RNA m6A modified single cell multi-modal analysis method based on antibody coupled DNA nanocluster probe

Abstract

The invention provides an RNA m6A modified single cell multi-modal analysis method based on an antibody coupled DNA nanocluster probe, which can realize m6A modified fluorescence imaging, mass spectrum quantification and synchrotron radiation high-resolution imaging, and obtain multi-dimensional information related to m6A modified single cells, spatial positioning, quantification and the like. According to the method, an azide group is specifically added into an Fc region of an m6A antibody, so that the damage to an antigen binding site is reduced to the greatest extent, and a metal nanocluster is coupled through a click chemical reaction. The fluorescence property of the metal nanocluster is utilized to realize fluorescence in-situ imaging of m6A modification; the silver element in the probe is coupled with a laser ablation inductively coupled plasma mass spectrometer (LA-ICP-MS) to realize single cell quantification; and performing high-resolution synchrotron radiation imaging by combining synchrotron radiation X-rays. The method has the advantages of high specificity, single cell resolution, high spatial resolution, multi-scale analysis and the like.

Description

Technical Field

[0001] The present invention relates to the field of nucleic acid detection, and in particular to an RNA mRNA detection method based on antibody-coupled DNA nanocluster probes. 6 A modified single-cell multimodal analysis method. Background Art

[0002] m 6 A (N6-methyladenosine) modification is the most common post-transcriptional modification of eukaryotic mRNA and can affect a variety of biological processes at the cellular level.

[0003] The most commonly used high-throughput sequencing-based technologies, such as MERIP-seq and m 6 A-seq technology can analyze mRNAs at the transcriptome level. 6 Although A modification can provide information on RNA methylation levels, it cannot obtain single-cell and spatial location information. It also has problems such as high cost, the need to input a large number of samples, and inaccurate quantification. Later, PCR quantification techniques that rely on enzyme-assisted recognition were developed, such as T3 ligase-PCR and SELECT technology, which can achieve accurate quantification of methylation at specific sites. However, most of these technologies are limited to the level of population cells, ignoring the analysis of cell-to-cell variability and rare cell populations with biological significance, and losing spatial location information. The existing m 6 A RNA imaging technology can achieve quantitative analysis at the single-molecule and single-cell level, but it is difficult to perform in situ analysis and cannot obtain spatial location information; the currently developed m 6 A In situ imaging technology is still limited. For example, MR-FISH is a technology that uses in situ hybridization to detect rRNA methylation in single cells. This work successfully obtained the spatial location information of methylated bases in RNA at the single-cell level and achieved spatial imaging, but it is also difficult to perform m 6 A precise quantification and high-resolution three-dimensional imaging are difficult. Therefore, existing methods can provide transcriptional components, spatial localization and quantitative information respectively, but it is difficult to take into account multiple information dimensions. It is necessary to develop multimodal analysis of single cell m 6 A's technology.

[0004] The present invention couples monoclonal antibodies with DNA nanoclusters to construct a multi-signal integrated nanoprobe targeting m 6 A modification. The fluorescent properties of metal nanoclusters can be used to modify m 6 In situ imaging of RNA in a single cell was achieved by laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS) using the precise molecular formula of the cluster. 6A quantitative analysis of RNA can also be combined with synchrotron radiation soft X-ray spectroscopy microscopy beamline station for high-resolution imaging. Summary of the invention

[0005] In view of the above problems, the present invention aims to provide an RNAm 6 A modified single-cell multimodal analysis method, m 6 A monoclonal antibody is linked to the cluster-targeted DNA sequence through a click chemistry reaction, and then linked to the DNA nanocluster through base complementary pairing, which can target m in a single cell. 6 ARNA is specifically recognized and m 6 Using the precise molecular formula of the probe, single-cell mRNA was detected by laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS). 6 A RNA quantitative analysis. At the same time, high-resolution imaging is performed in conjunction with the synchrotron radiation soft X-ray spectroscopy microscopy beamline station.

