Bovine viral diarrhea recombinant expression protein as well as preparation method and application thereof

Abstract

The invention provides a bovine viral diarrhea recombinant expression protein as well as a preparation method and application thereof. A nucleotide sequence for coding the expression protein is shown as SEQ ID NO: 1. The expression protein has the beneficial effects that the expression protein for detecting the bovine viral diarrhea virus antibody is used as a coating material, so that the problem that a BVDV whole virus particle coating material in the market can only detect an antibody generated by injecting an inactivated vaccine and cannot distinguish and detect an antibody generated by injecting a recombinant protein is solved; according to the present invention, the expression protein is adopted to coat, such that whether the antibody is generated by injecting the BVDV-E2 recombinant protein vaccine can be specifically distinguished;

Description

Technical Field

[0001] The present application belongs to the field of biological products, and in particular relates to a recombinant expression protein for viral diarrhea and a preparation method and application thereof. Background Art

[0002] In my country, bovine viral diarrhea (BVD) often exists in the form of persistent infection in livestock herds. Foreign countries mainly adopt vaccination, enhanced monitoring, and elimination of persistently infected and immune-tolerant animals to purify cattle herds. Due to the existing veterinary system and the lack of awareness and attention to the disease, it is very difficult for my country to prevent and control the disease. However, some necessary work should be done to prevent BVD from becoming popular in my country. At present, there are many methods for detecting bovine viral diarrhea virus (BVDV) specific antibodies, among which the virus neutralization test (VN) is the most accurate method for detecting BVDV specific antibodies. However, the virus neutralization test is cumbersome to operate, and the time to determine the results is long, which is not suitable for large-scale sample testing. Enzyme-linked immunosorbent assay (ELISA) is an experimental diagnostic method with high sensitivity, strong specificity and good repeatability. It organically combines the specificity of antigen-antibody immune reaction and the principle of efficient catalytic action of enzymes to sensitively detect trace amounts of specific antibodies or antigens in body fluids. However, the ELISA method for detecting BVDV antibodies in domestic laboratories currently mainly relies on imported test kits. The cost of testing each sample is too high, which will be a great financial burden for Chinese breeders. In addition, the purchase cycle of foreign test kits is time-consuming, which is not conducive to the use of small breeders. Secondly, the reaction time of commonly used test kits on the market is usually more than 2.5 hours, and the operation is relatively complicated and requires multiple steps. This is not friendly to grassroots veterinarians and laboratory technicians, making the experimental efficiency inefficient. Summary of the invention

[0003] In order to solve the above problems existing in the prior art, the present invention provides a bovine viral diarrhea recombinant protein vaccine and a preparation method and application thereof.

[0004] In a first aspect of the present invention, an expression protein for detecting antibodies against bovine viral diarrhea virus is provided. The nucleotide sequence encoding the expression protein is shown in SEQ ID NO:1.

[0005] The second aspect of the present invention provides a method for preparing the expressed protein according to the first aspect of the present invention, comprising the following steps:

[0006] (1) RNA was extracted from BVDV type 1 strain, and its E2 gene fragment was amplified by RT-PCR and cloned into the pMD18-T vector, and then further directionally cloned into the pET30a expression vector to obtain the recombinant plasmid pET30a-E2;

[0007] (2) The positively identified plasmid pET30a-E2 was transformed into competent Escherichia coli cells BL21 (DE3), and a single colony was selected and cultured in LB liquid medium containing ampicillin;

[0008] (3) The culture product obtained in step (2) is added again to the LB liquid culture medium containing ampicillin for bacterial growth. After the culture is completed, IPTG is added for induction and purification to obtain the expressed protein.

[0009] According to some embodiments of the preparation method of the present invention, in step (2), the mass content of ampicillin in the LB liquid culture medium is 0.1-0.3 mM / L; for example, 0.1 mM / L, 0.2 mM / L, 0.3 mM / L, etc.

[0010] Each liter of LB liquid medium includes 10 g of peptone, 5 g of yeast extract and 5 g of NaCl.

[0011] According to some embodiments of the preparation method of the present invention, in step (2), the culturing condition is overnight culturing at 35-38°C, such as 35°C, 36°C, 37°C, 38°C, etc.

[0012] According to some embodiments of the preparation method of the present invention, in step (3), the mass content of ampicillin in the LB liquid culture medium is 0.1-0.3 mM / L; for example, 0.1 mM / L, 0.2 mM / L, 0.3 mM / L, etc.

