Rice mutant OsNramp5 gene, amino acid and identification method, application and primer of rice mutant OsNramp5 gene

Abstract

The invention belongs to the technical field of rice planting, and discloses a rice mutant type OsNramp5 gene, amino acid and an identification method, application and primer thereof, the rice mutant type OsNramp5 gene takes the genome IRGSP-1. 0 version of Nipponbare rice as a reference genome, the specific polymorphism of eight bases of TACCTTGG is deleted at the position between the No.13 chromosome 8871937-8871944 of rice, and the genomic IRGSP-1. 0 version of Nipponbare rice is used as the reference genome; the method is used for rapidly identifying the low-cadmium-accumulation rice and cultivating a low-cadmium-accumulation variety, and finally a rice variety improved line with a low-cadmium-absorption phenotype is obtained. According to the method for identifying whether the cadmium low-accumulation rice mutant OsNramp5 gene is contained or not, the PCR primer and the KASP gene typing primer, accurate typing of different individuals can be conducted on Indel found through sequencing, the accuracy and efficiency of existing innovative germplasm screening identification can be further improved, and operation is easy and convenient.

Description

Technical Field

[0001] The invention belongs to the technical field of rice planting, and in particular relates to a method for cultivating high-quality rice mutants. OsNramp5 Genes, amino acids and their identification methods, application methods and primers. Background Art

[0002] Cadmium (Cd) is a heavy metal with strong biological toxicity, and its half-life in the human body can be as long as 30 years. Cd pollution in cultivated land has become a global environmental problem. Rice is the staple food of more than half of the world's population. Compared with other crops, rice has a stronger ability to accumulate Cd, and the Cd content of indica rice is generally higher than that of japonica rice. For Cd-contaminated areas where rice is the staple food, Cd in rice is one of the main sources of human intake. About 90% of the world's rice is produced in Asia, and the average Cd content of Asian rice is higher than that of rice from Europe, the Middle East and North America. The problem of excessive cadmium in rice is particularly serious in my country's southern rice-growing areas. Previous studies have solved the problem of "cadmium rice" through comprehensive management measures such as screening "emergency low-cadmium varieties", flooding irrigation to reduce cadmium, and increasing soil pH. However, the cadmium reduction effect of "emergency low-cadmium accumulation varieties" is unstable, and the comprehensive management measures of soil improvement are costly and difficult for farmers to accept. Therefore, creating new germplasm with low Cd accumulation and breeding new rice varieties with low Cd accumulation are the most economical and effective ways to solve this problem. Summary of the invention

[0003] The technical problem to be solved by the present invention is to overcome the shortcomings and defects mentioned in the above background technology and provide a method for cultivating high-quality rice mutants with high efficiency, high accuracy and simple operation. OsNramp5 Genes, amino acids and their identification methods, application methods and primers.

[0004] In order to solve the above technical problems, the technical solution proposed by the present invention is: In a first aspect, the present invention provides a rice mutant OsNramp5 The gene, using the genome of Nipponbare rice (IRGSP-1.0 version) as the reference genome, lacks eight bases TACCTTGG at the position between 8871937-8871944 on chromosome 13 of rice. The rice mutant OsNramp5 The nucleotide sequence of the CDS region of the gene is shown in SEQ ID No.1.

[0005] In a second aspect, the present invention provides a rice mutant OsNramp5 The amino acids encoded by the gene, the sequence of which is shown in SEQ ID No.2.

[0006] In a third aspect, the present invention provides a method for determining whether rice contains a rice mutant. OsNramp5The method for identifying a gene comprises the following steps: using the rice genomic DNA to be tested as a template, performing PCR amplification using PCR primers, and if only a product with a length of 155 bp is obtained, it indicates that the sample does not contain the rice mutant OsNramp5 If two products with lengths of 147 bp and 155 bp are obtained, it means that the sample contains the rice mutant OsNramp5 gene, and is in a heterozygous state; if only a product of 147 bp in length is obtained, it means that the sample contains the rice mutant in a homozygous state OsNramp5 Gene; The nucleotide sequences of the PCR primers are as follows: lcd8871936-F (see SEQ ID No. 5): 5'-CGACCTCGCCGTCGACGA-3'; lcd8871936-R (see SEQ ID No. 6): 5'-GTACGTATATTCACAATGTACGCGT-3'.