[0006] An RNA mRNA probe based on antibody-coupled DNA nanocluster probes 6 A modified single cell multimodal analysis method, the specific scheme is as follows:

[0007] (1) Using hairpin DNA as a template, add silver nitrate solution, stir thoroughly, and then add sodium borohydride solution to reduce it to generate DNA nanoclusters, which form red fluorescence.

[0008] (2) Construction of m-type Fc region-specific addition of azide groups 6 A monoclonal antibody was prepared and alkyne-PEG-active ester (ALK-PEG-NHS) was linked to the antibody via click chemistry.

[0009] (3) Through the coupling reaction between n-hydroxysuccinimide (NHS) and amino groups, a DNA nanocluster targeting sequence (NH 2 -DNA), hybridize the DNA nanoclusters with the target sequences, and construct antibody-coupled DNA nanocluster probes.

[0010] (4) Using NaAsO 2 Treatment induced ACE2-HEK293T cells to produce a large number of stress granules in the cytoplasm. Using stress granule core protein G3BP1 as a marker, m 6 A Co-localization signal of modified RNA and G3BP1.

[0011] (5) Introducing the constructed DNA nanocluster probe into NaAsO 2In cells induced by treatment, antibodies were used to 6 ARNA was accurately identified and single-cell mRNA was observed in situ under laser confocal microscopy. 6 A RNA.

[0012] (6) Laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS) was used to quantify the concentration of silver atoms in a single cell, and then the m 6 A RNA expression level.

[0013] (7) In combination with the synchrotron radiation soft X-ray spectroscopy microscopy beamline, the scanning transmission X-ray microscopy (STXM) of the beamline can be used to perform high-resolution scanning transmission imaging of the spatial structure of cells.

[0014] The following content is a supplement to the technical route in the above solution:

[0015] 1. The hairpin DNA designed in the present invention is an oligonucleotide molecule with a specific structure, which comprises a cytosine base-rich silver atom / ion binding region and a nucleic acid targeting region, and its sequence (5'-3') is: TATCCGTCCTCCTTCCTCCACGGATAAATAAATAAATAAATAAATAA (47nt). NH 2 -DNA sequence: NH 2 -CAAATAGTCATTATTTATTTATTTATTTATTT(32nt).

[0016] 2. The synthesis process of the DNA-silver nanocluster probe described in the present invention is as follows: 368 μL of 25 μM hairpin DNA solution and 100 μL of 150 μM silver nitrate solution are mixed evenly, stirred for 4 minutes, and then 110 μL of 50 μM sodium borohydride solution is added to the solution, and stirred at 4°C for 6 hours to reduce the silver nitrate to obtain silver nanoclusters.

[0017] 3. Monoclonal antibodies specifically add azide groups to the Fc region 6 A monoclonal antibody. This antibody was obtained from Thermo Fisher Scientific SiteClick TM Antibody Azide Modification Kit was used according to the kit instructions. After modification, the samples were stored at -20°C.

[0018] 4. Click chemistry reaction conditions are as follows: add 8 μL of 1 mg / ml monoclonal antibody solution, 20 μL of 25 mM ALK-PEG-NHS solution, and 1 mM CuSO 410 μL of the solution, 10 μL of the 5 mM sodium ascorbate solution, and 5 μL of the 2 mM BTTAA solution were stirred at 40°C overnight under a nitrogen atmosphere.

[0019] 5. The coupling reaction conditions are: take 2 μL of the solution in step (2), 25 μM NH 2 -DNA solution 2μL, DMSO 10μL, 300mM Na 2 CO 3 Solution 2μL, DEPC water 4μL, reaction temperature 28℃, reaction time 30min.

[0020] 6. NaAsO of the present invention 2 The solution was diluted with DMEM medium solution containing 10% (v / v) serum to a final concentration of 0.5 mM, stored in the dark, and incubated with ACE2-HEK293T cells at 37° C. for 1 h.

[0021] 7. The antibody and target were incubated for 1.5 h. When performing laser confocal imaging, a 60x oil objective was selected and four channels, DAPI, GFP, RFP and TD, were selected for photographing and image storage.

