Application of CPT1A inhibitor in preparation of medicine for inhibiting melanoma metastasis
By targeting the fatty acid metabolism pathway regulated by CPT1A, CPT1A inhibitors were developed, which solved the problem of difficulty in inhibiting melanoma metastasis in the prior art, and achieved specific inhibition and safety improvement of melanoma metastasis.
Patent Information
- Application Number
- CN202411971045.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-30
- Publication Date
- 2025-03-14
AI Technical Summary
The prior art is difficult to effectively inhibit melanoma metastasis, especially under the limitations of the blood-brain barrier and lung microenvironment, traditional drugs cannot accurately interfere with the metastasis and infiltration of tumor cells.
By targeting the fatty acid metabolism pathway regulated by CPT1A, CPT1A inhibitors, such as Etomoxir, ST1326, siRNA or shRNA, interfere with the energy metabolism needs of tumor cells and inhibit tumor metastasis.
The specific inhibition of melanoma metastasis was achieved, the limitations of the blood-brain barrier and lung microenvironment were overcome, the growth and migration ability of metastatic tumors was significantly reduced, and the targeting and safety of treatment were improved.
Smart Images
Figure CN119607211A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and in particular to application of a CPT1A inhibitor in preparing a drug for inhibiting melanoma metastasis. Background Art
[0002] Tumors are major diseases that threaten human health, and their incidence and mortality rates are increasing year by year worldwide. Tumor metastasis is a major feature of malignant tumors and an important cause of death in patients. Metastasis refers to the process in which primary tumor cells break through the barrier of their initial tissues, invade the blood or lymphatic system, and form new tumor foci at a distant site. Its occurrence involves complex biological mechanisms, including tumor cell invasion, angiogenesis, circulation transport, heterogeneous growth, and immune escape. Fatty acid metabolism is one of the important metabolic pathways for tumor cells to maintain rapid growth and migration. Studies have shown that fatty acid oxidation (FAO) not only provides energy for tumor cells, but also promotes tumor invasion and metastasis by regulating the tumor microenvironment and enhancing immune escape ability.
[0003] Brain metastasis and lung metastasis are among the most common and fatal complications in patients with advanced malignancies, with extremely high incidence and mortality rates. The occurrence of brain metastasis is mainly limited by the blood-brain barrier (BBB). This physiological barrier greatly limits the ability of chemotherapeutic drugs, targeted drugs, etc. to enter the central nervous system, resulting in poor treatment effects. On the other hand, as one of the main target organs for tumor cell metastasis, the lung also provides suitable conditions for the growth of metastatic tumors due to its rich vascular network and specific microenvironment. However, for the treatment of lung metastasis, existing drugs are usually unable to accurately intervene in the infiltration and colonization of tumor cells in the lung microenvironment. Existing drugs for the treatment of tumor metastasis mainly focus on chemotherapy, targeted therapy and immunotherapy, but have the following defects: (1) Due to their high heterogeneity, metastatic tumor cells are prone to develop resistance to existing treatments through gene mutations or signal pathway reprogramming, thereby reducing or even ineffective treatment effects. (2) While inhibiting tumor metastasis, they often cause damage to normal tissues and organs, such as severe toxicity caused by chemotherapy or interference of targeted therapy with other normal signal pathways.
[0004] Melanoma is a malignant tumor originating from melanocytes. Its incidence has increased significantly in recent years, especially in areas with high UV exposure. Although melanoma can usually be cured by surgery in the early stage, once it develops to the late stage and metastasizes, its prognosis is extremely poor, and the five-year survival rate is significantly reduced. Melanoma has a strong metastatic ability and is the main cause of death in patients. The biological process of melanoma metastasis is extremely complex and involves multiple links, including tumor cell invasion of the basement membrane, angiogenesis, the formation of circulating tumor cells (CTCs), immune escape in the blood circulation, and colonization and growth in distal tissues. Metastatic tumor cells usually have higher heterogeneity and adaptability to survive and grow in the new microenvironment, which makes the current drugs designed for highly expressed targets in primary tumors may be lowly expressed or even absent in metastatic tumors, resulting in decreased drug efficacy. Some drugs can inhibit the growth or invasion of primary tumors, but cannot prevent the colonization of circulating tumor cells (CTCs) in distal tissues or inhibit the further development of metastatic tumors.