[0013] According to some embodiments of the preparation method of the present invention, the amount of the culture product obtained in step (2) added to the LB liquid culture medium is 0.8%-1.2%; for example, 0.8%, 0.9%, 1.0%, 1.2%.

[0014] According to some embodiments of the preparation method of the present invention, the temperature of the bacterial enrichment culture is 37° C., and the time of the bacterial enrichment culture is 6-8 h; for example, 6 h, 7 h, 8 h, etc.

[0015] According to some embodiments of the preparation method of the present invention, the purification is: ultrasonically disrupting the bacteria, collecting the precipitate by centrifugation and dissolving it with urea to obtain a dissolved solution; using a nickel column to purify the dissolved solution, collecting (using a centrifuge tube to collect the protein solution flowing out of the purification column) the protein in the eluate and desalting and renaturing it to obtain the expressed protein.

[0016] According to some embodiments of the preparation method of the present invention, the mass concentration of the urea is 7-9 mol / L; for example, 7 mol / L, 8 mol / L, 9 mol / L.

[0017] According to some embodiments of the preparation method of the present invention, the desalting and renaturing is to dialyze and renature the purified protein using a dialysis bag gradient hypotonic dialysis method. The dialysis bag is placed in a beaker and the prepared liquid is placed in a gradient of 6M, 4M, 2M, 1M, and 0M for 6 to 8 hours at each concentration.

[0018] The third aspect of the present invention provides a use of the expression protein described in the first aspect of the present invention or the expression protein obtained by the preparation method described in the second aspect of the present invention in detecting bovine viral diarrhea virus antibodies.

[0019] The fourth aspect of the present invention provides an ELISA kit for detecting antibodies to bovine viral diarrhea virus, the kit comprising an ELISA plate coated with the expression protein described in the first aspect of the present invention or the expression protein obtained by the preparation method described in the second aspect of the present invention.

[0020] The fifth aspect of the present invention provides a use of the ELISA kit described in the fourth aspect of the present invention in detecting bovine viral diarrhea virus antibodies.

[0021] According to some embodiments of the application of the present invention, the following steps are included:

[0022] (1) Add the diluted primary antibody and horseradish peroxide-labeled secondary antibody to the microwells of the ELISA plate; incubate at 37°C for 0.5-1.5 h;

[0023] (2) Discard the liquid in the microwells of the ELISA plate, wash and pat dry, add color developing solution to develop color, then add stop solution, and then use an ELISA reader to detect.

[0024] According to some embodiments of the application of the present invention, in step (1), the primary antibody is the serum of an animal immunized with a BVDV-E2 protein subunit vaccine, preferably bovine serum.

[0025] According to some embodiments of the use of the present invention, the secondary antibody is HRP-labeled goat anti-bovine secondary antibody.

[0026] According to some embodiments of the application of the present invention, the diluent used to dilute the primary antibody is 0.08M-0.12M PBS buffer, for example, 0.08M, 0.09M, 0.10M, 0.12M, etc., and the volume ratio of the PBS diluent to the primary antibody is (8-12):1; for example, 8:1, 9:1, 10:1, 12:1, etc.

[0027] According to some embodiments of the application of the present invention, in step (2), the detergent used for washing is PBST buffer.

[0028] According to some embodiments of the application of the present invention, in step (2), the color developing solution is TMB color developing solution.

[0029] According to some embodiments of the application of the present invention, in step (2), the stop solution is sulfuric acid. According to some embodiments of the application of the present invention, the concentration of sulfuric acid is 1-3 mol / L; for example, 1 mol / L, 2 mol / L, 3 mol / L.

[0030] The beneficial effects of the present invention are as follows: using the expression protein for detecting bovine viral diarrhea virus antibodies described in the present invention as a coating material solves the problem that the BVDV whole virus particle coating material used on the market can only detect antibodies produced by injection of inactivated vaccines, but cannot distinguish and detect antibodies produced by injection of recombinant proteins. That is, by using the expression protein described in the present application for coating, it is possible to specifically distinguish whether the antibodies are produced by injection of BVDV-E2 recombinant protein vaccine.

[0031] 2. When using the detection kit described in this application, the primary antibody and the secondary antibody are co-incubated, which shortens the test time and improves the test efficiency. DETAILED DESCRIPTION

[0032] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present application more clearly understood, the present application is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present application and are not used to limit the present application.