[0022] 8. Laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS) was used to quantify the concentration of silver atoms within single cells, with the spot size set to 35 μm to ensure that the boundaries of the cells were completely covered and there was no overlap with adjacent cells.

[0023] 9. 2-7×10 4 ACE2-HEK293T cells were seeded on silicon nitride windows and incubated with antibody-coupled DNA nanocluster probes in a cell culture incubator at 37°C for 1 h, followed by dehydration with gradient ethanol concentrations. The concentrations of the ethanol solutions were: 15% (v / v), 35% (v / v), 55% (v / v), 75% (v / v), 85% (v / v), 95% (v / v), and dehydration was performed for 5 min at each concentration.

[0024] An RNA mRNA probe based on antibody-coupled DNA nanocluster probes 6 The technical principle of the A modified single cell multimodal analysis method is as follows: This method is used in m 6 A monoclonal antibody Fc region specifically adds an azide group, using the antibody to specifically recognize m 6 ARNA. Then, the target DNA of the DNA nanocluster is coupled through click chemistry reaction, and the DNA cluster is connected by nucleic acid complementary pairing. The fluorescent properties of metal nanoclusters can be used to achieve m 6In situ imaging of RNA in a single cell was achieved by laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS), using the property of clusters with precise molecular formula. 6 A. Quantitative analysis of RNA. High-resolution imaging was performed in conjunction with the synchrotron radiation soft X-ray spectroscopy microscopy beamline.

[0025] An RNAm probe based on antibody-coupled DNA nanocluster probes 6 Compared with the existing technology, the A modified single cell multimodal analysis method has the following beneficial effects:

[0026] (1) For m 6 A modified RNA is specifically recognized. The specific addition of an azide group to the Fc region of a monoclonal antibody can minimize the destruction of the antigen binding site and retain binding affinity compared to non-site-specific labeling.

[0027] (2) For m 6 The antibody-coupled DNA nanocluster probes are introduced into fixed cells, and the fluorescent properties of the clusters are used to image the target in situ. The spatial location of methylated transcripts in cells can be visualized, which is helpful for understanding m 6 How A regulates various physiological processes spatially.

[0028] (3) For m 6 A modified RNA was used for single cell quantification. Red fluorescent silver nanoclusters with precise molecular composition were designed and synthesized using DNA as a template. The molecular formula is (Ag) 8 (DNA) 1 Combined with laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS), single-cell RNAm 6 Quantitative analysis of A modifications.

[0029] (4) High-resolution single-cell imaging. Combined with the synchrotron soft X-ray spectroscopy microscopy beamline, the scanning transmission X-ray microscopy (STXM) of the beamline can perform scanning transmission imaging of spatial structures with a resolution of 30 nm and high-resolution imaging of specific elements in a substance and dual-energy contrast imaging of their content. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1A , 1B (Ag) of Example 1 of the present invention 8 (DNA) 1 Synthesis time and concentration optimization diagram of silver nanoclusters

[0031] Figure 2 (Ag) of Example 1 of the present invention 8 (DNA) 1Fluorescence spectrum of silver nanoclusters

[0032] Figure 3 (Ag) of Example 1 of the present invention 8 (DNA) 1 Matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF-MS) of silver nanoclusters

[0033] Figure 4 (Ag) of Example 1 of the present invention 8 (DNA) 1 DLS particle size distribution of silver nanoclusters

[0034] Figure 5 Example 2 of the present invention is a flow chart for preparing antibody-coupled DNA nanocluster probes

[0035] Figure 6 This is the polyacrylamide gel electrophoresis image of the antibody-coupled DNA nanocluster probe of Example 2 of the present invention

[0036] Figure 7 This is a laser confocal microscopy image of the antibody-coupled DNA nanocluster probe in Example 3 of the present invention in ACE2-HEK293T cells

