Soybean transformant nucleic acid specific sequence multi-target detection primer group and application

Abstract

The invention provides a primer group for a soybean transformant nucleic acid specific sequence, application, a product and a method. The primer group for detecting the soybean transformant nucleic acid specific sequences can detect 24 soybean transformant nucleic acid specific sequences and soybean internal reference Lectin gene sequences, the primer group can distinguish negative and positive specific types of a sample to be detected, the detection result is high in accuracy, the sensitivity is high, the sample detection flux is high, and the detection cost is low. The method disclosed by the invention can be widely applied to transgenic soybean variety planting supervision and soybean transformant component screening in non-transgenic varieties, and meanwhile, the screening of transgenic components of bean products can also be accurately detected.

Description

Technical Field

[0001] The present invention relates to the technical field of soybean seed plant and related agricultural product detection, and in particular to a nucleic acid specific sequence component for accurately detecting 24 soybean transformant specific sequences of soybean and its processed products and a soybean internal reference Lectin gene sequence. Background Art

[0002] Soybean is a crop with the most prominent contradiction between supply and demand in my country. my country is one of the major soybean importers in the world. The practice in the United States, Brazil and Argentina has proved that the application of genetically modified soybean and its supporting technologies has effectively reduced variable costs and improved the total factor productivity of soybean. my country has always attached great importance to the development of agricultural genetically modified technology. With the continuous efforts of R&D personnel, a series of major progress has been made in research, providing sufficient conditions for the industrial application of genetically modified soybean. The industrialization of soybean biological breeding requires the improvement of policies and regulations in many aspects such as safety evaluation, intellectual property protection, variety approval, and labeling management to ensure that the industrial application is standardized and orderly.

[0003] The specific sequence of soybean transformants refers to the sequence of the connection region between the 5′ and 3′ ends of the exogenous insertion fragment and the soybean genome, including the soybean genome sequence and the partial sequence of the transformation vector T-DNA. Carrying out specific detection of the sequence of soybean transformants can determine the transformant components while detecting the positive transgenic. It is of great significance for the intellectual property protection and supervision of transgenic products. The detection of transgenic components currently mainly uses PCR methods, conventional PCR, real-time fluorescence PCR and digital PCR. A single reaction well can only complete the detection of a single target, with few detection targets and low detection efficiency. MassARRAY is a detection technology that does not rely on immune reaction or fluorescent labeling, and detects the molecular weight difference of one base between the probe and the extension product by detecting the molecular weight of nucleic acid. MassARRAY combines multiple PCR technology, MassARRAYiPLEX single base extension technology and matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF-MS) to perform genotyping detection on the nucleic acid sites to be detected. Base differences of different molecular weights can be detected simultaneously in one sample, which is conducive to solving the false negative problem caused by uneven amplification efficiency of multiple PCR. This technology has a high degree of automation, simple operation process and high accuracy.

[0004] In summary, with the continuous advancement of the industrialization of biobreeding in my country, there is an urgent need for strong technical support for the implementation of policies, regulations and management measures in terms of safety evaluation and intellectual property protection of soybean transformants.

[0005] In view of this, the present invention is proposed. Summary of the invention

[0006] The object of the present invention is to provide a multi-target detection method for detecting soybean transformants, so as to alleviate the technical problem of low detection target flux in the prior art.

[0007] The object of the present invention is to provide the use of the above primer set for detecting specific sequence sites of soybean transformant nucleic acid in detecting a detection product for accurately detecting soybean and its processed products.

[0008] The purpose of the present invention is to provide a product for detecting specific sequence sites of soybean transformant nucleic acid.

[0009] The invention provides a primer genome for detecting specific sequence sites of soybean transformants. The detected soybean transformants include: A5547-127, MON87751, MON87769, CV127, MON87701, A2704-12, 305423, WYN029GMA, DAS-81419-2, GMB151, MON87708, WYN341GMC, FG72, GTS40-3-2, MON87705, SHZD3201, DAS-44406-6, IND-00410-5, 6106-1, MON89788, DAS-68416-4, CAL16, DBN9004, DBN8002 and a soybean internal reference Lectin gene.

[0010] The present invention also provides the use of the primer genome for detecting specific sequence sites of soybean transformant nucleic acid in a detection product for detecting soybean-related products.

[0011] The present invention also provides a product for detecting specific sequence sites of soybean transformant nucleic acid, which comprises reagents and / or equipment for detecting nucleic acid sequence sites of soybean transformant, and the above-mentioned primer set.

[0012] In addition, the present invention also provides a method for detecting specific sequence sites of soybean transformant nucleic acid, which comprises using the above primer set to detect the soybean transformant nucleic acid sequence sites in the genome of the sample to be tested.

