Antibacterial peptide and application thereof

Abstract

The invention discloses an antibacterial peptide and application thereof. The antibacterial peptide can inhibit bacteria and can be applied to a feed composition. When the feed is used for feeding the Songyang chickens, the growth performance and the egg laying performance of the Songyang chickens can be remarkably improved, and the feed has a potential application prospect.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to an antimicrobial peptide and application thereof. Background Art

[0002] In animal husbandry, disease prevention and control is an important part, especially in the current intensive feeding situation, bacterial diseases are prone to occur. Antibiotics are often used as a means of prevention and control, but it is very easy to develop drug resistance and reduce the prevention and control effect. In order to improve the prevention and control effect, multiple antibiotics with different resistances are often added. Multiple antibiotics may have antagonism and poor effects, and the use of multiple antibiotics may damage the animal's digestive system, thereby affecting the feeding effect and causing a decline in breeding income.

[0003] Antimicrobial peptides have the advantages of broad-spectrum antimicrobial activity, thermal stability, no residue, and low resistance to drugs. In the prior art, many antimicrobial peptides have been used in the field of breeding. For example, in the field of aquaculture, antimicrobial peptides are mostly used as new antibiotic substitutes. In the field of livestock and poultry breeding, the use of antimicrobial peptides as feed additives is a major application direction. For example, adding cecropin antimicrobial peptides to the basic feed of pregnant sows can improve the health rate of sow piglets and reduce the diarrhea rate of piglets (Guo Qiang, He Tao. Effects of adding cecropin antimicrobial peptides to the daily diet of pregnant sows on reproductive performance and postpartum piglet growth performance [J]. Feed and Animal Husbandry, 2012 (12): 54-56.). After piglets were fed antimicrobial peptides, it was found that the levels of IL-6 and TNF-α in their serum were significantly reduced (HU WY, YANG YY, LI Z, et al. Antibacterial, cyto-toxicity and mechanism of the antimicrobial peptide KR-32 in weaning piglets[J]. International Journal of Peptide Research and Therapeutics, 2020, 26(2): 943-953.), which illustrates the role of antimicrobial peptides as feed additives.

[0004] Currently, antimicrobial peptides are mostly short peptides in their natural form, but there is still room for improvement in natural antimicrobial peptides. For example, researchers have found that the folding mode of antimicrobial peptides may affect their effects, which has become another direction for the development of antimicrobial peptides. In order to solve the above problems, the present invention provides an antimicrobial peptide and application thereof.

[0005] In one aspect, the invention provides a polypeptide comprising an amino acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100% identical to the amino acid sequence shown in SEQ ID NO:1.

[0006] In one aspect, the present invention provides a nucleic acid molecule encoding the polypeptide of the present invention.

[0007] In one aspect, the present invention provides an expression vector comprising the nucleic acid molecule of the present invention.

[0008] In one aspect, the present invention provides a host cell comprising the nucleic acid molecule or expression vector of the present invention.

[0009] In one aspect, the present invention provides a composition comprising the polypeptide of the present invention.

[0010] In one aspect, the present invention provides a pharmaceutical composition comprising the polypeptide or composition of the present invention.

[0011] In one aspect, the present invention provides a feed composition comprising the polypeptide or composition of the present invention.

[0012] In one aspect, the present invention provides use of the polypeptide, nucleic acid molecule, expression vector, composition or feed composition in the preparation of animal feed.

[0013] In another aspect, the present invention also provides a method for improving feeding effect of animals, which comprises feeding the feed composition of the present invention.

[0014] Beneficial Effects The present invention mutates known antimicrobial peptides and finds 10 possible mutation modes by increasing β-folding. When the antimicrobial peptides are used as antibacterial agents to inhibit Staphylococcus aureus, the antibacterial effect is significantly stronger than that of the wild type.

[0015] The present invention develops a composition based on antimicrobial peptides. When the composition is used in feed, it can significantly improve the feeding effect of chickens and has potential application value.