[0037] Fig. 8A , 8B The laser ablation inductive coupling standard curve and standard sample point diagram of the antibody-coupled DNA nanocluster probe of Example 4 of the present invention

[0038] Fig.9A , 9B In Example 4 of the present invention, NaAsO 2 Stimulated and No NaAsO 2 Laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS) signal diagram of two stimulation conditions, 9C is the difference analysis diagram of the two conditions

[0039] Fig.10 This is a scanning transmission imaging diagram of a high-resolution spatial structure using scanning transmission X-ray microscopy (STXM) according to Example 5 of the present invention. DETAILED DESCRIPTION

[0040] The following embodiments are intended to facilitate a better understanding of the present invention, and provide a clear and complete description of the technical solutions in the embodiments of the present invention, which should not be construed as limiting the scope of protection of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0041] Unless otherwise specified, all experimental materials, reagents and equipment in the examples can be obtained through conventional purchasing channels.

[0042] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0043] The quantitative tests in the following examples were all repeated three times, and the results were averaged.

[0044] Example 1: Silver nanoclusters (Ag) with precise DNA molecular numbers 8 (DNA) 1 Preparation

[0045] 368 μL of 25 μM hairpin DNA solution with the sequence of TATCCGTCCTCCTTCCTCCACGGATAAATAAATAAATAAATAAATAA (47 nt) and 100 μL of AgNO 3 The (150 μM) solution was mixed evenly and stirred for 4 min. Then 110 μL NaBH 4 The (50 μM) solution was added to the above mixed solution and stirred at 4 °C for 6 h to reduce AgNO 3 The synthesized silver nanoclusters were separated and purified by centrifugal filters (Millipore, 50 kDa and 3 kDa MWCO membranes) to cut off the aggregated nanoclusters and free ions. Then, the silver nanoclusters were purified by HPLC system (Agilent 1260 Infinity, USA). The HPLC column was C18 column ( 30×4.6mm), 0.01M trimethylamine acetate buffer as the mobile phase, acetonitrile as the modifier, and UV detection wavelength of 260nm were used to purify and collect the silver nanoclusters. The silver nanoclusters were stored at 4°C in the dark before further use. The synthesized silver nanoclusters showed pink color under visible light and red fluorescence under UV light. Figure 1A , 1B As shown, the optimization diagram of the synthesis time and concentration of silver nanoclusters, the optimal synthesis time is 6h, and the optimal DNA concentration is 50μM.

[0046] like Figure 2 As shown, the fluorescence spectrum shows that the best fluorescence excitation peak of silver nanoclusters is 540nm, and the best fluorescence emission peak is at 630nm.

[0047] like Figure 3 As shown in Figure 2, the results of matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF-MS) showed that eight silver atoms were bound to one DNA chain, and it can be concluded that the composition of the silver nanocluster is (Ag) 8 (DNA) 1 .

[0048] like Figure 4 As shown, (Ag) 8 (DNA) 1 The hydrated particle size measured by DLS was 3.22 nm.

[0049] Example 2: Preparation of antibody-coupled DNA nanocluster probes

[0050] The preparation process of antibody-coupled DNA nanoclusters is as follows Figure 5 As shown, 40 μL of 1 mg / ml m 6 A monoclonal antibody solution using Thermo Fisher SiteClick TM The antibody azide modification kit was used to modify the Fc region to specifically add an azide group. 6 A monoclonal antibody. Then it was purified by HPLC system (Agilent 1260 Infinity, USA), and the HPLC column was C18 column ( 30×4.6mm), the mobile phase was 0.01M trimethylamine acetate buffer, acetonitrile was the modifier, and the modified antibody solution was purified and collected at 260nm. The antibody solution was concentrated to 1mg / ml by a centrifugal filter (Millipore, 50kDa MWCO membrane). OD280=1.4 was measured by an ELISA absorbance detection system. Then, the click chemistry reaction of azide and alkyne was carried out, and 8μL of 1mg / ml monoclonal antibody solution, 20μL of 25mM ALK-PEG-NHS solution, and 1mM CuSO were added to a 200μL EP tube. 4 10 μL of solution, 10 μL of 5 mM sodium ascorbate solution, and 5 μL of 2 mM BTTAA solution were stirred at 40°C overnight under nitrogen atmosphere. Then, the coupling reaction between NHS and amino groups was carried out. 2 μL of solution in the EP tube in the previous step, 25 μM NH 2 -DNA solution 2μL, DMSO 10μL, 300mM Na 2 CO 3 2 μL of solution and 4 μL of DEPC water, reaction temperature was 28°C, and reaction time was 30 min. Finally, 10 μL of the previous solution and 10 μL of 20 μM silver nanocluster solution were taken respectively, and reacted at 37°C for 1 h. The coupled antibody probe was separated and purified by a centrifugal filter (Millipore, 50 kDa MWCO membrane).