[0033] The present application provides an expression protein for detecting bovine viral diarrhea virus antibodies, and the nucleic acid sequence encoding the expression protein is shown in SEQ ID NO: 1:

[0034] The nucleic acid sequence of SEQ ID NO: 1 is:

[0035] CTCCCAGCCTGTAAACCTGACTTTTCTTACGCCATAGCCAAAAACAATGAGATAGGCCCTCTTGGAGCTACGGGCCTCACCACTCAATGGTATGAATACTCGGATGGGATGCGGCTGCAGGACACGGAAGTTGTAGTGTGGTGTAAAGGTGGAGATCAAATATCTAATTACGTGTGAGAGGGAAGCCAGGTATCTGGCCATTTTACACACGAGAGCCCTGCCGACATCTGTAGTATTTAAAAAAATCATAGAA GGAAAAAAACAAGAGGACGTAGTTGAAATGGATGATGACTTTGAGTTCGGTCTTTGCCCGTGTGATGCTAAACCCTTGGTAAGGGGAAAATTTAATACAACACTTCTAAATGGGCCAGCTTTCCAGAT GGTTTGCCCTATAGGATGGACTGGGACTGTGAGCTGTGCACTGGCTAATAAGGATACGTTAGCCTTGACCGTTGTACGAACATACACGAGGCACAAGCCGTTCCCCTATAGGCAAGGCTGCATCACC.

[0036] Example 1

[0037] A method for preparing an expression protein for detecting bovine viral diarrhea virus antibodies comprises the following steps:

[0038] (1) RNA was extracted from BVDV type 1 strain, and its E2 gene fragment was amplified by RT-PCR and cloned into the pMD18-T vector, and then further directionally cloned into the pET30a expression vector to obtain the recombinant plasmid pET30a-E2;

[0039] (2) The positively identified plasmid pET30a-E2 was transformed into competent Escherichia coli BL21 (DE3) cells, and a single colony was selected and placed in LB liquid medium containing ampicillin at 37° C. for overnight culture; the mass content of ampicillin in the LB liquid medium was 0.3 mM / L, and each liter of LB liquid medium contained the following raw materials in weight: 10 g of peptone, 5 g of yeast extract, and 5 g of NaCl;

[0040] (3) The culture product obtained in step (2) is added again to LB liquid medium containing ampicillin for enrichment culture (the mass content of ampicillin in the LB liquid medium is 0.3 mM / L), the amount of culture product added is 0.8%-1.2% of the LB liquid medium, the temperature of the enrichment culture is 37° C. and the time of the enrichment culture at this temperature is 6 h. After the culture is completed, IPTG is added for induction in a prokaryotic protein expression system, such as E. coli (Escherichia coli expression system).

[0041] The cells were ultrasonically disrupted, the precipitate was collected by centrifugation and dissolved with urea at a mass concentration of 7 mol / L to obtain a solution, the solution was purified by a nickel column, the protein in the eluate was collected and desalted and renatured, and the purified E2 recombinant protein was dialyzed and renatured by a dialysis bag gradient low osmotic dialysis method, and the protein was placed in a dialysis bag. The dialysis bag was placed in a beaker and the prepared liquid was placed in a gradient of 6M, 4M, 2M, 1M, and 0M, and each concentration was placed for 6-8 hours to obtain the expressed protein.

[0042] Example 2

[0043] An ELISA kit for detecting antibodies to bovine viral diarrhea virus:

[0044] The expressed protein obtained in Example 1 was diluted to 1 ug / mL with PBS and added to a substrate-free ELISA plate, with 100 ul per well (the number of coated wells was determined by the sample size, and generally 2-3 replicates were performed for one sample, including negative serum control wells and blank control wells). Negative serum was calf serum that had not been infected with BVDV virus or bovine serum that had not been immunized with BVDV-E2 protein subunit vaccine; the blank control was 0.1 M PBS buffer, placed in a refrigerator at 4°C for overnight coating or in a 37°C constant temperature incubator for one hour, then the coating solution was discarded and patted dry, and 200 ul was added to each well. 0.05% PBST, place on a microplate shaker and shake for 3 minutes, wash 3 times, pat the plate dry after each wash, add 100ul of blocking solution to each well after washing, block with 5% BSA blocking solution at 37°C for one hour, discard the blocking solution and pat dry, add 200ul of 0.05% PBST to each well, place on a microplate shaker and shake for 1 minute, wash 5 times, pat the plate dry after each wash;

[0045] 100ul of primary antibody serum diluted at a ratio of 1:10 was added to each well, and 100ul of secondary antibody serum (primary antibody was bovine serum immunized with BVDV-E2 protein subunit vaccine; secondary antibody was HRP-labeled goat anti-bovine secondary antibody) was added to each well. The diluent used for diluting the primary antibody was 0.1M PBS buffer, and the plate was blocked at 37°C in the dark for one hour. The primary and secondary antibodies were discarded, and 200ul of PBST was added to each well for five washes, each for 1min. After washing, the plate was patted dry, and 100ul of TMB colorimetric solution was added to each well. The plate was colorimetric at 37°C in the dark for 15min. After the colorimetric development was completed, 50ul of 2mol / L sulfuric acid was added, and the OD was detected by an enzyme reader. 450 View the results.