[0016] The antimicrobial peptide of the invention is relatively short, has a simple preparation method and is suitable for large-scale application.

[0017] The above description is only an overview of the technical solution of the present invention. In order to more clearly understand the technical means of the present invention and implement it according to the contents of the specification, the following is a description of the preferred embodiments of the present invention. Summary of the invention

[0018] In order to solve the above problems, the present invention provides an antimicrobial peptide and application thereof.

[0019] In one aspect, the invention provides a polypeptide comprising an amino acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100% identical to the amino acid sequence shown in SEQ ID NO:1.

[0020] In one aspect, the present invention provides a nucleic acid molecule encoding the polypeptide of the present invention.

[0021] In one aspect, the present invention provides an expression vector comprising the nucleic acid molecule of the present invention.

[0022] In one aspect, the present invention provides a host cell comprising the nucleic acid molecule or expression vector of the present invention.

[0023] In one aspect, the present invention provides a composition comprising the polypeptide of the present invention.

[0024] In one aspect, the present invention provides a pharmaceutical composition comprising the polypeptide or composition of the present invention.

[0025] In one aspect, the present invention provides a feed composition comprising the polypeptide or composition of the present invention.

[0026] In one aspect, the present invention provides use of the polypeptide, nucleic acid molecule, expression vector, composition or feed composition in the preparation of animal feed.

[0027] In another aspect, the present invention also provides a method for improving feeding effect of animals, which comprises feeding the feed composition of the present invention.

[0028] Beneficial Effects (1) The present invention mutates known antimicrobial peptides and finds 10 possible mutation modes by increasing β-folding. When the antimicrobial peptides are used as antibacterial agents to inhibit Staphylococcus aureus, the antibacterial effect is significantly stronger than that of the wild type.

[0029] (2) The present invention develops a composition based on antimicrobial peptides. When the composition is used in feed, it can significantly improve the feeding effect of chickens and has potential application value.

[0030] (3) The antimicrobial peptide of the present invention is relatively short, has a simple preparation method, and is suitable for large-scale application.

[0031] The above description is only an overview of the technical solution of the present invention. In order to more clearly understand the technical means of the present invention and implement it according to the contents of the specification, the following is a description of the preferred embodiments of the present invention. DETAILED DESCRIPTION

[0032] General techniques The techniques and procedures described or referenced herein include those generally well understood by those skilled in the art and / or commonly employed using routine methods, such as the widely used methods described in Sambrook et al., Molecular Cloning: A Laboratory Manual (3rd ed., 2001); Current Protocols in Molecular Biology (Ausubel et al., eds., 2003).

[0033] General terms Unless otherwise described, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art. For the purpose of interpreting this specification, the following term description will be applied, and where appropriate, terms used in the singular will also include the plural form, and vice versa. All patents, applications, published applications and other publications are incorporated by reference in their entirety. If any description of a term set forth conflicts with any document incorporated herein by reference, the term description set forth below shall prevail.

[0034] As used herein, the terms "antimicrobial peptide", "antimicrobial polypeptide", "antimicrobial protein" and "antimicrobial protein" are synonymous and are used herein to refer to polymers of amino acid residues with antimicrobial, bacteriostatic or bactericidal functions. The term applies to amino acid polymers in which one or more amino acid residues are artificial chemical mimetics of the corresponding naturally occurring amino acids, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymers. Unless otherwise stated, a specific polypeptide sequence also implicitly encompasses conservatively modified variants thereof".

[0035] As used herein, the term "amino acid" means the twenty common naturally occurring amino acids. Naturally occurring amino acids include alanine (A), arginine (R), asparagine (N), aspartic acid (D), cysteine ​​(C); glutamic acid (E), glutamine (Q), glycine (G), histidine (H), isoleucine (I), leucine (L), lysine (K), methionine (M), phenylalanine (F), proline (P), serine (S), threonine (T), tryptophan (W), tyrosine (Y) and valine (V).