[0051] like Figure 6 As shown, polyacrylamide gel electrophoresis characterized the molecular weight of the heavy chain before and after modification. The molecular weight of the heavy chain after modification increased by 10KD compared with that before modification. The increased molecular weight is NH 2 -Molecular weight of the DNA sequence.

[0052] Example 3: Confocal laser microscopy localization study of antibody-coupled DNA nanoclusters on ACE2-HEK293T cells

[0053] The density is 2-7×10 4 ACE2-HEK293T cells were seeded on glass slides and divided into two groups, respectively, in the presence or absence of NaAsO 2 The cells were cultured in a 37°C cell culture incubator for 1 h in the presence of NaAsO 2 Dilute with DMEM medium solution containing 10% (v / v) serum to a final concentration of 0.5mM. Then, wash the cells with PBS and fix with 4% (v / v) paraformaldehyde solution for 15min, and then wash with PBS. Treat with 0.5% (v / v) Triton X-100 solution for 5min, then wash with PBS. Incubate the cells with 5% (v / v) BSA solution at 37°C for 1h. The hybridization of the antibody-coupled DNA nanocluster probe with the target mRNA was carried out in a 20μL system. 10μL of the purified probe solution in Example 2 was mixed with 10μL of 1% (v / v) G3BP1 antibody solution, and then incubated with ACE2-HEK293T cells seeded on glass slides in a 37°C cell culture incubator for 1.5h. Then wash the cells with PBS-T solution [DEPC-PBS solution containing 0.05% (v / v) Tween-20] for 3min. Add 2% (v / v) (Alexa 488) goat anti-mouse antibody solution 20 μL, and incubate with the cells on the glass slide in a cell culture incubator at 37°C for 1 hour. Then add Fluoromount-G [containing 4',6-diamidino-2-phenylindole (DAPI)] to counterstain the cell nucleus, mount the coverslip and start imaging. Finally, use UltraVIEW Vox (PerkinElmer) confocal laser scanning system accessory and Nikon microscope to image the cells.

[0054] The results are as follows Figure 7 As shown in the figure, under confocal microscopy, the synthesized probe has a good imaging effect in situ in ACE2-HEK293T cells, and the red fluorescence is the intracellular m 6 A modified RNA. The green fluorescence is the G3BP1 protein in the stress granules in a single cell. As can be seen from the figure, the two are clearly co-localized.

[0055] Example 4: mRNA expression on single ACE2-HEK293T cells by laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS) 6 A RNA quantitative analysis.

[0056] LA-ICP-MS measurements were performed using a NWR 213 laser ablation system and a Nexion 300D ICP-MS instrument (PerkinElmer, Norwalk, CT, USA). Helium was used as the ablation gas. The flow rate of helium was 0.6 L min -1 After cell ablation, argon gas was injected through the Y-shaped tube. During the ablation process, the 115In signal intensity was adjusted to the maximum value. The signal intensity was recorded as a function of time (counts per second (CPS)). We seeded ACE2-HEK293T cells (2-7×10 4 ), 10 μL of the purified probe solution in Example 2 was taken and incubated with the inoculated ACE2-HEK293T cells in a 37°C cell culture incubator for 1.5 h. In order to enable the laser to completely ablate a single cell, an area with a diameter of 35 μm was ablated at the corresponding cell position. The diameter was selected to ensure that the cell boundary was completely covered by the laser and did not overlap with adjacent cells.