[0046] Application of the expressed protein described in Example 1 of this application

[0047] 1. Test Reagents

[0048] PBS diluent (prepared by diluting PBS powder), Tween 20, bovine serum albumin (BSA powder), primary antibody (diluted serum of the animal to be tested, mouse serum is used as an example in this case), secondary antibody (rabbit anti-mouse IgG enzyme-labeled antibody labeled with horseradish peroxide), TMB colorimetric solution, stop solution (2 mol / L H 2 SO 4 ).

[0049] Preparation of diluent and blocking solution:

[0050] 0.05% PBST: 500ml PBS and 250μl Tween 20

[0051] For example, 10 ml of blocking solution and primary and secondary antibody diluent: 0.2 g BSA powder + 10 ml PBST

[0052] Prepare according to the test requirements, prepare as much as needed, and use the test reagents immediately after preparation.

[0053] Stop solution (2 mol / L H 2 SO 4 ): Take 20 mL of concentrated H 2 SO 4 Slowly pour in a small amount of pure water (stirring while adding), make up to 180mL with pure water, and store in a sealed condition (no need to prepare and use immediately).

[0054] 2. Test equipment

[0055] Dispensing gun, pipette trough, microplate shaker, ELISA reader.

[0056] 3. Test methods

[0057] Dilute the purified recombinant protein with determined protein concentration to 1ug / mL with PBS, add it to the substrate-free ELISA plate, 100μl per well (the number of coated wells is determined by the sample volume, generally 2 to 3 replicates are made for one sample, including negative serum control wells and blank control wells), place in a refrigerator at 4℃ for overnight coating or place in a 37℃ constant temperature incubator for one hour.

[0058] Discard the coating solution and pat dry, add 200μl 0.05% PBST to each well, place on a microplate shaker and wash for 3 minutes. Wash 3 times, pat dry after each wash; add 100μl blocking solution to each well; block at 37℃ in the dark for one hour.

[0059] Discard the blocking solution and pat dry, add 200μl 0.05% PBST to each well, place on a microplate shaker and shake for 3 minutes. Wash 3 times and pat dry after each wash; add 100μl primary antibody serum diluted in proportion to each well, generally starting from 1600 times and diluting 2 times to determine the titer of the experimental group. First, add 1ul serum to 399ul diluent to obtain a 400-fold diluted primary antibody, and then dilute it twice to obtain a 1600-fold primary antibody, and then dilute it twice to obtain 3200, 6400, 12800, 25600........ (the serum of the experimental group can reach 1:1638400 after 14 days); block at 37℃ in the dark for one hour (it doesn't matter if it's a little longer).

[0060] Discard the primary antibody coating solution, add 200μl of PBST to each well and wash three times, 3 minutes each time. Pat the plate dry after each wash. Add 100μl of secondary antibody serum to each well (the secondary antibody serum diluent is prepared in the same way as the primary antibody diluent, and the dilution concentration is determined by the instructions, generally 1:5000, and block at 37℃ in the dark for one hour. Discard the coating solution, add 200μl of PBST to each well and wash three times, 3 minutes each time. Pat the plate dry after each wash; add 100μl of TMB colorimetric solution to each well, and color at 37℃ in the dark for 30 minutes. After color development, add 100μl of stop solution; use an enzyme reader to detect OD 450 Check the results. The test results are shown in Table 1:

[0061] Table 1

[0062]

[0063]

[0064] Note: The preparation method of positive serum includes mixing BVDV-E2 protein and ISA206 adjuvant in a weight ratio of adjuvant: aqueous phase = 1:1. After mixing evenly, 2 ml of vaccine is injected into the head and neck muscle of the immunized cattle. 21 days after immunization, booster immunization is performed once. 14 days after the second immunization, blood is collected, 37℃ for 1 hour, and centrifuged at 3000rpm for 10 minutes after the blood is fully coagulated. The light yellow supernatant is the positive serum.