[0005] Therefore, it is urgent to comprehensively consider the specific mechanisms of tumor metastasis process and site, and combine the selectivity of drug targets and the precision of drug delivery to develop more effective treatment strategies. Summary of the invention
[0006] In view of the defects in the prior art, the present invention proposes the use of CPT1A inhibitors in the preparation of drugs for inhibiting melanoma metastasis. The present invention inhibits tumor metastasis by intervening in the fatty acid metabolism of tumor cells, especially the β-oxidation pathway regulated by CPT1A, and provides an innovative solution for the treatment of tumor metastasis.
[0007] The present invention provides the use of a CPT1A inhibitor in preparing a drug for inhibiting tumor metastasis.
[0008] In some embodiments, the tumor is melanoma, breast cancer, or lung cancer.
[0009] In some embodiments, the metastasis is a brain metastasis or a lung metastasis.
[0010] In some embodiments, the CPT1A inhibitor is Etomoxir, ST1326, siRNA or shRNA; the sequence of the shRNA is shown in SEQ ID NO.1 or SEQ ID NO.2.
[0011] In some embodiments, the medicament includes a pharmaceutically acceptable carrier and / or a pharmaceutically acceptable carrier.
[0012] In some embodiments, the pharmaceutically acceptable carrier may be any one or more of a buffer, an emulsifier, a suspending agent, a stabilizer, a preservative, an excipient, a filler, a coagulant, a conditioning agent, a surfactant, a dispersant, and a defoaming agent.
[0013] In some embodiments, the pharmaceutical carrier is any one or more of a virus, a microcapsule, a liposome, a nanoparticle, and a polymer.
[0014] In some embodiments, the drug comprises a second active substance, which is an immune checkpoint inhibitor, such as a CTLA-4 inhibitor or a PD-1 inhibitor.
[0015] In summary, compared with the prior art, the present invention achieves the following technical effects:
[0016] 1. The present invention precisely intervenes in the energy metabolism needs of tumor cells by targeting the fatty acid metabolism pathway regulated by CPT1A, thereby effectively inhibiting the migration and infiltration capabilities required in the process of tumor metastasis. Especially in the treatment of brain metastasis and lung metastasis, the present invention overcomes the limitations of the blood-brain barrier and the lung microenvironment and achieves specific inhibition of metastatic tumors.
[0017] 2. The present invention has little effect on normal tissue cells by intervening in the specific target of fatty acid metabolism, thus avoiding the extensive toxic effects of traditional chemotherapy drugs and targeted drugs on normal cells and tissues. In addition, the present invention has good tissue targeting, reduces the toxic side effects caused by systemic distribution, and thus significantly improves the patient's treatment tolerance and safety. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.
[0019] Figure 1 The results of metabolic communication analysis of the melanoma metastasis model in Example 1 of the present invention; Figure 1 A is single-cell transcriptome data, Mel-167brain represents melanoma brain metastasis, and the others are various cells in the tumor microenvironment; Figure 1 B is the metabolic communication results of melanoma metastases and microenvironment cells analyzed by Mebocost; Figure 1 C is the result of Mebocost analysis, where the first column shows the output cells of the metabolites, the second column shows the output metabolites, the third column shows the cell types that receive the metabolites through receptors, and the fourth column shows the specific cells that receive the metabolites; Figure 1 D is the expression distribution diagram of receiver in each cell type in metabolic communication; Figure 1 E is the enrichment score analysis result of fatty acid β-oxidation; Figure 1 F is the metabolome analysis of mouse brain metastasis and normal mouse brain; Figure 1 G is the pathway enrichment analysis of differential metabolites in metabolomics data; Figure 1 H is the difference analysis of the content of four long-chain fatty acids in brain metastasis and normal brain.
[0020] Figure 2 This is the spatial metabolomics analysis and cell proliferation effect of the melanoma mouse brain metastasis model in Example 2 of the present invention; Figure 2 A is a schematic diagram of the spatial metabolomics of the Mel-167 cardiac injection mouse model; Figure 2 B is the HE staining result of brain metastasis; Figure 2 C is the spatial metabolomics analysis of the distribution of L-carnitine in various tissues; Figure 2 D is the volcano plot of differential metabolites between tumor and adjacent tissues in the spatial metabolome; Figure 2 E is the intensity comparison of L-carnitine in tumor, adjacent to cancer and normal brain tissue; Figure 2 F is the cell proliferation result after L-carnitine treatment; Figure 2 G is the imaging results of L-carnitine and control mice model; Figure 2 H is the fluorescence intensity statistics of mouse model.