[0057] like Fig. 8A , 8B This is the standard curve and standard sample points of silver in LA-ICP-MS.

[0058] like Fig.9A , 9B , 9C, compared with the absence of NaAsO 2 Compared with NaAsO 2 After stimulation, single cell m 6 A concentration decreased significantly. A single signal intensity peak is the m in situ of a single cell. 6 A RNA.

[0059] Example 5: In combination with the synchrotron radiation soft X-ray spectroscopy microscopy beamline, the scanning transmission X-ray microscopy (STXM) of the beamline can be used to perform high-resolution scanning transmission imaging of spatial structures.

[0060] ACE2-HEK293T (2-7×10 4 Cells were seeded on silicon nitride windows and divided into two groups, with or without NaAsO 2 The cells were incubated in a 37°C cell culture incubator for 1 h in the presence of NaAsO 2Dilute with DMEM medium solution containing 10% (v / v) serum to a final concentration of 0.5mM. Then, wash the cells with PBS and fix with 4% (v / v) paraformaldehyde solution for 15min, and wash with PBS. Treat with 0.5% (v / v) Triton X-100 solution for 5min, then wash with PBS. Incubate with 5% (v / v) BSA solution at 37°C for 1h. Subsequently, hybridization of the antibody-coupled DNA nanocluster probe with the target mRNA was performed, and 20μL of the coupled and purified antibody in Example 2 was incubated with ACE2-HEK293T cells in a 37°C cell culture incubator for 1.5h. Then, the sample was washed with PBS-T solution [DEPC-PBS solution containing 0.05% (v / v) Tween-20] for 3 min, and dehydrated with ethanol gradient concentrations. The concentrations of the ethanol solutions were: 15% (v / v), 35% (v / v), 55% (v / v), 75% (v / v), 85% (v / v), 95% (v / v), and dehydrated for 5 min at each concentration. The radiation energy was set to 642 eV, and the step size was 0.05 μm for scanning and shooting. Fig.10 As shown, with no NaAsO 2 Compared with NaAsO 2 After stimulation, obvious stress granules were found in the cells. The three-dimensional images also successfully demonstrated that 6 Spatial distribution of A sites.

Claims

1. An RNAm based on antibody-coupled DNA nanocluster probe 6 A modified single cell multimodal analysis method, characterized in that, The following steps are involved: (1) Using hairpin DNA as a template, adding silver nitrate solution, stirring thoroughly, and then adding sodium borohydride solution to reduce it to generate DNA nanoclusters that emit red fluorescence; (2) Construction of m-type Fc region-specific addition of azide groups 6 A monoclonal antibody, and linked alkyne-PEG-active ester ALK-PEG-NHS to the antibody by click chemistry reaction; (3) adding a DNA nanocluster targeting sequence NH2-DNA to the monoclonal antibody through a coupling reaction between n-hydroxysuccinimide NHS and amino groups, hybridizing the DNA nanocluster with the targeting sequence, and constructing an antibody-coupled DNA nanocluster probe; (4) NaAsO2 was used to induce ACE2-HEK293T cells to produce stress granules in the cytoplasm. Using stress granule core protein G3BP1 as a marker, m 6 A Co-localization signal of modified RNA and G3BP1; (5) The constructed antibody-coupled DNA nanocluster probe was introduced into cells induced by NaAsO2 treatment, and the antibody was used to bind to m 6 ARNA was identified and mRNA in single cells was observed in situ under laser confocal microscopy. 6 ARNA; (6) Laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS) was used to quantify the concentration of silver atoms in a single cell, and then the m 6 ARNA expression; (7) In combination with the synchrotron radiation soft X-ray spectroscopy microscopy beamline, the scanning transmission X-ray microscopy (STXM) of the beamline was used to perform scanning transmission imaging of cells.

