccacaa ggaaagtaaa gatgtttttc acacttattg 60

[0161] gatggtctca attctaacta ggaccgcaga ggaaagagag gaattaagga atcaccttgc 120

[0162] agataaactc atcgaaacaa ggccagtttt ttaccctgtc cacacgatgc caatgtactc 180

[0163] ggaaaaatat caaaagcacc ctatagctga ggatcttggt tggcgtggaa ttaat 235

[0164] <210>2

[0165] <211>59

[0166] <212>DNA

[0167] <213>Artificial Sequence

[0168] <400>2

[0169] ttcttaatac gactcactat aggggaaggt ggttagctac aggctgacca gtgcagttg 59

[0170] <210>3

[0171] <211>59

[0172] <212>DNA

[0173] <213>Artificial Sequence

[0174] <400>3

[0175] ggctgaccag tgcagttgtg tcatgtgcta cggtgaccta acacgtcact cagtcacaa 59

[0176] <210>4

[0177] <211>59

[0178] <212>DNA

[0179] <213>Artificial Sequence

[0180] <400>4

[0181] cacgtcactc agtcacaacg gctatctata tttccactaa ccaaagttag tggaaatgt 59<210>5

[0182] <211>53

[0183] <212>DNA

[0184] <213> Artificial Sequence

[0185] <400> 5

[0186] accaaagtta gtggaaatgt agatggttag cacctctctt tcctctgcgg tcc 53

[0187] <210> 6

[0188] <211> 25

[0189] <212> DNA

[0190] <213> Artificial Sequence

[0191] <400> 6

[0192] ggaccgcaga ggaaagagag gtgct 25

[0193] <210> 7

[0194] <211> 20

[0195] <212> DNA

[0196] <213> Artificial Sequence

[0197] <400> 7

[0198] aacagtcttg tacaagtcca 20

[0199] <210> 8

[0200] <211> twenty one

[0201] <212> DNA

[0202] <213> Artificial Sequence

[0203] <400> 8

[0204] ggtgcttttg atatttttcc g 21

[0205] <210> 9

[0206] <211> 46

[0207] <212> DNA

[0208] <213> Artificial Sequence

[0209] <400> 9

[0210] ctctctttcc tctgcggtcc tttgatgttt ttcacactta ttggat 46

[0211] <210> 10

[0212] <211> 43

[0213]

Claims

1. A one-pot nucleic acid molecule detection method mediated by LAMP and CRISPR / BrCas12b for detecting Escherichia coli O157:H7, characterized in that: The nucleic acid molecule detection method comprises the following steps: S1. Extract nucleic acid samples from Escherichia coli O157:H7 samples; S2. Prepare a reaction system mixed solution, wherein the mixed solution includes: a single-stranded DNA reverse cleavage probe, 5 oligonucleotide LAMP primers, a small (single) guide RNA (sgRNA) or its derivatives, a CRISPR-related Cas protein or its variants, a Cas-LAMP one-pot reaction buffer, and a Bst DNA polymerase or its variants; S3, adding the nucleic acid sample to the reaction system mixture, performing a constant temperature reaction, and releasing a fluorescent signal; S4. After the fluorescent probe is cut, it generates a detectable fluorescent signal, which is read and recorded. The fluorescent signal is used to determine the presence of the target nucleic acid molecule in the sample to be tested. The nucleic acid test result is presented in real time in the form of a fluorescence curve.

2. The method for detecting nucleic acid molecules according to claim 1, characterized in that: The nucleic acid molecules to be detected in the nucleic acid sample in step (1) include one or more of single-stranded DNA and double-stranded DNA.

3. The method for detecting nucleic acid molecules according to claim 1, characterized in that: The CRISPR-associated Cas protein or its variant is a nuclease having single-stranded or double-stranded DNA recognition and cleavage functions and single-stranded DNA cleavage functions; the CRISPR-associated Cas protein or its variant includes any one of AacCas12b, AapCas12b, and BrCas12b or any one of their variants.

4. The method for detecting nucleic acid molecules according to claim 1, characterized in that: The single-stranded DNA trans-cleavage probe is a single-stranded DNA, the 5' end of which is labeled with a fluorescent group including but not limited to FAM, HEX, VIC, CY5, CY3, ROX, TAMRA, TET, FITC, and JOE, and the 3' end is labeled with a quenching group including but not limited to TAMRA, BHQ1, MGB, BHQ2, etc. that can be combined with any fluorescent group at the 5' end.

5. The method for detecting nucleic acid molecules according to claim 1, characterized in that: The small guide RNA or its derivative comprises a sequence complementary to the oligonucleotide LAMP primer rfbE-FIP-2; and the oligonucleotide LAMP primer rfbE-FIP-2 sequence is complementary to a partial sequence of one chain of the target molecule and a partial sequence of the small guide RNA or its derivative, and also introduces a PAM site sequence.

6. The method for detecting nucleic acid molecules according to claim 1, characterized in that: The Bst strand displacement DNA polymerase described in step (2) is a DNA polymerase with strand displacement effect, which can displace the downstream DNA chain without template denaturation; the DNA polymerase can be any one of Bst 2.0 DNA polymerase, Bst 3.0 DNA polymerase, Warmstar Bst 2.0 DNA polymerase, Bst LF DNA polymerase, OmniAmp DNA polymerase, etc., or any variant of any one of them.

7. The method for detecting nucleic acid molecules according to claim 1, characterized in that: The spacer sequence of the small guide RNA (sgRNA) or its derivative described in step (2) is complementary to the LAMP product nucleic acid molecule sequence.

8. The method for detecting nucleic acid molecules according to claim 1, characterized in that: The DNA single-stranded trans-cleavage probe described in step (2) is a random TA-rich single-stranded DNA sequence, which can be TTATTATT or TTTTT or TTTTTTTT or other TA-rich single-stranded DNA sequences, and the preferred sequence is TTATTATT; this sequence can be recognized by the CRISPR-Cas protein and non-specifically cleaved.

9. The method for detecting nucleic acid molecules according to claim 1, characterized in that: The main components of the Cas-LAMP one-pot reaction buffer in step (2) include dNTPs, Tris-HCl, MgSO4, KCl, ATP, DTT, (NH4)2SO4, Triton X-100 and mannitol. The preferred reaction buffer includes: 0.18mM-1.62mM dNTPs, 10mM-40mM Tris-HCl, 1.8mM-16.2mM MgSO4, 5mM-20mM KCl, 0.01mM-10mM ATP, 0.5mM-10mM DTT, 5mM-20mM (NH4)2SO4, 0.1%-0.4% Triton X-100 and 100mM-400mM mannitol, with a pH value between 6.5-8.

0.

10. An isothermal nucleic acid detection system (kit) for the nucleic acid detection method for Escherichia coli O157:H7 according to claim 1, characterized in that: The kit includes a single-stranded DNA trans-cleavage fluorescent reporter probe, 5 oligonucleotide LAMP primers, a small (single) guide RNA (sgRNA) or its derivatives, a CRISPR-related Cas protein or its variants, a Cas-LAMP one-pot reaction buffer, and a Bst DNA polymerase or its variants.

Images