[0021] Figure 3 The relationship between fatty acid oxidation and tumor metastasis, drug resistance and immunotherapy response in Example 3 of the present invention; Figure 3 A is the result of CPT1A immunohistochemical staining in brain metastasis and lung metastasis tissues; Figure 3 B is the comparison of fatty acid β-oxidation scores in single-cell transcriptome data; Figure 3 C is the analysis of the relationship between fatty acid oxidation and immunotherapy response; Figure 3 D is the relationship between fatty acid oxidation score and Enza resistance progression in prostate cancer; Figure 3 E is the result of cell proliferation experiment after knocking down CPT1A; Figure 3 F shows the results of cell invasion experiment after knocking down CPT1A; Figure 3 G is the imaging result of mouse animal experiment; Figure 3 H is the experimental result of cell viability treated with etomoser; Figure 3 I is the fluorescence intensity curve result of animal experiment.
[0022] Figure 4 This is an analysis of the role of SREBP2 in cholesterol synthesis and fatty acid metabolism in Example 4 of the present invention; Figure 4A is the enrichment analysis of down-regulated genes in the transcriptome data of etomoser (ETO) and control group; Figure 4 B is the GSEA enrichment analysis of SREBP2 downstream target genes; Figure 4 C is the survival curve analysis of SREBP2 target genes in the TCGA dataset; Figure 4 D is the expression heat map of SREBP2 target genes in transcriptome data; Figure 4 E is the enrichment analysis of pathways positively and negatively correlated with fatty acid metabolism; Figure 4 F-G are the correlation analysis between fatty acid metabolism and SREBP2 target genes in tumor, paracancerous, TCGA and CCLE data; Figure 4 H is the confocal microscopy result of the protein amount and nuclear entry of SREBP2 after etomosher (ETO) treatment; Figure 4 I is the Western Blot result; Figure 4 J is the gene with the strongest correlation with SREBP2 in the melanoma public data; Figure 4 K is the Western Blot analysis results of SREBP2, HMGCR, CPT1A and FDPS protein levels after etomosher (ETO) treatment; Figure 4 L is the result of Kaplan-Meier survival curve analysis; Figure 4 M is the animal imaging result after knocking down FDPS; Figure 4 N is the fluorescence intensity diagram after knocking down FDPS. DETAILED DESCRIPTION
[0023] In order to enable those skilled in the art to better understand the solutions of the present invention, the technical solutions in the embodiments of the present invention are clearly and completely described. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of the present invention.
[0024] The present invention discloses the use of a CPT1A inhibitor in the preparation of a drug for inhibiting melanoma metastasis, and inhibits melanoma metastasis by targeting the expression or activity of CPT1A (carnitine palmitoyltransferase 1A). CPT1A is a key enzyme for fatty acids to enter mitochondria for β-oxidation, and plays an important role in cellular energy metabolism and fatty acid metabolism. The present invention experimentally finds that the expression of CPT1A in melanoma cells is significantly higher than that in normal tissues, especially in metastatic lesions, and shows higher activity. Through observation in a mouse model, CPT1A plays a promoting role in the process of melanoma metastasis, especially by regulating fatty acid metabolism, providing energy for tumor cells, and supporting their rapid growth and metastasis. Melanoma cells are treated with RNA interference technology and the CPT1A inhibitor Etomoxir, and it is found that the inhibition of CPT1A can significantly slow down the migration and invasion ability of tumor cells. In a mouse brain metastasis model, the CPT1A inhibitor Etomoxir is injected, and it is observed that the brain metastasis lesions of the mice in the treatment group are significantly reduced, and the fluorescence imaging results show that Etomoxir significantly inhibits the growth of melanoma metastatic lesions. In addition, the survival of mice in the Etomoxir-treated group was prolonged, indicating that it has potential clinical application prospects. Compared with traditional chemotherapy and immunotherapy, this method has lower side effects and higher therapeutic targeting, and can provide a new therapeutic strategy for the clinical treatment of melanoma.
[0025] The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials and reagents used are all commercially available unless otherwise specified.