[0013] The above technical solution provided by the embodiment of the present invention has the following advantages compared with the prior art: The embodiment of the present invention provides a primer set for accurately detecting multiple target nucleic acid specific sequence sites of soybean transformants, which can detect soybean transformants including: A5547-127, MON87751, MON87769, CV127, MON87701, A2704-12, 305423, WYN029GMA, DAS-81419-2, GMB151, MON87708, WYN341GMC, FG72, GTS40-3-2, MON87705, SHZD3201, DAS-44406-6, IND-00410-5, 6106-1, MON89788, DAS-68416-4, CAL16, DBN9004, DBN8002 and soybean internal reference Lectin gene. The test results covered 24 soybean transformants. The detection method increased the number of targets detected, shortened the detection cycle, and reduced the detection cost. The test results can meet the requirements for determining the variety specificity of soybean transformants.

[0014] The primers provided by the present invention are optimized, and the amplification products include nucleic acid specific sequences of 24 soybean transformants. The primer design is optimized by adjusting the amplification sites of the primers and the positions of the single base extension design. After sample testing, it is ensured that the primer set can detect the nucleic acid specific sequences of the 24 soybean transformants and can meet the typing requirements of nucleic acid mass spectrometry detection.

[0015] The product for detecting multiple targets of soybean transformants provided by the present invention includes reagents and / or equipment for carrying out detection and the primer set provided by the present invention. The product can accurately detect specific sites of nucleic acid of soybean transformants, has high detection efficiency and simple operation process, and has broad application scenarios in the field of detection of soybeans and their processed products in the process of biobreeding industrialization.

[0016] The method for multi-target detection of soybean transformant nucleic acid specific sequences provided by the present invention comprises using the above-mentioned primer set to detect soybean transformants in the genome of the sample to be tested, specifically: A5547-127, MON87751, MON87769, CV127, MON87701, A2704-12, 305423, WYN029GMA, DAS-81419-2, GMB151, MON87708, WYN341G MC, FG72, GTS40-3-2, MON87705, SHZD3201, DAS-44406-6, IND-00410-5, 6106-1, MON89788, DAS-68416-4, CAL16, DBN9004, DBN8002 and soybean internal reference Lectin gene, including 24 soybean transformants and soybean internal reference, with the characteristics of high accuracy, simple operation and short detection cycle.

[0017] The present invention applies the nucleic acid mass spectrometry platform to the detection of up to 24 soybean transformants for the first time, thereby improving the detection target throughput of a single reaction well, and is suitable for batch detection of a large number of test samples, with low detection cost and strong practicality. The present invention has strong applicability to samples, has good detection capabilities for soybeans and their processed products, and is suitable for processes such as intellectual property protection of soybean varieties and market supervision of soybean transformants in the process of biobreeding industrialization.

[0018] The present invention is described in more detail as follows: A primer component, a kit and a method for detecting specific sites of nucleic acid of soybean transformants based on nucleic acid mass spectrometry technology; According to a first aspect of the present invention, a primer set for detecting specific sites of nucleic acid of soybean transformants is provided, wherein the soybean transformants include: A5547-127, MON87751, MON87769, CV127, MON87701, A2704-12, 305423, WYN029GMA, DAS-81419-2, GMB151, MON87708, WYN341GMC, FG72, GTS40-3-2, MON87705, SHZD3201, DAS-44406-6, IND-00410-5, 6106-1, MON89788, DAS-68416-4, CAL16, DBN9004, DBN8002 and soybean internal reference Lectin gene.

[0019] The primer set for detecting specific sites of soybean transformant nucleic acid provided by the present invention is designed for specific sequences of nucleic acid of soybean transformant, and can realize specific detection of specific sites of soybean transformant nucleic acid, with high accuracy of detection results, short detection cycle, low detection cost, wide coverage, and 95% of soybean transformant materials with production safety certificates obtained in my country. In addition, the primer set designed by the present invention is obtained through optimization and testing, all primers can type samples, and the detection products can meet the detection requirements of mass spectrometry technology.

[0020] The detection primer component of the soybean transformant nucleic acid-specific site comprises 25 pairs of multiple detection primer pairs and 25 single-base extension primers. The target transformant sequence amplified by the detection primer pair is shown as SEQ NO.1 to ID NO.25, the nucleic acid sequences of the detection primer pair are shown as SEQ NO.26 to ID NO.75, and the single-base extension nucleic acid sequences are shown as SEQ NO.76 to ID NO.100.

[0021] In some optional embodiments, the multiple detection primer pairs are used for detecting 24 soybean transformant nucleic acid specific sequences and soybean internal reference Lectin gene, and the 24 soybean transformant nucleic acid specific sites and soybean internal reference gene sequences specifically include: A5547-127, MON87751, MON87769, CV127, MON87701, A2704-12, 305423, WYN029GMA, DAS -81419-2, GMB151, MON87708, WYN341GMC, FG72, GTS40-3-2, MON87705, SHZD3201, DAS-44406-6, IND-00410-5, 6106-1, MON89788, DAS-68416-4, CAL16, DBN9004, DBN8002 and soybean internal reference Lectin gene.