[0036] The term "administer" or "administration" refers to the operation of injecting or otherwise physically delivering a substance (e.g., a therapeutic agent) present in vitro into a patient's body, such as by transmucosal, intradermal, intravenous, intramuscular delivery, and / or any other physical delivery method described herein or known in the art. When treating a disease, disorder, condition, or symptom thereof, the administration of the substance is typically performed after the onset of the disease, disorder, condition, or symptom thereof. When preventing a disease, disorder, condition, or symptom thereof, the administration of the substance is typically performed before the onset of the disease, disorder, condition, or symptom thereof.

[0037] As used herein, an "effective amount" is generally an amount sufficient to reduce the severity and / or frequency of symptoms; eliminate symptoms and / or potential causes; prevent the occurrence of symptoms and / or their potential causes; and / or improve or remedy damage caused by a disease, disorder or condition, including, for example, an infection and neoplasm formation or associated therewith. In some embodiments, an effective amount is a therapeutically effective amount or a prophylactically effective amount.

[0038] As used herein, the term "therapeutically effective amount" refers to an amount of an agent (e.g., a vaccine composition) sufficient to reduce and / or improve the severity and / or duration of a given disease, disorder or condition, and / or its associated symptoms (e.g., infectious diseases, such as those caused by viral infection, or neoplastic diseases, such as cancer). A "therapeutically effective amount" of a substance / molecule / agent of the present disclosure (e.g., a lipid nanoparticle composition described herein) may vary according to a number of factors, such as the disease state, age, sex, and weight of the individual, and the ability of the substance / molecule / agent to elicit a desired response in the individual. A therapeutically effective amount includes an amount in which the therapeutically beneficial effects of a substance / molecule / agent outweigh any toxic or deleterious effects thereof.

[0039] As used herein, a "prophylactically effective amount" is an amount of a pharmaceutical composition that will have an expected preventive effect when administered to a subject, such as preventing a disease, disorder, illness, or related symptoms (e.g., an infectious disease, such as an infectious disease caused by a viral infection, or a neoplastic disease, such as cancer), delaying its onset (or recurrence), or reducing its onset (or recurrence) likelihood. Typically, but not necessarily, since a preventive dose is used for a subject before a disease, disorder, or illness or in its early stages, the preventive effective amount may be less than the therapeutically effective amount. A complete therapeutic or preventive effect may not occur by administering a single dose, but may only occur after a series of doses are administered. Therefore, a therapeutically or prophylactically effective amount may be administered in one or more administrations.

[0040] As used herein and unless otherwise indicated, the terms "treat," "treating," or "treatment" refer to alleviating a condition, disease, or disorder, or one or more symptoms associated with a condition, disease, or disorder, or slowing or stopping the further progression or worsening of those symptoms, or alleviating or eradicating the cause of the condition, disease, or disorder itself.

[0041] As used herein and unless otherwise indicated, the terms "prevent", "preventing" and "prevention" refer to reducing the likelihood of the onset (or recurrence) of a disease, disorder, condition or related symptoms (e.g., an infectious disease, such as an infectious disease caused by a viral infection, or a neoplastic disease, such as cancer).

[0042] As used herein and unless otherwise indicated, the term "management" refers to the beneficial effects that a subject obtains from a therapy (e.g., a prophylactic or therapeutic agent) that does not result in a cure of the disease. In certain embodiments, one or more therapies (e.g., a prophylactic or therapeutic agent, such as a lipid nanoparticle composition described herein) are administered to a subject to "manage" an infectious or neoplastic disease, one or more symptoms thereof, thereby preventing progression or worsening of the disease.

[0043] The term "prophylactic agent" refers to any agent that can completely or partially inhibit the development, recurrence, onset, or spread of a disease and / or its associated symptoms in a subject.

[0044] The term "therapeutic agent" refers to any agent useful in treating, preventing or alleviating a disease, disorder or condition, including any agent useful in treating, preventing or alleviating one or more symptoms of a disease, disorder or condition and / or its associated symptoms.