2. RNAm based on antibody-coupled DNA nanocluster probe according to claim 1 6 A modified single cell multimodal analysis method, characterized in that, The hairpin DNA sequence (5'-3') is: TATCCGTCCTTCCTCCACGGATAAATAAATAAATAAATAAATAA (47 nt); the NH2-DNA sequence is: NH2-CAAATAGTCATTATTTATTTATTTATTTATTT (32 nt).

3. RNAm based on antibody-coupled DNA nanocluster probe according to claim 1 6 A modified single cell multimodal analysis method, characterized in that, In step (1), the synthesis process of the silver nanoclusters is as follows: 368 μL of 25 μM hairpin DNA solution and 100 μL of 150 μM silver nitrate solution are mixed evenly, stirred for 4 minutes, and then 110 μL of 50 μM sodium borohydride solution is added to the mixed solution, and stirred at 4°C for 6 hours to reduce the silver nitrate to obtain silver nanoclusters.

4. RNAm based on antibody-coupled DNA nanocluster probe according to claim 1 6 A modified single cell multimodal analysis method, characterized in that, In step (2), the monoclonal antibody is an Fc region-specific azide group added to the 6 A monoclonal antibody.

5. RNAm based on antibody-coupled DNA nanocluster probe according to claim 1 6 A modified single cell multimodal analysis method, characterized in that, In step (2), the click chemistry reaction conditions are: add 8 μL of 1 mg / ml monoclonal antibody solution, 20 μL of 25 mM ALK-PEG-NHS solution, 10 μL of 1 mM CuSO4 solution, 10 μL of 5 mM sodium ascorbate solution, and 5 μL of 2 mM BTTAA solution, and stir at 40°C overnight under a nitrogen environment.

6. RNAm based on antibody-coupled DNA nanocluster probe according to claim 1 6 A modified single cell multimodal analysis method, characterized in that, In step (3), the coupling reaction conditions are: take 2 μL of the solution in step (2), 2 μL of 25 μM NH2-DNA solution, 10 μL of DMSO, 2 μL of 300 mM Na2CO3 solution, and 4 μL of DEPC water, the reaction temperature is 28°C, and the reaction time is 30 min.

7. RNAm based on antibody-coupled DNA nanocluster probe according to claim 1 6 A modified single cell multimodal analysis method, characterized in that, In step (4), the NaAsO2 solution has a final concentration of 0.5 mM and is incubated with ACE2-HEK293T cells at 37°C for 1 h.

8. RNAm based on antibody-coupled DNA nanocluster probe according to claim 1 6 A modified single cell multimodal analysis method, characterized in that, In step (5), the antibody and ACE2-HEK293T cells were co-incubated at 37° C. for 1.5 h. During the laser confocal imaging operation, a 60x oil objective was selected, and four channels, DAPI, GFP, RFP and TD, were selected for photographing and image storage.

9. RNAm based on antibody-coupled DNA nanocluster probe according to claim 1 6 A modified single cell multimodal analysis method, characterized in that, In step (6), 2-7×10 ACE2-HEK293T cells were seeded on the coverslip. 4 The cells were co-incubated with antibody-coupled DAN nanocluster probes at 37°C for 1.5 h. In order to completely ablate a single cell with the laser, an area with a diameter of 35 μm was ablated at the corresponding cell position. The diameter was selected to ensure that the cell boundaries were completely covered and there was no overlap with adjacent cells.

10. RNAm based on antibody-coupled DNA nanocluster probe according to claim 1 6 A modified single cell multimodal analysis method, characterized in that, In step (7), ACE2-HEK293T (2-7×10 4 The cells were seeded on a silicon nitride window and incubated with the constructed probe at 37°C for 1.5 h, followed by dehydration with gradient ethanol concentrations. The concentrations of the ethanol solutions were: 15% (v / v), 35% (v / v), 55% (v / v), 75% (v / v), 85% (v / v), and 95% (v / v), and dehydration was performed for 5 min at each concentration.

Images