[0022] Table 1 Specific nucleic acid sequences of soybean transformants In some optional embodiments, each primer in the 25 pairs of multiple amplification primer pairs is about 30 bp in length, the annealing temperature is 49.3-68.5, and the length of the amplified fragment is 107 bp-156 bp.

[0023] It should be noted that the primer pairs described in the present invention are all PCR primer pairs in a multiplex amplification reaction system.

[0024] Optionally, an ACGTTGGATG sequence is added before the primer sequences at both ends to increase the molecular weight of the amplification primer to exceed the molecular weight detection range of MassARRAY to avoid interfering with the detection results of the extension product.

[0025] Table 2 Nucleic acid sequence information of soybean transformants detected by 24 pairs of multiple amplification primers In some optional embodiments, the actual detection application requires extension primers, and the primer set also includes 25 single-base extension primers shown in SEQ ID NO. 76-100.

[0026] In some optional embodiments, the length of the extension primer is 15 bp to 28 bp, and the molecular weight of the product is 4390.9 Da to 8563.6 Da.

[0027] Table 3 Sequence information of the 24 single base extension primers Specifically, the primer pairs and extension primers described in the present invention are in one-to-one correspondence, and the corresponding primer pairs and extension primers are used to detect common nucleotide sites. For example, the first primer pair includes the nucleotide sequence corresponding to the transformant as shown in SEQ ID NO.1, the upstream primer and downstream primer sequences as shown in SEQ ID NO.26 and SEQ ID NO.27, and the extension primer of the nucleotide sequence as shown in SEQ ID NO.76, and the above-mentioned amplified output sequence, primer pair and extension primer are all used to detect the same nucleotide site; the second primer pair includes the nucleotide sequence corresponding to the transformant as shown in SEQ ID NO.2, the upstream primer and downstream primer sequences as shown in SEQ ID NO.28 and SEQ ID NO.29, and the extension primer of the nucleotide sequence as shown in SEQ ID NO.77, and the above-mentioned amplified output sequence, primer pair and extension primer are all used to detect the same nucleotide site; the third primer pair includes the nucleotide sequence corresponding to the transformant as shown in SEQ ID NO.3, the upstream primer and downstream primer sequences as shown in SEQ ID NO.30 and SEQ ID NO.31, and the extension primer of the nucleotide sequence as shown in SEQ ID NO.78, and the above-mentioned amplified output sequence, primer pair and extension primer are all used to detect the same nucleotide site; Specifically, the sequence numbers of the amplification sequence, the amplification primer pair, and the extension primer correspond to the sequence of the specific sites of the soybean transformant nucleic acid. The detection sites corresponding to the amplification sequence of the first pair of primers, the first pair of amplification primers, and the first extension primer are A5547-127 ( Figure 1 ); The second pair of primer amplification sequences, the second pair of amplification primers and the second extension primer correspond to the detection site MON87751 ( Figure 2 ); The third pair of primers amplification sequence, the third pair of amplification primers and the third extension primer correspond to the detection site MON87769 ( Figure 3 ); The fourth pair of primers amplification sequence, the fourth pair of amplification primers and the fourth extension primer correspond to the detection site CV127 ( Figure 4 ); the first pair of primer amplification sequences, the first pair of amplification primers and the first extension primer correspond to the detection site MON87701 ( Figure 5 ); Specifically, the single-base extension primer detects the target nucleic acid sequence, and the positive and negative test results are significantly distinguished in the nucleic acid mass spectrum. For example, the sequence of the first pair of primers and the first single-base extension primer product in the positive sample is GCACGCAATGTCATACCGTCAT, the genotype is C, and the molecular weight is 6680.4 Da. The sequence of the first pair of primers and the first single-base extension primer product in the negative sample is GCACGCAATGTCATACCGTCATG, the genotype is DEL, and the molecular weight is 6967.6 Da.

[0028] Table 4 Analysis amount and genotyping of the products detected by 37 pairs of multiplex amplification primers and corresponding single base extension primers in positive samples and negative samples According to a second aspect of the present invention, there is provided the use of the above-mentioned primer set for specific sites of soybean transformant nucleic acid in the preparation of transgenic soybean detection related products.

[0029] According to a third aspect of the present invention, there is provided a product for detecting genetically modified soybeans, the product comprising the above-mentioned primer set.

[0030] This product can achieve specific detection of specific nucleic acid positive sites of soybean transformants, with a short detection cycle, low cost and high accuracy, and has great application value and market promotion prospects.