[0007] In a fourth aspect, the present invention provides another method for determining whether rice contains a rice mutant. OsNramp5 The method for identifying a gene is characterized in that it comprises the following steps: using the rice genomic DNA to be tested as a template, performing PCR amplification using KASP genotyping primers, and if only a HEX signal is obtained, the sample does not contain the rice mutant OsNramp5 If a FAM / HEX signal is obtained, the sample contains the rice mutant OsNramp5 If only FAM signal is obtained, it indicates that the sample contains the rice mutant in homozygous state. OsNramp5 Gene; The nucleotide sequence of the KASP genotyping primer is as follows: lcd8871936-KF (see SEQ ID No.7): 5'-GAAGGTGACCAAGTTCATGCTCGTATGCATGTCGATCTTCTTCTTCTCT-3'; lcd8871936-KH (see SEQ ID No. 8): 5'-GAAGGTCGGAGTCAACGGATTCGTATGCATGTCGATCTTCTTCTTCTCG-3'; lcd8871936-KC (see SEQ ID No.9): 5′-GACGACCTGGCCGACATC-3′.

[0008] In addition to the above PCR primers and KASP primers for the low cadmium accumulation rice mutant OsNramp5 In addition to gene identification, other technical means such as Snager sequencing, second-generation sequencing, and third-generation sequencing can also be used to detect whether there is a TACCTTGG deletion at 8871937 and 8871944 on rice chromosome 13.

[0009] In a fifth aspect, the present invention provides a rice mutant OsNramp5 Application of genes in breeding rice with low cadmium accumulation.

[0010] The above application, preferably, comprises the following steps: using the rice mutant OsNramp5 The material of the gene is the donor parent, and the other rice to be improved is the recipient parent. The F1 is hybridized, and the F1 is planted to obtain the F2 generation. Whether the individual plants of the F2 generation population contain the rice mutant OsNramp5 The above process is repeated until the offspring obtains genetically stable rice mutants containing homozygous OsNramp5 The single plant with the gene is the rice with low cadmium accumulation.

[0011] Preferably, the rice mutant OsNramp5 The gene material is lcd-R2020, and the receptor parent is 9311.

[0012] In a sixth aspect, the present invention provides a method for identifying whether rice contains the rice mutant OsNramp5 The PCR primers for the gene, the nucleotide sequences of the PCR primers are as follows: lcd8871936-F (see SEQ ID No. 5): 5'-CGACCTCGCCGTCGACGA-3'; lcd8871936-R (see SEQ ID No. 6): 5'-GTACGTATATTCACAATGTACGCGT-3'.

[0013] In a seventh aspect, the present invention provides a method for identifying whether rice contains the rice mutant OsNramp5 The nucleotide sequence of the KASP genotyping primer is as follows: lcd8871936-KF (see SEQ ID No.7): 5'-GAAGGTGACCAAGTTCATGCTCGTATGCATGTCGATCTTCTTCTTCTCT-3'; lcd8871936-KH (see SEQ ID No. 8): 5'-GAAGGTCGGAGTCAACGGATTCGTATGCATGTCGATCTTCTTCTTCTCG-3'; lcd8871936-KC (see SEQ ID No. 9): 5'-GACGACCTGGCCGACATC-3'.

[0014] In an eighth aspect, the present invention provides an application of the PCR primer or the KASP genotyping primer in cultivating rice with low cadmium accumulation.