[0045] The term "therapy" refers to any regimen, method and / or agent that can be used to prevent, manage, treat and / or improve a disease, disorder or condition. In certain embodiments, the term "therapy" refers to biological therapy, supportive therapy and / or other therapies known to those skilled in the art, such as medical personnel, that can be used to prevent, manage, treat and / or improve a disease, disorder or condition.

[0046] The terms "subject" and "patient" are used interchangeably. As used herein, in certain embodiments, the subject is a mammal, such as a non-primate (e.g., cattle, pigs, horses, cats, dogs, rats, etc.) or a primate (e.g., monkeys and humans). In specific embodiments, the subject is a human. In one embodiment, the subject is a mammal (e.g., a human) suffering from an infectious disease or a neoplastic disease. In another embodiment, the subject is a mammal (e.g., a human) at risk of developing an infectious disease or a neoplastic disease.

[0047] As used herein, "substantially all" means at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or about 100%.

[0048] As used herein and unless otherwise indicated, the term "about" or "approximately" means an acceptable error of a particular value determined by one of ordinary skill in the art, which depends in part on the manner in which the value is measured or determined. In certain embodiments, the term "about" or "approximately" means within 1, 2, 3, or 4 standard deviations. In certain embodiments, the terms "about" and "approximately" mean within 20%, within 15%, within 10%, within 9%, within 8%, within 7%, within 6%, within 5%, within 4%, within 3%, within 2%, within 1%, within 0.5%, within 0.05%, or lower of a given value or range.

[0049] As used herein, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise.

[0050] All publications, patent applications, deposit numbers, and other references cited herein are incorporated herein by reference in their entirety to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference. The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein should be construed as an admission that the present invention is not entitled to antedate such publications by virtue of prior invention. In addition, the publication dates provided may differ from the actual publication dates, which may need to be independently confirmed.

[0051] A number of embodiments of the present invention have been described. However, it should be understood that various modifications can be made without departing from the spirit and scope of the present invention. Therefore, the descriptions in the experimental section and examples are intended to illustrate rather than limit the scope of the invention described in the claims.

[0052] Antimicrobial peptides Wild-type antimicrobial peptide The present disclosure provides a new variant of an antimicrobial peptide, the antimicrobial peptide WT, which is selected from the black soldier fly antimicrobial peptide Cecropin-α recorded in CN202011471892.5, which is used as the research basis, and its amino acid sequence is as follows: MNFSKLFVFVAVVIALLVAFAGQSEAGWSRSLWFKKIEKPVERAGQRIRDATIQGIAIQQGANVLTVRGGVLAQARGLKG Antimicrobial peptide variants In some embodiments, the selected groups of amino acids that are considered to be conservative substitutions for each other are: Acidic residue D and E Basic residues K, R and H Hydrophilic uncharged residues S, T, N and Q Aliphatic uncharged residue G, A, V, L, and I Nonpolar uncharged residues C, M and P Aromatic residues F, Y and W 1 group A, S and T 2 groups D and E 3 groups N and Q 4 groups R and K 5 groups I, L, and M 6 groups F, Y and W In some embodiments, other selected groups of amino acids that are considered to be conservative substitutions for each other are: Considering that its activity is related to the folding mode of the polypeptide, the applicant predicted its structure and believed that increasing its β-folding could improve its antibacterial properties and found a mutation method.

[0053] Mutation Group Mutation method Mutated codon Mutation 1 A15I ATT Mutation 2 A15F TTC Mutation 3 A15W TGG Mutation 4 A15T ACG Mutation 5 A15Y TAC Mutation 6 G61V GTG Mutation 7 G61F TTC Mutation 8 G61W TGG Mutation 9 G61T ACG Mutation 10 G61I ACC Compositions containing antimicrobial peptides In one embodiment, the pharmaceutical composition described herein refers to one or more antimicrobial peptides JL33 described herein, as well as other components such as physiological / pharmaceutically acceptable carriers and excipients. The purpose of the pharmaceutical composition is to facilitate administration to an organism, facilitate the absorption of the active ingredient, and thus exert biological activity. In this disclosure, "pharmaceutical composition" and "preparation" are not mutually exclusive.