[0031] In some optional embodiments, the product for detecting transgenic soybean positivity also includes reagents and / or equipment for site-specific detection of soybean transformant nucleic acid.

[0032] Specifically, the reagent and / or device for detecting specific sites of nucleic acid in soybean transformants can be purchased on the market, for example, it can be a universal reagent or kit for detecting specific sites of nucleic acid in the plant field.

[0033] In some optional embodiments, the reagents include PCR Buffer, PCR Enzyme, MgCl2, PrimerMix, dNTP Mix, template and water; In some optional embodiments, the device includes a PCR instrument and a device for detecting specific sites of soybean transformant nucleic acid using MassARRAY.

[0034] In addition, the present invention also provides a method for detecting transgenic soybean positivity, the method comprising using the above primer set to detect soybean transformation nucleic acid specific sites in the genome of the sample to be tested.

[0035] The method can detect soybean transformants: A5547-127, MON87751, MON87769, CV127, MON87701, A2704-12, 305423, WYN029GMA, DAS-81419-2, GMB151, MON87708, WYN341GMC, FG72, GTS40-3-2, MON87705, SHZD3201, DAS-44406-6, IND-00410-5, 6106-1, MON89788, DAS-68416-4, CAL16, DBN9004, DBN8002 and soybean internal reference Lectin nucleic acid specific sequence sites by using the primer set provided by the invention, and has the characteristics of short detection cycle, no need for sequencing, high sensitivity and simple operation.

[0036] In some optional embodiments, the above-mentioned primer set is used to perform PCR amplification on the genome of the sample to be tested, and the amplified product is subjected to a base extension reaction. Finally, MassARRAY is used to detect the product obtained by the reaction to determine the nucleotides at the specific sites of the soybean transformant nucleic acid in the genome of the sample to be tested.

[0037] Genotyping using MassARRAY technology is based on the molecular weight detection of the product to be detected using time-of-flight mass spectrometry technology. First, multiple target sequences to be detected are amplified using multiplex PCR technology, and then extension primers are added. The test sample is judged to be positive based on the molecular weight difference of the extension product designed for the nucleic acid site to be detected.

[0038] Optionally, the above method should first use shrimp alkaline phosphatase to perform a dephosphorylation reaction on the multiple amplification products before carrying out the single base extension reaction. The above steps are necessary steps before the single base extension reaction.

[0039] Optionally, before the detection of single-base extension products is performed in the above method, the products should be purified, and the purification reaction can be performed using a desalting column.

[0040] In some optional embodiments, the primer sets can be grouped together or divided into units to detect the acid-specific sites of soybean transformants in the sample to be detected.

[0041] The primer set was fully optimized to ensure that the primers in the set did not interfere with each other.

[0042] Specifically, primers are designed using the specific sequences of soybean transformants that have obtained my country's safety certificate. The design principle of primers for the specific sequences of soybean transformants is that the multiple amplification products should cover the soybean genome-specific sequences and exogenous gene sequences as much as possible. If the above principles cannot design specific primers, the multiple amplification products should be in the exogenous gene sequence region, and a 10-base universal sequence should be added to the two end sequences of the multiple amplification primers to increase the molecular weight of the amplification products and avoid interfering with the typing results; extension primers are used to detect the amplification products.

[0043] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0044] The specific method is: (1) The specific nucleic acid sequences of 24 soybean transformants and the soybean internal reference Lectin gene sequence were obtained respectively; (2) According to the specific nucleic acid sequences of the 24 soybean transformants and the specific sites of the soybean internal reference Lectin gene sequence, the multiple amplification primer sets and single base extension primers are designed respectively, and the specificity of the primers and amplification products is evaluated to eliminate mutual interference between primers and ensure the product; (3) extracting genomic DNA from the sample to be tested to obtain genomic DNA of the sample; (4) Using the obtained genomic DNA of the sample to be tested as a template, the primer set and related reagents are used to perform an amplification reaction to obtain an amplification product. The amplification system is as follows: Reagent Volume Concentration PCR Multiple Amplification Enzyme 0.2 μM 5 U / μL Primer Mix 1 μM 0.5 μM dNTP Mix 0.1 μM 25 mM PCR Buffer 0.625 μM 10 X <![CDATA[MgCl2]]> 0.325 μM 25 mM template 1 μM 10 ng / μL Water, HPLC grade 1.75 μM NA Total 5 μM The reaction procedure is:

[0045] (5) The multiple amplification products are subjected to alkaline phosphatase digestion to remove excess dNTPs in the products. The digestion system is as follows: Reagent Volume Concentration SAP 0.3 μM 1.7 U / μL SAP Buffer 0.17 μM 10 X Water 1.53 μM NA Total 5 μM The reaction procedure is: Temperature (℃) Times (min) Cycle 37 40 1 85 5 1 4 ∞ 1 (6) The digested amplified product is used as a template to perform a single base extension reaction using the single base extension primer, amplification reagent, and ddNTP. The reaction system for single base extension is as follows: Reagent Volume Concentration iPLEX Enzyme 0.76 μM 5 U / μL Primer Mix 0.2 μM 0.5 μM iPLEX Buffer Plus 0.2 μM 10 X iPLEX terminator 0.8 μM 25 mM Water, HPLC grade 0.04 μM NA Total 5 μM The reaction procedure is:

[0046] (7) The amplified product was diluted 3 times and then desalted using resin.