[0015] Compared with the prior art, the present invention has the following beneficial effects: 1. The present invention provides a rice mutant for cultivating high-quality hybrid rice with low cadmium accumulation OsNramp5 Gene, using the specific polymorphism of the eight-base sequence TACCTTGG missing between 8871937-8871944 on rice chromosome 13, was used to quickly identify low-cadmium accumulation rice and cultivate low-cadmium accumulation varieties, and finally obtained rice variety improvement lines with low cadmium absorption phenotypes, reducing the workload of cultivating low-cadmium accumulation rice and shortening the cultivation cycle, which not only saved the identification time cost, but also facilitated crop improvement and germplasm innovation of low-cadmium accumulation varieties; 2. The present invention provides a method for identifying whether a rice mutant with low cadmium accumulation is present. OsNramp5 The gene method, PCR primers and KASP genotyping primers can accurately type the Indels found by sequencing for different individuals, which can further improve the accuracy and efficiency of existing innovative germplasm screening and identification, and the operation is simple. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0017] Figure 1 is the Sanger sequencing result of the mutant strain in Example 1; Figure 2 is the homozygous mutant parent (mt) and the control material (WT) in Example 1 OsNramp5 Comparison of relative gene expression and cadmium content; A is the relative expression, B is the cadmium content in stems and leaves, and C is the cadmium content in roots; Figure 3 The rice mutant in Example 2 OsNramp5 Polyacrylamide gel electrophoresis identification of genes; Figure 4 is the fluorescent marker genotyping diagram in Example 3; Figure 5 This is a graph of the cadmium content of LCD-9311 and the wild-type control in Example 4. DETAILED DESCRIPTION

[0018] In order to facilitate the understanding of the present invention, the present invention will be described more comprehensively and meticulously below in conjunction with the accompanying drawings and preferred embodiments of the present invention, but the protection scope of the present invention is not limited to the following specific embodiments.

[0019] Unless otherwise defined, all the professional terms used below have the same meanings as those generally understood by those skilled in the art. The professional terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the scope of protection of the present invention.

[0020] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods.

[0021] Embodiment 1: 1. Creation of molecular markers for low cadmium accumulation Using high energy heavy ion beams (12C 6+ ) irradiated high-quality hybrid rice restorer line R2020, and the irradiated M1 generation seeds were grown to the tillering stage. 500 plants were sampled to construct a DNA pool, and the major effect gene of rice cadmium absorption was used to generate the DNA pool. OsNramp5 Gene exon capture primers were used to perform exon capture and targeted deep sequencing of the mixed pool. After filtering, the sequencing data was aligned with the Nipponbare genome (IRGSP-1.0) as the reference sequence. Among them, there was an Indel mutation in mixed pool 7. Pool 7 was the M1 generation DNA mixed pool of R2020, which contained a OsNramp5 Mutation within the gene, deletion of TACCTTGG between 8871937 and 8871944 on rice chromosome 13 (see Figure 1 , the reference genome is the IRGSP-1.0 version of the rice variety Nipponbare).

[0022] In view of the above Indel mutation, KASP typing primers were developed, namely lcd8871936-KF, KH, KC. The KASP primers were used to genotype the individual strains in the No. 7 mixed pool, and the fifth strain in the 12th row of the R2020 M1 generation population was identified to have a deletion mutation of TACCTTGG. In the M2 population with the above mutation, a homozygous mutant individual strain was identified and named lcd-R2020.

[0023] A specific length polymorphism molecular marker was designed based on the TACCTTGG sequence missing between 8871937 and 8871944 on rice chromosome 13, namely "molecular marker lcd8871936". OsNramp5 The nucleotide sequence and amino acid sequence of the gene CDS region are shown in SEQ ID No.1 and SEQ ID No.2.

[0024] SEQ ID No.1:

[0025] SEQ ID No.2: *.

[0026] The RNA of homozygous mutants and wild-type materials was extracted by Trizol method, and then converted into cDNA. OsNramp5 Design qPCR primers based on cDNA sequence, q OsNramp5 F: CGTTTGCTCTCATCCCTCTT (SEQ ID No.3); q OsNramp5 R: CAGGAACCACGAGAACACTATTA (SEQ ID No. 4). Fluorescence quantitative analysis was performed using Roche 480 fluorescence quantitative PCR instrument. The results are shown in Figure 2 A. Homozygous mutant OsNramp5 The gene expression levels were significantly decreased compared with the wild-type materials. OsNramp5Homozygous mutant plants and wild-type plants were grown to the 2-leaf 1-heart stage and treated with Yoshida rice nutrient solution (0.5 μmol / L CdCl2) for two weeks. The cadmium content in the stems, leaves and roots of the homozygous mutant plants was significantly lower than that in the control materials ( Figure 2 of BC).