[0065] The specific values ​​of the test are shown in Table 2:

[0066] Table 2

[0067] Dilution multiple 314 316 317 318 319 Negative 200 0.944 1.495 1.012 0.13 0.882 0.094 400 0.519 1.249 0.943 0.11 0.38 0.131 800 0.246 1.105 0.84 0.124 0.219 0.081 1600 0.196 0.883 0.343 0.131 0.151 0.135 3200 0.133 0.631 0.258 0.128 0.12 0.094 6400 0.128 0.444 0.121 0.087 0.087 0.103 12800 0.073 0.323 0.078 0.087 0.087 0.093 25600 0.117 0.296 0.117 0.085 0.109 0.101 51200 0.104 0.165 0.122 0.126 0.101 0.092 102400 0.11 0.125 0.099 0.092 0.094 0.095 204800 0.131 0.092 0.11 0.078 0.087 - 409600 0.155 0.097 0.106 0.098 0.088 - 819200 0.109 0.104 0.104 0.129 0.1114 - 1638400 1.102 0.102 0.093 0.091 0.094 -

[0068] The above description is only a preferred embodiment of the present application and is not intended to limit the present application. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present application should be included in the protection scope of the present application.

Claims

1. An expression protein for detecting antibodies against bovine viral diarrhea virus, characterized in that: The nucleic acid sequence encoding the expressed protein is shown in SEQ ID NO:

1.

2. The method for preparing the expressed protein according to claim 1, characterized in that: The steps include: (1) RNA was extracted from BVDV type 1 strain, and its E2 gene fragment was amplified by RT-PCR and cloned into the pMD18-T vector, and then further directionally cloned into the pET30a expression vector to obtain the recombinant plasmid pET30a-E2; (2) The positively identified plasmid pET30a-E2 was transformed into competent Escherichia coli cells BL21 (DE3), and a single colony was selected and cultured in LB liquid medium containing ampicillin; (3) The culture product obtained in step (2) is added again to the LB liquid culture medium containing ampicillin for bacterial growth. After the culture is completed, IPTG is added for induction and purification to obtain the expressed protein.

3. The preparation method according to claim 2, characterized in that: In step (2), the mass content of ampicillin in the LB liquid culture medium is 0.1-0.3 mM / L; And / or, in step (2), the culture condition is overnight culture at 35-38°C.

4. The preparation method according to claim 2, characterized in that: In step (3), the mass content of ampicillin in the LB liquid culture medium is 0.1-0.3 mM / L; And / or, the amount of the culture product obtained in step (2) added is 0.8%-1.2% of the LB liquid culture medium; And / or, the temperature of the bacterial enrichment culture is 37° C., and the time of the bacterial enrichment culture is 6-8 hours.

5. The preparation method according to claim 2, characterized in that: The purification comprises: ultrasonically disrupting the bacterial cells, collecting the precipitate by centrifugation and dissolving it with urea to obtain a solution; purifying the solution with a nickel column, collecting the protein in the eluate and performing desalting and renaturation to obtain the expressed protein; Preferably, the mass concentration of the urea is 7-9 mol / L; Preferably, the desalting and renaturation is to perform dialysis renaturation on the purified protein using a dialysis bag gradient hypotonic dialysis method.

6. Use of the expressed protein according to claim 1 or the expressed protein obtained by the preparation method according to any one of claims 3 to 4 in detecting antibodies against bovine viral diarrhea virus.

7. An ELISA kit for detecting bovine viral diarrhea virus antibodies, characterized in that: The kit comprises an ELISA plate coated with the expression protein according to claim 1 or the expression protein obtained by the preparation method according to any one of claims 3 to 4.

8. Use of the ELISA kit according to claim 7 in detecting antibodies against bovine viral diarrhea virus.

9. The use according to claim 8, characterized in that: The following steps are involved: (1) Add the diluted primary antibody and horseradish peroxide-labeled secondary antibody to the microwells of the ELISA plate; incubate at 37°C for 0.5-1.5 h; (2) Discard the liquid in the microwells of the ELISA plate, wash and pat dry, add color developing solution to develop color, then add stop solution, and then use an ELISA reader to detect.

10. The use according to claim 9, characterized in that: In step (1), the primary antibody is serum of an animal immunized with BVDV-E2 protein subunit vaccine, preferably bovine serum; And / or, the secondary antibody is HRP-labeled goat anti-bovine secondary antibody; And / or, the diluent used to dilute the primary antibody is a 0.08M-0.12M PBS buffer, and the volume ratio of the diluent to the primary antibody is (8-12):1; And / or, in step (2), the detergent used for washing is PBST buffer; And / or, in step (2), the color developing solution is TMB color developing solution; And / or, in step (2), the stop solution is sulfuric acid, and preferably, the concentration of the sulfuric acid is 1-3 mol / L.

Images