[0047] (8) Place the desalted sample on the sample target and allow it to crystallize naturally; (9) Perform nucleic acid mass spectrometry on the crystallized sample target and collect data.

[0048] In the embodiment of the present application, the above method uses a multiple detection primer set as an amplification system and uses the genomic DNA of the soybean to be detected and its derivative products as a template to effectively amplify the soybean transformant and the internal reference Lectin gene nucleotide sequence components in the sample to be detected, thereby ensuring the stability of the single base extension reaction template. The single base extension product is subjected to nucleic acid mass spectrometry detection to distinguish the molecular weight of the product and determine the genotype, thereby determining the relevant soybean transformant and the internal reference Lectin gene positive site. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 The cluster peak diagram of the site A5547-127 corresponding to the first pair of amplification primers and extension primers of the present invention; Figure 2 The cluster peak diagram of the site MON87751 corresponding to the second pair of amplification primers and extension primers of the present invention; Figure 3 The cluster peak diagram of the site MON87769 corresponding to the first pair of amplification primers and extension primers of the present invention; Figure 4 The cluster peak diagram of the site CV127 corresponding to the first pair of amplification primers and extension primers of the present invention; Figure 5 The cluster peak diagram of the site MON87701 corresponding to the first pair of amplification primers and extension primers of the present invention; Figure 6 The cluster peak diagram of the CAL16 site before the optimized primer provided in Example 1 of the present invention; Figure 7 This is the cluster peak diagram of the CAL16 site after the primers are optimized according to Example 1 of the present invention. DETAILED DESCRIPTION

[0050] The present invention will be further described below with reference to specific embodiments, but is not limited thereto.

[0051] In order to ensure the specificity of the detection of the soybean transformant nucleic acid specific site, the amplification product of the detection primer should contain the soybean genome sequence and the exogenous insertion sequence upstream or downstream of the exogenous gene detection site. Therefore, when designing the detection primer, one of the amplification primers should be located on the soybean genome of the soybean transformant nucleic acid specific sequence, and the other primer should be located on the exogenous gene of the soybean transformant nucleic acid specific sequence.

[0052] Taking the optimization of CAL16 locus primers as an example, the CAL16 locus primers had the problem of being detected in non-target samples before optimization. After redesigning the PCR primers and changing the single-base extension primers, the upstream primers were changed to: ACGTTGGATGAATGGCGAATGCTAGAGCAG, the downstream primers were changed to: ACGTTGGATGTCTCTTCTACTCCTCATGTC, the single-base extension primers detected by positive transformants were changed to: GCAGTTTTAAACTATCAGTGTTTGA, with a molecular weight of 7068.6Da, and the single-base extension primers detected by negative transformants were changed to: GCAGTTTTAAACTATCAGTGTTTGG, with a molecular weight of 7355.8Da. The test was carried out according to the experimental steps described in the specific method. The specific cluster peak diagrams before and after the primers were changed are as follows: Figure 6 and Figure 7 Before the primers were changed, the CAL16 locus was detected at other sites except the positive DNA template of CAL16 soybean transformant ( Figure 7 ), after primer optimization, the specificity of CAL16 detection was enhanced, and it was detected only at other sites of the positive DNA template of CAL16 soybean transformants ( Figure 7 ).

[0053] Preparation process: According to the relevant sequences in the qualitative PCR method of herbicide-resistant, insect-resistant and herbicide-resistant soybean transformants and their derivative varieties involved in the national standards of the People's Republic of China, the nucleotide sequences of soybean transformants and the internal reference Lectin gene were collected and sorted. The soybean transformants involved were: A5547-127, MON87751, MON87769, CV127, MON87701, A2704-12, 305423, WYN029GMA, DAS-81419-2, GMB151, MON87708, WYN341GMC, FG72, GTS40-3-2, MON87705, SHZD3201, DAS-44406-6, IND-00410-5, 6106-1, MON89788, DAS-68416-4, CAL16, DBN9004, DBN8002. According to the collection and collation of soybean transformant nucleotide sequences and internal reference Lectin gene sequences, nucleic acid mass spectrometry detection multiple amplification primers and single base extension primers were designed, the primer set was designed, the specificity of the primers was evaluated, and mutual interference between primers was eliminated.