[0026] Example 1 Establishment of Melanoma Mel-167 Cell Line Brain Metastasis Mouse Model and Single Cell Transcriptome Data Analysis
[0027] Mel-167 melanoma cell line containing GFP-Luciferase was prepared into 8×10 6 After the mice were anesthetized, 100 μL of Mel-167 cell suspension was injected through the heart, and then the small animal imaging system (IVIS) was used to track the metastatic location and number of tumor cells in the animal model. During imaging, Luciferin dilution was injected intraperitoneally (IP) into the mouse model. The luminescent signal reached a peak within 10 to 15 minutes, and the signal recorded at this time was relatively correct data.
[0028] When the light signal is close to 10 9At the same time, the mice were euthanized and the experimental animal model was obtained. The obtained cells were processed for single-cell library construction and single-cell transcriptome sequencing. Seurat was used to standardize the single-cell gene expression data and perform functional clustering analysis on the cells. Subsequently, the cells were grouped and annotated using the existing database, and the UMAP dimensionality reduction algorithm was used to achieve data visualization. The Mebocost algorithm was used to analyze the metabolic communication between melanoma metastases and microenvironment cells.
[0029] The results are as follows:
[0030] like Figure 1 As shown, Figure 1 A is the UMAP dimensionality reduction plot of single-cell transcriptome data of the brain metastasis mouse model. Figure 1 B shows the metabolic communication between melanoma metastases and microenvironment cells analyzed using Mebocost. Figure 1 The Mebocost analysis results of C showed that Mel-167 metastatic tumors took up more long-chain fatty acids in the microenvironment. Figure 1 In D, the key roles of tumor cells (Mel167.brain), macrophages (MG), and astrocytes (AST) in metabolic communication are shown. Figure 1 The enrichment score analysis of E fatty acid β-oxidation showed that the fatty acid β-oxidation activity of Mel-167 metastatic tumors was significantly stronger than that of microenvironment cells, suggesting that they rely on fatty acid metabolism to support tumor proliferation and metastasis. Figure 1 In F, the metabolome of mouse brain metastases was compared with that of normal mouse brain, showing that long-chain fatty acids, L-carnitine and its derivatives were significantly higher in Mel-167 metastases. Figure 1 Pathway enrichment analysis of differential metabolites in G metabolomics data revealed the upregulation of fatty acid metabolism and other related pathways during tumor metastasis. Figure 1 The results of the differential analysis of the contents of four long-chain fatty acids in brain metastases and normal brain showed that the content of long-chain fatty acids in metastatic tumors was significantly higher than that in normal brain.
[0031] Example 2 Spatial metabolomics analysis of L-carnitine in melanoma metastasis and its effect on cell proliferation
[0032] The melanoma Mel-167 mouse brain metastasis model established by cardiac injection is shown in the schematic diagram. Figure 2 As shown in A, the brain tissues of mice were collected after injection and used for spatial metabolomics analysis. The expression levels of CPT1A were detected in melanoma brain metastases, lung metastases and adjacent tissues by immunohistochemistry (IHC), Western Blot and qPCR techniques, respectively.
[0033] To verify the effect of L-carnitine in the cell model, the cell proliferation experiment process is to plate in a 96-well plate, set up 3 replica wells for each cell type, and the time of plating is recorded as day 0. The detection method is to add 50μL CellTiter to each well. TM The reagent was incubated in the dark for 5 min, and then the luminescence value was measured to represent the cell activity. The cell activity was measured on days 0, 2, and 4 as the result of cell proliferation. The concentration of L-carnitine treatment was set to 0 μM, 5 μM, and 10 μM.
[0034] To verify the effect of L-carnitine in animal models, L-carnitine solution (100 mg / kg, solvent is 1×PBS solution) was injected intraperitoneally on the basis of the mouse heart injection model, once every five days. The small animal imaging system (IVIS) was used to track the metastatic location and number of tumor cells in the animal model, with each imaging interval of 5 to 8 days. The signal location and intensity represent the location and growth status of tumor cells in the mouse body.