[0027] 2. Rice mutant OsNramp5 Linkage verification of genes with low cadmium accumulation traits The F1 generation was obtained by hybridizing lcd-R2020 with Huazhan, and the F2 generation was harvested by planting the F1 generation. The F2 population was obtained by field planting, and the rice mutant OsNramp5 Gene typing was performed on the F2 population. Based on the results, random selection was performed on + / +, + / -, and - / - (containing rice mutants, respectively). OsNramp5 100 plants of each of the three genotypes (gene homozygous, heterozygous, and unmarked) were planted in a heavily cadmium-contaminated field (soil cadmium concentration was 1.5 mg / kg, pH was 5.7). After the rice was fully mature, the plants were harvested, threshed, and the brown rice was ground into powder. Referring to the national standard determination method (GB / T 5009.15-2003), the cadmium content in brown rice was determined by ICP-MS. The results are shown in Table 1 below, and the cadmium content of the grains by typing is shown in Table 2 below. The experiment showed that the rice mutant type lcd-R2020 contained OsNramp5 The gene is completely linked to the low cadmium accumulation phenotype and can be used to quickly breed rice with low cadmium accumulation.

[0028] Table 1: Determination of cadmium content in brown rice of different genotypes

[0029] Table 2: Statistics of cadmium content in grains by molecular marker typing of lcd8871936

[0030] Embodiment 2: A method for identifying whether rice materials contain rice mutants OsNramp5 Gene method, that is, using PCR primers to determine whether rice materials contain rice mutants OsNramp5 Gene identification includes the following steps: Use the rice genomic DNA to be tested as a template and perform PCR amplification using PCR primers. If only one product of 155 bp is obtained, the sample does not contain the rice mutant. OsNramp5 If two products with lengths of 147 bp and 155 bp are obtained, the sample contains a rice mutant OsNramp5gene, and is in a heterozygous state; if a product with a length of 147 bp is obtained, it indicates that the sample contains a homozygous rice mutant OsNramp5 Gene; The sequences of the above PCR amplification primers are: lcd8871936-F (see SEQ ID No. 5): 5'-CGACCTCGCCGTCGACGA-3'; lcd8871936-R (see SEQ ID No. 6): 5'-GTACGTATATTCACAATGTACGCGT-3'.

[0031] like Figure 3 As shown, the primers can amplify the chromosome region containing the marker and perform high-throughput identification of whether there is a low cadmium accumulation marker.

[0032] Embodiment 3: A method for identifying whether rice materials contain rice mutants OsNramp5 Genetic method, that is, to identify rice mutants by fluorescent marker genotyping OsNramp5 Gene typing, for example, using the KASP technique, includes the following steps: Using rice genomic DNA as a template, PCR amplification was performed using KASP genotyping primers. If a HEX signal was obtained, the sample did not contain rice mutants. OsNramp5 gene; if a FAM / HEX signal is obtained, the sample contains a rice mutant OsNramp5 If a FAM signal is obtained, it indicates that the sample contains a homozygous rice mutant OsNramp5 Gene; The above KASP genotyping primer sequences are: lcd8871936-KF (see SEQ ID No.7): 5'-GAAGGTGACCAAGTTCATGCTCGTATGCATGTCGATCTTCTTCTTCTCT-3'; lcd8871936-KH (see SEQ ID No. 8): 5'-GAAGGTCGGAGTCAACGGATTCGTATGCATGTCGATCTTCTTCTTCTCG-3'; lcd8871936-KC (see SEQ ID No.9): 5′-GACGACCTGGCCGACATC-3′.

[0033] The fluorescent marker genotyping obtained in this example is shown in Figure 4 shown.

[0034] Embodiment 4: Rice mutant obtained in Example 1 OsNramp5 The application of genes in breeding high-quality rice with low cadmium accumulation, namely, using rice mutants OsNramp5 Genetic and quality characteristics of breeding high-quality rice with low cadmium accumulation include the following steps: The F1 was obtained by hybridization of lcd-R2020 and 9311, and the F1 was planted to obtain the F2 generation. The KASP primers lcd8871936-KF, FH, and KC were used to identify the genotype of the lcd8871936 marker in the F2 population, and the agronomic traits of the individual plants containing the lcd8871936 molecular marker were identified. The above process was repeated until the offspring obtained a genetically stable, high-quality, and homozygous lcd8871936 marker low cadmium accumulation restorer line, named lcd-9311.