[0054] Application method: Use CTAB or plant DNA extraction kit to obtain the DNA of the sample to be tested, and dilute the obtained DNA to the concentration required for nucleic acid mass spectrometry detection as a detection template.

[0055] ① Multiplex PCR amplification reaction: Add each reaction component according to the optional reaction system. The specific system is shown in the following table: Reagent Volume Concentration PCR Multiple Amplification Enzyme 0.2 μM 5 U / μL Primer Mix 1 μM 0.5 μM dNTP Mix 0.1 μM 25 mM PCR Buffer 0.625 μM 10 X <![CDATA[MgCl2]]> 0.325 μM 25 mM template 1 μM 10 ng / μL Water, HPLC grade 1.75 μM NA Total 5 μM According to the optional reaction program, the reaction system is mixed and then the multiple amplification reaction is started. The reaction program is shown in the following table:

[0056] ② SAP digestion treatment: According to the optional reaction system, the amplified product is treated with alkaline phosphatase (SAP) to remove excess dNTPs in the product. The specific reaction system is shown in the following table: Reagent Volume Concentration SAP 0.3 μM 1.7 U / μL SAP Buffer 0.17 μM 10 X Water 1.53 μM NA Total 5 μM After mixing the components, perform SAP digestion according to the optional reaction procedure: Temperature (℃) Times (min) Cycle 37 40 1 85 5 1 4 ∞ 1 ③ Extension reaction: According to the optional reaction system, the product after SAP digestion is subjected to a single base extension reaction. The specific reaction system is shown in the following table: Reagent Volume Concentration PCR Multiple Amplification Enzyme 0.2 μM 5 U / μL Primer Mix 1 μM 0.5 μM dNTP Mix 0.1 μM 25 mM PCR Buffer 0.625 μM 10 X <![CDATA[MgCl2]]> 0.325 μM 25 mM template 1 μM 10 ng / μL Water, HPLC grade 1.75 μM NA Total 5 μM According to the optional reaction program, the reaction system is mixed and then the multiple amplification reaction is started. The reaction program is shown in the following table:

[0057] ④ On-machine detection: dilute the reaction product 3 times and use resin for desalting. Spot the desalted sample on the sample target to allow it to crystallize naturally. Finally, carry out mass spectrometry detection on the machine and collect data.

[0058] ⑤ Result analysis: nucleic acid typing analysis of the detection site is performed according to the nucleic acid mass spectrometry peak diagram. For example, in the MON87751 soybean transformant nucleic acid specific sequence, the positive typing is T and the negative typing is DELL according to the design of MON87751 soybean transformant; if the nucleic acid typing detected at the MON87751 site is T, it means that the test sample is positive homozygous at this site; if the nucleic acid typing detected at the MON87751 site is DELL, it means that the test sample is negative homozygous at this site; if the nucleic acid typing detected at the MON87751 site is A and DLL, the test sample is positive heterozygous at this site; and so on, the positive judgment results of other sites are carried out. The positive results of each site are comprehensively analyzed for the positive analysis of the soybean transformant nucleic acid specific site of the sample to be tested, the transformant type of the soybean variety is determined, and the intellectual property protection of the relevant soybean transformant varieties is carried out.

[0059] Preparation process: According to the relevant sequences in the qualitative PCR method of herbicide-resistant, insect-resistant and herbicide-resistant soybean transformants and their derivative varieties involved in the national standards of the People's Republic of China, the nucleotide sequences of soybean transformants and the internal reference Lectin gene were collected and sorted. The soybean transformants involved were: A5547-127, MON87751, MON87769, CV127, MON87701, A2704-12, 30 5423, WYN029GMA, DAS-81419-2, GMB151, MON87708, WYN341GMC, FG72, GTS40-3-2, MON87705, SHZD3201, DAS-44406-6, IND-00410-5, 6106-1, MON89788, DAS-68416-4, CAL16, DBN9004, DBN8002. According to the collected and collated soybean transformant nucleotide sequences and the internal reference Lectin gene sequences, multiple amplification primers and single base extension primers for nucleic acid mass spectrometry detection were designed, multiple amplification primers and single base extension primers for nucleic acid mass spectrometry detection were designed, the primer sets were designed, the specificity of the primers was evaluated, and the mutual interference between the primers was eliminated.

[0060] (3) Application method: The DNA of the sample to be tested is obtained by CTAB or plant DNA extraction kit, and the obtained DNA is diluted to the concentration required for nucleic acid mass spectrometry detection as a detection template.