[0054] In some embodiments, when delivering the pharmaceutical composition to animals (eg, poultry), a variety of delivery systems are known and can be used to administer the pharmaceutical composition. Methods of introduction include, but are not limited to, eye drops, intranasal, and oral routes.

[0055] Feed additives containing antimicrobial peptides The feed additive referred to in this article contains antimicrobial peptide JL33 and / or its homologues. When the additive is used, it is mixed into the feed composition, so the antimicrobial peptide JL33 can be used in combination with one or more of the following: nutritionally acceptable carriers, nutritionally acceptable diluents, nutritionally acceptable excipients, nutritionally acceptable adjuvants, and nutritionally active ingredients. For example, at least one component selected from the group consisting of proteins, peptides, sucrose, lactose, sorbitol, glycerol, propylene glycol, sodium chloride, sodium sulfate, sodium acetate, sodium citrate, sodium formate, sodium sorbate, potassium chloride, potassium sulfate, potassium acetate, potassium citrate, potassium formate, potassium acetate, potassium sorbate, magnesium chloride, magnesium sulfate, magnesium acetate, magnesium citrate, magnesium formate, magnesium sorbate, sodium metabisulfite, methyl paraben, and propyl paraben.

[0056] In some embodiments, the antimicrobial peptides of the present disclosure are mixed with feed components to form a feed. As used herein, "feed component" means all or part of a feed. A part of a feed may mean one component of a feed or more than one (e.g., 2 or 3 or 4 or more) components of a feed. In one embodiment, the term "feed component" encompasses a premix or a premix ingredient.

[0057] In some embodiments, the feed composition can be a fodder or a premix thereof, a compound feed or a premix thereof. The feed additive composition can be mixed with a compound feed, a compound feed component, or mixed into a premix of a compound feed, or mixed into a fodder, a fodder component, or a premix of a fodder. Any feed described herein may comprise one or more feed materials selected from the group comprising: a) cereals, such as small grains (e.g., wheat, barley, rye, oats, triticale, and combinations thereof) and / or large grains such as maize or sorghum; b) by-products from cereals, such as corn gluten meal, wet cake (especially corn-based wet cake), distillers dried grains (DDG), especially corn-based distillers dried grains (cDDG), distillers dried grains with solubles (DDGS), especially corn-based distillers dried grains with solubles (cDDGS), wheat bran, semolina, wheat short meal, rice bran, rice hulls, oat hulls, palm kernels, and citrus pulp; c) proteins obtained from sources such as soy, sunflower, peanut, lupin, pea, bean, cotton, canola, fish meal, dried plasma protein, meat and bone meal, potato protein, whey, copra, sesame; d) oils and fats obtained from plant and animal sources; e) minerals and vitamins.

[0058] Example 1 Obtaining antimicrobial peptide variants The black soldier fly antimicrobial peptide Cecropin-α recorded in CN202011471892.5 was used as the research basis, and its amino acid sequence is as follows: MNFSKLFVFVAVVIALLVAFAGQSEAGWSRSLWFKKIEKPVERAGQRIRDATIQGIAIQQGANVLTVRGGVLAQARGLKG In this application, the antimicrobial peptide is mainly used for the prevention and treatment of Salmonella. In order to better use the antimicrobial peptide in the field of aquaculture, the inventor considered increasing the effectiveness time of the antimicrobial peptide, so he planned to mutate the sequence of the above antimicrobial peptide to increase the β-folding. Through prediction, the short peptide was mutated and 10 mutants were obtained.