[0035] The results are as follows:
[0036] Figure 2 The HE staining results in B show the morphological differences between melanoma brain metastases and normal control tissues. The metastatic tumor area shows typical tumor cell morphology and has a clear boundary with the surrounding normal tissues. Figure 2 C shows the distribution of L-carnitine in various tissues in the spatial metabolomics analysis. By using mass spectrometry imaging technology, L-carnitine showed a higher intensity in the brain metastasis area, showing its enrichment in the tumor metastasis site. The figure shows the difference in L-carnitine concentration in different tissue regions through heat maps or intensity distribution maps. Figure 2 The volcano plot in D shows the differential metabolites between tumor tissue and adjacent tissue in the spatial metabolome analysis. By comparing the expression differences of metabolites in the two tissues, the figure clearly marks the metabolites that are significantly upregulated or downregulated. Figure 2 E The results showed that the concentration of L-carnitine in tumor tissue was significantly higher than that in adjacent paracancerous and normal brain tissue, suggesting that L-carnitine may play a promoting role in tumor metastasis. Figure 2 F shows the proliferation curves of MEL-167, PEM22, and A375 cell lines after being treated with L-carnitine at different concentrations. The results showed that the addition of L-carnitine significantly promoted the proliferation of these tumor cell lines, especially in the Mel-167 cell line. Figure 2 G shows that the signal intensity in the brain of mice treated with L-carnitine was significantly higher than that in the control group, indicating that L-carnitine may promote metabolic changes in tumor metastasis. Figure 2H counted the fluorescence intensity of the L-carnitine treatment group and the control group at different time points in the mouse modeling experiment. The data in the figure show the trend of the fluorescence signal intensity over time, and statistical analysis shows that the fluorescence intensity of the L-carnitine group is significantly higher than that of the control group, which further indicates the important role of L-carnitine in tumor metastasis. All experimental results showed that the expression of CPT1A in melanoma cells was significantly higher than that in normal tissues, especially in metastatic lesions, showing higher activity. Through observations in mouse models, the study found that CPT1A played a promoting role in the process of melanoma metastasis, especially by regulating fatty acid metabolism, providing energy for tumor cells, and supporting their rapid growth and metastasis.
[0037] Example 3 Relationship between fatty acid oxidation and tumor metastasis, drug resistance and immunotherapy response
[0038] The brains of mice with melanoma brain metastasis (MBM) and non-modeled controls (Norm) were frozen and sliced in sagittal sections according to the hematoxylin-eosin staining method and stained with H&E. The H&E-stained slides were adjacent to the sections for spatial metabolomics detection.
[0039] H&E staining steps:
[0040] Take out the frozen sections from -80℃ in advance and place them in a -20℃ refrigerator to thaw overnight. Put the sections into the hematoxylin stain for 2 minutes, take them out and rinse them with tap water for 5-10 seconds. Then differentiate them with hydrochloric acid for 2 seconds and rinse them with tap water for 1-2 seconds. Under a microscope, the cell nucleus is purple-blue. Anti-blue with ammonia solution for 30 seconds and rinse with running water for 1-2 seconds. Under a microscope, the cell nucleus is blue. Stain with eosin stain for 1 minute and rinse with running water. Under a microscope, the cell nucleus is blue and the cytoplasm is red. The stained slides need to be transparentized using different concentrations of alcohol (from low to high) and xylene. Seal the slides with neutral gum and scan the H&E results.
[0041] The doxycycline (dox)-induced CPT1A knockdown plasmids (shCPT1A#1, shCPT1A#2) were constructed based on the TET-ON-plko.1 plasmid. The vector was linearized by double restriction digestion (EcoRI, AgeI) for 4 hours at 37°C. The linearized vector was recovered using a universal DNA purification and recovery kit (DP214-03, TIANGEN).
[0042] Among them, the shRNA sequence targeting CPT1A is:
[0043] shCPT1A#1: 5'-GACAACGATGTACGCCAAGAT-3' (SEQ ID NO. 1);
[0044] shCPT1A#2: 5'-CGATGTTACGACAGGTGGTTT-3' (SEQ ID NO. 2).
[0045] Order the shRNA paired primers from Sangon Biotech (Shanghai) Co., Ltd. and anneal them to form double strands. The annealing procedure is to react at 95 degrees for 5 minutes, then step down the temperature by 5 degrees to 60 degrees, and then cool naturally to room temperature. After annealing, the returned product is connected with the double enzyme digestion recovery vector. T4 ligase (M0202L, NEB) is used for connection. T4 ligase, T4 ligase buffer and shRNA annealing diluent are mixed in a ratio of 1:1:8. The connection procedure is incubated at room temperature for 2 hours.
[0046] Cells and animal models were treated with Etomoxir or doxycycline hydrochloride. Cell proliferation, invasion and fluorescence signal intensity were recorded. The specific experimental steps are as follows:
[0047] For the cell model, the cell proliferation assay was performed by plating cells in a 96-well plate, with 3 replicate wells for each cell type. The plating time was recorded as day 0, and the detection method was to add 50 μL CellTiter TM Reagent, incubate in dark for 5 min, then measure the luminescence value to represent cell activity. Cell activity was measured on days 0, 2, and 4 as the result of cell proliferation. The concentration of etomosher treatment group was set to 0 μM, 25 μM, and 50 μM. The dox+ treatment group was pretreated with doxycycline hydrochloride (300 ng / mL) for 3 days before measuring cell activity.