[0061] ① Multiplex PCR amplification reaction: According to the optional reaction system and amplification procedure, the multiplex amplification reaction is carried out according to the components and reaction procedure described in Example 1 ② SAP digestion treatment: According to the optional reaction system and the optional reaction procedure, SAP digestion treatment is performed according to the components and reaction procedures described in Example 1; ③ Extension reaction: according to the optional reaction system and the optional reaction procedure, the extension reaction is carried out according to the components and the reaction procedure described in Example 1; ④ On-machine detection: dilute the reaction product 3 times and use resin for desalting. Spot the desalted sample on the sample target to allow it to crystallize naturally. Finally, carry out mass spectrometry detection on the machine and collect data.

[0062] ⑤ Result analysis: nucleic acid typing analysis of the detection site is performed according to the nucleic acid mass spectrometry peak diagram. For example, in the MON87751 soybean transformant nucleic acid specific sequence, the positive typing designed according to the MON87751 soybean transformant is T, and the negative typing is DELL; if the nucleic acid typing detected at the MON87751 site is T, then it means that the test sample is positive homozygous at this site; if the nucleic acid typing detected at the MON87751 site is DELL, then it means that the test sample is negative homozygous at this site; if the nucleic acid typing detected at the MON87751 site is A and DLL, then the test sample is positive heterozygous at this site; and so on, the positive judgment results of other sites are performed. The positive results of each site are combined to determine the positive components of the soybean transformant nucleic acid specific site of the sample to be tested, and then the transgenic positive component analysis is carried out, and the supervision of transgenic soybean varieties during the planting process and the screening of soybean transformant components in non-transgenic varieties are carried out.

[0063] Preparation process: Genomic DNA, as a stable genetic material, can be detected in most soybean products. According to the relevant sequences in the qualitative PCR method of herbicide-resistant, insect-resistant and herbicide-resistant soybean transformants and their derivatives involved in the national standards of the People's Republic of China, the soybean transformants nucleotide sequences and internal reference Lectin genes were collected and sorted. The soybean transformants involved were: A5547-127, MON87751, MON87769, CV127, MON87701, A2704-12, 30542 3. WYN029GMA, DAS-81419-2, GMB151, MON87708, WYN341GMC, FG72, GTS40-3-2, MON87705, SHZD3201, DAS-44406-6, IND-00410-5, 6106-1, MON89788, DAS-68416-4, CAL16, DBN9004, DBN8002. According to the collected and collated soybean transformant nucleotide sequences and the internal reference Lectin gene sequences, multiple amplification primers for nucleic acid mass spectrometry detection and single base extension primers were designed, multiple amplification primers for nucleic acid mass spectrometry detection and single base extension primers were designed, the primer sets were designed, the specificity of the primers was evaluated, and mutual interference between primers was eliminated.

[0064] Application method: Use the extraction method suitable for DNA extraction in soybean products to prepare the DNA of the sample to be tested, and dilute the obtained DNA to the concentration required for nucleic acid mass spectrometry detection as a detection template.

[0065] ① Multiplex PCR amplification reaction: According to the optional reaction system and amplification procedure, the multiplex amplification reaction is carried out according to the components and reaction procedure described in Example 1 ② SAP digestion treatment: According to the optional reaction system and the optional reaction procedure, SAP digestion treatment is performed according to the components and reaction procedures described in Example 1; ③ Extension reaction: according to the optional reaction system and the optional reaction procedure, the extension reaction is carried out according to the components and the reaction procedure described in Example 1; ④ On-machine detection: dilute the reaction product 3 times and use resin for desalting. Spot the desalted sample on the sample target to allow it to crystallize naturally. Finally, carry out mass spectrometry detection on the machine and collect data.

[0066] ⑤ Result analysis: nucleic acid typing analysis of the detection site is performed according to the nucleic acid mass spectrometry peak diagram. For example, in the MON87751 soybean transformant nucleic acid specific sequence, the positive typing designed according to the MON87751 soybean transformant is T, and the negative typing is DELL; if the nucleic acid typing detected at the MON87751 site is T, then it means that the test sample is positive homozygous at this site; if the nucleic acid typing detected at the MON87751 site is DELL, then it means that the test sample is negative homozygous at this site; if the nucleic acid typing detected at the MON87751 site is A and DLL, then the test sample is positive heterozygous at this site; and so on, the positive judgment results of other sites are carried out. The positive results of each site are combined to determine the positive components of the soybean transformant nucleic acid specific site of the sample to be tested, and then the analysis of the positive components of the transgenic is carried out, and the screening of transgenic components in soybean products is carried out.