[0059] Table 1 Mutation Group Mutation method Mutated codon Mutation 1 A15I ATT Mutation 2 A15F TTC Mutation 3 A15W TGG Mutation 4 A15T ACG Mutation 5 A15Y TAC Mutation 6 G61V GTG Mutation 7 G61F TTC Mutation 8 G61W TGG Mutation 9 G61T ACG Mutation 10 G61I ACC Example 2 Verification of the antibacterial effect of antimicrobial peptide variants Preparation of antimicrobial peptide variants There are two ways to prepare antimicrobial peptides: one is to synthesize short peptides by GenScript Biochemical; the other is to express them in E. coli: According to the coding nucleotide sequence of the wild-type antimicrobial peptide (atgaactttagcaaactgtttgtgtttgtggcggtggtgattgcgctgctggtggcgtttgcgggccagagcgaagcgggctggagccgcagcctgtggtttaaaaaaattgaaaaaccggtggaacgcgcgggccagcgcattcgcgatgcgaccattcagggcattgcgattcagcagggcgcgaacgtgctgaccgtgcgcggcggcgtgctggcgcaggcgcgcggcctgaaaggc), the coding nucleotide sequences of each variant were designed (according to the codons corresponding to the mutated amino acids in Table 1, adaptively modified), and the wild-type antimicrobial peptide and each variant were constructed into pET-32a(+) The antimicrobial peptide WT and each variant expression plasmid were transfected into DH5α competent cells (Beyotime, D1031S) respectively. After expansion, the DH5α competent cells were spread on the plate containing AMP, and then the single colony was picked and sent to Novozymes for sequencing to verify the colony with the correct sequence. After that, the colony was amplified and expressed in large quantities, the bacteria were collected by centrifugation, crushed under high pressure to release the target protein, purified by nickel column, and then freeze-dried and concentrated.

[0060] Comparison of antibacterial effects The indicator bacteria used in this example is Staphylococcus aureus.

[0061] MIC was determined by two-fold microdilution method: Prepare bacterial suspension, dilute Staphylococcus aureus cultured to the logarithmic growth phase to a concentration of 10 5 CFU / mL, the purified antimicrobial peptide solutions were mixed with the bacterial suspension in equal amounts in the first column of the 96-well plate. At this time, the initial concentration of the antimicrobial peptide samples was 200μg / mL, and then diluted in a concentration gradient. Equal amounts of diluted bacterial suspension were added to all samples in the 96-well plate, and Staphylococcus aureus was incubated at 37°C for 18h. The turbidity of each well was observed with the naked eye, and the minimum concentration that could make the solution in the well clear was the MIC of the antimicrobial peptide. After testing, the results are as follows: Table 2 Group MIC (μg / mL) Mutation 1 15.2 Mutation 2 12.3 Mutation 3 9.6 Mutation 4 17.4 Mutation 5 12.8 Mutation 6 13 Mutation 7 18 Mutation 8 10.2 Mutation 9 14.6 Mutation 10 11.2 WT 16.4 The results are shown in Table 2. The antibacterial activity of each antimicrobial peptide variant was significantly changed relative to WT. Mutations 1-3, 5-6, and 8-10 all had improved antibacterial effects relative to WT, especially mutations 3, 8, and 10, which had significantly better inhibitory effects than WT and other variants.

[0062] Example 3 Testing the effects of various antimicrobial peptide variants on Songyang chicken Testing the effects of various antimicrobial peptide variants on the growth performance of Songyang chickens The experiment selected 330 4-week-old Songyang chicken roosters with similar weight, with an average weight of 0.29±0.04kg, and randomly divided them into 11 groups, with 10 replicates in each group. 0.005 parts of antimicrobial peptides were added to the basic feed (65 parts of corn; 10 parts of soybean meal; 6 parts of rice bran; 1.5 parts of bone meal; 0.1 parts of vitamin A, vitamin D3, vitamin K and vitamin E; 0.02 parts of copper, zinc and magnesium minerals; 0.3 parts of salt), supplemented light in the morning and evening, and increased the light time by 0.5h~1h per week until the light time reached 14h~16h per day. Feed 3-4 times a day to meet their needs, free drinking water, and the drinking water equipment should be cleaned and disinfected every day. The weight of each group of Songyang chickens was measured at 21 weeks of age, and the results are as follows: Table 3 Group Weight (kg) Mutation 1 0.92 Mutation 2 1.02 Mutation 3 1.24 Mutation 4 0.89 Mutation 5 1.06 Mutation 6 0.9 Mutation 7 0.88 Mutation 8 0.92 Mutation 9 0.98 Mutation 10 1.17 WT 1.01 Control group (no antimicrobial peptides added) 0.97 Analysis of the above results shows that the weight of Songyang chickens fed with feed supplemented with antimicrobial peptide mutations 3 and 10 was significantly higher than that of other groups and the WT and control groups, which indicates that these two antimicrobial peptide variants can improve the growth performance of Songyang chickens.