[0048] For the animal model, Mel-167 cells with GFP-Luciferase were injected into the left ventricle of severely immunodeficient NCG mice through the heart. The etomosher treatment group was treated by intraperitoneal injection, and the etomosher concentration was 5 mg / kg, and the solvent formula was 90% corn oil mixed with 10% DMSO. The shCPT1A#1 treatment group used special drinking water to induce CPT1A knockdown, and the formula was 250 mL of sterile drinking water with 6 g sucrose and 0.25 g doxycycline hydrochloride.
[0049] The results are as follows:
[0050] Figure 3 The immunohistochemical staining results in A showed that tumor cells in the brain metastasis and lung metastasis areas showed higher CPT1A positive staining, indicating that CPT1A may play an important role in the metabolic process of tumor metastasis. Figure 3The comparison of fatty acid β-oxidation scores in B single-cell transcriptome data (brain metastasis and adjacent tumors, lung metastasis and adjacent tumors) showed that the fatty acid β-oxidation scores in metastatic areas (brain metastasis and lung metastasis) were significantly higher than those in adjacent tumor areas, suggesting that fatty acid metabolism may play a promoting role in tumor metastasis. Figure 3 C shows that more samples with higher fatty acid oxidation levels showed good immunotherapy response, suggesting that fatty acid oxidation may be positively correlated with the efficacy of immunotherapy. Figure 3 D's data showed that patients with higher levels of fatty acid oxidation often developed resistance, indicating that fatty acid metabolism plays an important role in tumor resistance.
[0051] The results of in vitro cell proliferation experiments with CPT1A knockout are as follows Figure 3 As shown in E, after knocking down CPT1A, the proliferation of tumor cells was not inhibited. The results of the cell invasion experiment are shown in Figure 3 As shown in F, the invasion ability of cells in the CPT1A knockdown group was significantly reduced, suggesting that CPT1A plays an important role in the migration and invasion of tumor cells.
[0052] The imaging results of the model mice are as follows Figure 3 As shown in G, the metastatic signals of the etomosher-treated group and the CPT1A knockdown group were significantly reduced compared with the control group. The fluorescence signals of the mice at different time points were recorded by fluorescence imaging technology. Figure 3 As shown in I, the fluorescence intensity of the brain metastasis area of mice in the CPT1A inhibition group and the etomosher treatment group was lower, indicating that tumor metastasis can be effectively inhibited by either drug inhibition or in vivo knockdown of CPT1A content.
[0053] Mel-167, PEM22 and A375 cells were treated with CPT1A inhibitor etomosir. The results of cell proliferation assay are shown in Figure 3 H showed that etomosser significantly inhibited cell proliferation, especially in the Mel-167 cell line, indicating that etomosser had a significant inhibitory effect on the metabolism of tumor cells.
[0054] Example 4 Role of CPT1A and SREBP2 (key transcription factors for cholesterol synthesis) in cholesterol synthesis and fatty acid metabolism
[0055] Next-generation sequencing was performed on the etomosher-treated group and the control group, and the molecular mechanism of etomosher-mediated inhibition of circulating tumor cells was explored through gene set enrichment analysis, gene set scoring and survival analysis.
[0056] Western blot technology was used to detect etomoser-mediated changes in protein content.
[0057] A doxycycline (dox)-induced FDPS knockdown plasmid (shFDPS#1) was constructed. The knockdown sequence used for FDPS was: 5'-CCAGCAGTGTTCTTGCAATAT-3' (SEQ ID NO. 3), and the remaining steps were the same as the construction method of shCPT1A#1 and shCPT1A#2.
[0058] Mel-167 cells carrying GFP-Luciferase and shFDPS#1 were injected into the left ventricle of severely immunodeficient NCG mice. The shFDPS#1 treatment group used special drinking water to induce FDPS knockdown, with a formula of 250mL sterilized drinking water plus 6g sucrose and 0.25g doxycycline hydrochloride. Small animal imaging was performed immediately after the heart injection, and each imaging was performed 5 to 8 days apart. The signal intensity represents the growth status of tumor cells in the mouse.