[0067] Preparation process: According to the relevant sequences in the qualitative PCR method of herbicide-resistant, insect-resistant and herbicide-resistant soybean transformants and their derivative varieties involved in the national standards of the People's Republic of China, the nucleotide sequences of soybean transformants and the internal reference Lectin gene were collected and sorted. The soybean transformants involved were: A5547-127, MON87751, MON87769, CV127, MON87701, A2704-12, 30 5423, WYN029GMA, DAS-81419-2, GMB151, MON87708, WYN341GMC, FG72, GTS40-3-2, MON87705, SHZD3201, DAS-44406-6, IND-00410-5, 6106-1, MON89788, DAS-68416-4, CAL16, DBN9004, DBN8002. According to the collected and collated soybean transformant nucleotide sequences and the internal reference Lectin gene sequences, multiple amplification primers for nucleic acid mass spectrometry detection and single base extension primers were designed, multiple amplification primers for nucleic acid mass spectrometry detection and single base extension primers were designed, the primer sets were designed, the specificity of the primers was evaluated, and the mutual interference between the primers was eliminated.

[0068] Application method: 1% DNA of MON87701 and MON87751 soybean transformants was extracted using the CTAB method, and the DNA was diluted to a concentration of 10 ng / μL as a template for the detection of positive sites.

[0069] ① Multiplex PCR amplification reaction: According to the optional reaction system and amplification procedure, the multiplex amplification reaction is carried out according to the components and reaction procedure described in Example 1 ② SAP digestion treatment: According to the optional reaction system and the optional reaction procedure, SAP digestion treatment is performed according to the components and reaction procedures described in Example 1; ③ Extension reaction: according to the optional reaction system and the optional reaction procedure, the extension reaction is carried out according to the components and the reaction procedure described in Example 1; ④ On-machine detection: dilute the reaction product 3 times and use resin for desalting. Spot the desalted sample on the sample target to allow it to crystallize naturally. Finally, carry out mass spectrometry detection on the machine and collect data.

[0070] ⑤ Result analysis: nucleic acid typing analysis of the detection site is performed according to the nucleic acid mass spectrometry peak diagram. For example, in the MON87751 soybean transformant nucleic acid specific sequence, the positive typing designed according to the MON87751 soybean transformant is T, and the negative typing is DELL; if the nucleic acid typing detected at the MON87751 site is T, then it means that the test sample is positive homozygous at this site; if the nucleic acid typing detected at the MON87751 site is DELL, then it means that the test sample is negative homozygous at this site; if the nucleic acid typing detected at the MON87751 site is A and DLL, then the test sample is positive heterozygous at this site; and so on, the positive judgment results of other sites are carried out. The positive results of each site are combined to determine the positive components of the soybean transformant nucleic acid specific site of the sample to be tested, and then the analysis of the positive components of the transgenic is carried out, and the screening of transgenic components in soybean products is carried out.

Claims

1. A primer set for detecting specific sequences of multiple soybean transformants, characterized in that: Multiple amplification primers and single base extension primers for specific detection of soybean transformants, the primer set sequence is shown in SEQ ID NO. 26-100.

2. Use of the primer set for detecting multiple soybean transformant specific sequences as claimed in claim 1 in preparing a product for detecting soybean transformant specific sequences; the soybean transformant specific sequence product comprises: Its application in the monitoring of the cultivation of transgenic soybean varieties and the screening of soybean transformant components in non-transgenic varieties, as well as its application in the screening of transgenic components in soy products.

3. A product for soybean transformant-specific sequences, characterized in that The product comprises the primer set described in claim 1.

4. The product according to claim 3, characterized in that Reagents and / or equipment for detecting specific nucleic acid sequences of soybean transformants; the reagents include PCR Buffer, PCR Enzyme, MgCl2, Primer Mix, dNTP Mix, template and water; the equipment includes a PCR instrument and a nucleic acid mass spectrometer.

5. A method for detecting multiple soybean transformant-specific sequences, the method being based on a molecular detection method of nucleic acid sequence specificity, the method comprising using the amplification primer and single-base extension primer of claim 1 to detect the nucleotides of the soybean transformant-specific sequence and the soybean internal reference Lectin gene sequence in the sample to be tested.

6. The method according to claim 5, characterized in that The multiple amplification primer set described in claim 1 is used to amplify the soybean transformant-specific sequence and the soybean internal reference Lectin gene sequence of the sample to be detected, the amplification product is extended using a single base extension primer, and then the single base extension product is detected using a nucleic acid mass spectrometer to determine the nucleotide sites of the soybean transformant-specific sequence and the soybean internal reference Lectin gene in the sample to be detected.

7. The method according to claim 6, characterized in that The transformant-specific sequences contained in the primer genome are as follows: soybean transformants A5547-127, MON87751, MON87769, CV127, MON87701, A2704-12, 305423, WYN029GMA, DAS-81419-2, GMB151, MON87708, WYN341GMC, FG72, GTS40-3-2, MON87705, SHZD3201, DAS-44406-6, IND-00410-5, 6106-1, MON89788, DAS-68416-4, CAL16, DBN9004, DBN8002 and soybean internal reference Lectin gene.

Images