[0063] Testing the effects of various antimicrobial peptide variants on egg laying performance in Songyang chickens The experiment selected 330 Songyang chicken hens of similar weight at 5 months old, with an average weight of 1.04±0.2kg, and randomly divided them into 11 groups, with 10 replicates in each group. 0.005 parts of antimicrobial peptides (mutation 3, mutation 10) were added to the basic feed (65 parts corn; 10 parts soybean meal; 6 parts rice bran; 1.5 parts bone meal; 0.1 parts each of vitamin A, vitamin D3, vitamin K and vitamin E; 0.02 parts each of copper, zinc and magnesium minerals; 0.3 parts salt), and a control group was set up. The light was supplemented in the morning and evening, and the light time was increased by 0.5h~1h per week until the light time reached 14h~16h per day. Feed 3-4 times a day to ensure The chickens need free drinking water, and the drinking water equipment should be cleaned and disinfected every day. The egg production rate and egg weight of each group of Songyang chickens were measured daily. It was found that compared with the control group, the egg production rate and egg weight of mutation group 3 and mutation group 10 were increased (the egg production rate of mutation group 3 increased by an average of 1.2%, and the average egg weight increased by 0.8%, the egg production rate of mutation group 10 increased by an average of 0.7%, and the average egg weight increased by 0.5%), which indicates that mutation 3 and mutation 10 promote the egg production performance of Songyang chickens.

[0064] The embodiments of the present invention are described in detail above, but the present invention is not limited to the described embodiments. For those skilled in the art, various changes, modifications, substitutions and variations of these embodiments are made without departing from the principles and spirit of the present invention, and still fall within the protection scope of the present invention.

Claims

1. A polypeptide comprising an amino acid sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or 100% identical to the amino acid sequence shown in SEQ ID NO:

1.

2. The polypeptide according to claim 1, which comprises the following mutations relative to the amino acid sequence shown in SEQ ID NO: 1: addition, deletion and / or substitution of amino acids; Optionally, the protein comprises one of the following mutations relative to the amino acid sequence shown in SEQ ID NO: 1: A15I, A15F, A15W, A15Y, G61V, G61W, G61T, or G61I.

3. The polypeptide according to claim 1 or 2, which is mutated by one of the following mutations relative to the amino acid sequence shown in SEQ ID NO: 1: A15I, A15F, A15W, A15Y, G61V, G61W, G61T, or G61I. A nucleic acid molecule encoding the polypeptide according to any one of claims 1 to 3. An expression vector comprising the nucleic acid molecule according to claim 4 . A host cell comprising the nucleic acid molecule according to claim 4 or the expression vector according to claim 5.

7. A composition comprising the polypeptide according to any one of claims 1 to 3.

8. A pharmaceutical composition comprising the polypeptide according to any one of claims 1 to 3, or the composition according to claim 8.

9. A feed composition comprising the polypeptide according to any one of claims 1 to 3, or the composition according to claim 7.

10. Use of the polypeptide according to any one of claims 1 to 3, the nucleic acid molecule according to claim 4, the expression vector according to claim 5, the composition according to claim 7 or the feed composition according to claim 8 in the preparation of animal feed.

11. A method for improving feeding effect of animals, comprising feeding the feed composition according to claim 8.