[0059] The results are as follows:
[0060] Figure 4 Enrichment analysis of A showed that the most significantly downregulated pathway was the cholesterol synthesis pathway, suggesting that SREBP2 plays an important role in cholesterol synthesis. Figure 4 GSEA enrichment analysis of B showed that the downstream target genes of SREBP2 were significantly downregulated in the etomosher (ETO) group, further verifying the regulatory effect of SREBP2 on cholesterol synthesis. Figure 4 The results of C survival curve analysis showed that the high expression of these genes was associated with poor patient prognosis, suggesting that the activity state of SREBP2 is closely related to the malignancy and prognosis of the tumor. Figure 4 D Heat map shows that the expression of SREBP2 target genes in different samples is different, which further proves the regulatory role of SREBP2 in different tumor types. Figure 4 Pathway enrichment analysis of E showed that SREBP2 and cholesterol metabolism had a positive correlation with fatty acid metabolism, indicating their coordinated roles in cellular metabolism. Figure 4 F and 4G show the correlation analysis between fatty acid metabolism and SREBP2 target genes in tumor, paracancerous, TCGA and CCLE databases, respectively. The figure shows the relationship between fatty acid metabolism and SREBP2 target genes in different samples through correlation heat map and scatter plot, which further supports the important role of SREBP2 in metabolic regulation. Figure 4 H confocal imaging showed that the location of SREBP2 protein in the cell nucleus changed after etomosher treatment, indicating that its activity was regulated, which may affect cholesterol synthesis and fatty acid metabolism. Figure 4Western Blot results of I showed that treatment with oxidants and reductants significantly changed the protein expression levels of SREBP2 and CPT1A, further revealing the role of red oxygen balance in fatty acid metabolism and cholesterol synthesis. Figure 4 J lists the genes most strongly associated with SREBP2 in public melanoma data. The expression of these genes is positively correlated with SREBP2 and may be associated with the metabolic reprogramming of tumors, suggesting the importance of SREBP2 in melanoma metabolism. Figure 4 K shows the results of Western Blot analysis of SREBP2, HMGCR, CPT1A and FDPS protein levels after etomosher (ETO) treatment. After treatment, the expression of SREBP2 and its downstream target genes was significantly reduced, suggesting the central role of SREBP2 in metabolic regulation. Kaplan-Meier survival curve analysis was used, as shown in Figure 4 L shows that patients with high expression of FDPS have a poor prognosis, suggesting that FDPS may be used as a prognostic marker. Figure 4 M showed that tumor growth in mice was significantly inhibited, indicating that FDPS may be a key regulator of tumor growth. Figure 4 Fluorescence imaging of N showed that the fluorescence signal of tumor metastases in mice in the FDPS knockdown group was significantly reduced, further proving the role of FDPS in tumor metastasis. This indicates that the inhibition of CPT1A can downregulate the expression of SREBP2 and its downstream target genes, reduce cholesterol synthesis, and thus affect the growth and metastasis of tumor cells.
[0061] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
[0062] Sequence Listing SEQ ID NO.1 GACAACGATGTACGCCAAGAT
[0063] SEQ ID NO.2CGATGTTACGACAGGTGGTTT
[0064] SEQ ID NO.3CCAGCAGTGTTCTTGCAATAT
Claims
1. Application of CPT1A inhibitors in the preparation of drugs for inhibiting tumor metastasis.
2. The use according to claim 1, characterized in that: The tumor is melanoma, breast cancer or lung cancer.
3. The use according to claim 1, characterized in that: The metastasis is brain metastasis or lung metastasis.
4. The use according to claim 1, characterized in that: The CPT1A inhibitor is Etomoxir, ST1326, siRNA or shRNA.
5. The use according to claim 1, characterized in that: The drug includes a pharmaceutically acceptable carrier and / or a pharmaceutically acceptable carrier.
6. The use according to claim 1, characterized in that: The pharmaceutically acceptable carrier may be any one or more of a buffer, an emulsifier, a suspending agent, a stabilizer, a preservative, an excipient, a filler, a coagulant, a conditioning agent, a surfactant, a dispersant and a defoaming agent.
7. The use according to claim 1, characterized in that: The pharmaceutical carrier is any one or more of virus, microcapsule, liposome, nanoparticle and polymer.
8. The use according to claim 1, characterized in that: The drug contains a second active substance, which is an immune checkpoint inhibitor.