[0035] After lcd-9311 and the wild-type control grew to the two-leaf and one-heart stage, they were treated with Yoshida rice nutrient solution (0.5 μmol / L CdCl2) for two weeks, and the cadmium content in the stems, leaves and roots of lcd-9311 was measured. The cadmium content in the stems, leaves and roots of lcd-9311 was significantly lower than that in the control material ( Figure 5 ).

Claims

1. A rice mutant OsNramp5 A gene characterized by The rice mutant OsNramp5 The nucleotide sequence of the CDS region of the gene is shown in SEQ ID No.

1.

2. A rice mutant OsNramp5 The amino acid encoded by the gene is characterized in that The amino acid sequence is shown in SEQ ID No.

2.

3. Whether a rice contains the rice mutant according to claim 1 OsNramp5 A method for identifying a gene, characterized in that: The method comprises the following steps: using the rice genomic DNA to be tested as a template, performing PCR amplification using PCR primers, and if only a product with a length of 155 bp is obtained, it indicates that the sample does not contain the rice mutant OsNramp5 If two products with lengths of 147 bp and 155 bp are obtained, it means that the sample contains the rice mutant OsNramp5 gene, and is in a heterozygous state; if only a product of 147 bp in length is obtained, it means that the sample contains the rice mutant in a homozygous state OsNramp5 Gene; The nucleotide sequences of the PCR primers are as follows: lcd8871936-F: 5'-CGACCTCGCCGTCGACGA-3'; lcd8871936-R: 5'-GTACGTATATTCACAATGTACGCGT-3'.

4. Whether a rice contains the rice mutant according to claim 1 OsNramp5 A method for identifying a gene, characterized in that: The method comprises the following steps: using the rice genomic DNA to be tested as a template, performing PCR amplification using KASP genotyping primers, and if only HEX signal is obtained, the sample does not contain the rice mutant OsNramp5 If a FAM / HEX signal is obtained, the sample contains the rice mutant OsNramp5 If only FAM signal is obtained, it indicates that the sample contains the rice mutant in homozygous state. OsNramp5 Gene; The nucleotide sequence of the KASP genotyping primer is as follows: lcd8871936-KF: 5'-GAAGGTGACCAAGTTCATGCTCGTATGCATGTCGATCTTCTTCTTCTCT-3'; lcd8871936-KH: 5'-GAAGGTCGGAGTCAACGGATTCGTATGCATGTCGATCTTCTTCTTCTCG-3'; lcd8871936-KC: 5′-GACGACCTGGCCGACATC-3′.

5. A rice mutant according to claim 1 OsNramp5 Application of genes in breeding rice with low cadmium accumulation.

6. The use according to claim 5, characterized in that: The application comprises the following steps: using the rice mutant OsNramp5 The material of the gene is the donor parent, and the other rice to be improved is the recipient parent. The F1 is hybridized, and the F1 is planted to obtain the F2 generation. Whether the individual plants of the F2 generation population contain the rice mutant OsNramp5 The above process is repeated until the offspring obtains genetically stable rice mutants containing homozygous OsNramp5 The single plant with the gene is the rice with low cadmium accumulation.

7. The use according to claim 6, characterized in that: Rice mutant containing the OsNramp5 The gene material is lcd-R2020, and the receptor parent is 9311.

8. A method for identifying whether rice contains the rice mutant according to claim 1 OsNramp5 A PCR primer for a gene, characterized in that The nucleotide sequences of the PCR primers are as follows: lcd8871936-F: 5'-CGACCTCGCCGTCGACGA-3'; lcd8871936-R: 5'-GTACGTATATTCACAATGTACGCGT-3'.

9. A method for identifying whether rice contains the rice mutant according to claim 1 OsNramp5 A KASP genotyping primer for a gene, characterized in that The nucleotide sequence of the KASP genotyping primer is as follows: lcd8871936-KF: 5'-GAAGGTGACCAAGTTCATGCTCGTATGCATGTCGATCTTCTTCTTCTCT-3'; lcd8871936-KH: 5'-GAAGGTCGGAGTCAACGGATTCGTATGCATGTCGATCTTCTTCTTCTCG-3'; lcd8871936-KC: 5′-GACGACCTGGCCGACATC-3′.

10. Use of the PCR primers according to claim 8 or the KASP genotyping primers according to claim 9 in cultivating rice with low cadmium accumulation.

Images