CAPS molecular marker of rice blast-resistant gene Pi2, primer group and application

Abstract

The invention belongs to the field of molecular genetic breeding, and discloses a CAPS molecular marker of a rice blast-resistant gene Pi2, a primer group and application, and the nucleotide sequence of the CAPS molecular marker is as shown in SEQ ID NO.1; the SEQ ID NO. 1 contains a Pst I restriction enzyme cutting site. The invention designs a CAPS marker primer Pi2-CF / Pi2-CR and restriction enzyme Pst I for distinguishing a disease-resistant gene Pi2 from other disease-resistant genes and susceptible genes, so that the gene Pi2 is accurately identified, and a favorable tool is provided for subsequently cultivating a broad-spectrum durable rice blast-resistant new rice variety. The invention discloses an intragene molecular marker of a rice blast resistant gene Pi2, which is a co-dominant functional marker, and a disease-resistant homozygous genotype, a susceptible homozygous genotype and a heterozygous genotype can be accurately distinguished by only using one marker.

Description

Technical Field

[0001] The invention belongs to the field of molecular genetic breeding, and in particular relates to a CAPS molecular marker, a primer set and application of a rice blast resistance gene Pi2. Background Art

[0002] Rice (Oryza sativa L.) is one of the three major food crops in the world, and about half of the world's population relies on rice as their staple food. In the production process of rice, rice blast is one of the main diseases, which seriously affects the yield and quality of rice and restricts the development of the rice industry. Therefore, improving the resistance of rice to rice blast is one of the important goals of rice breeding. Cultivating broad-spectrum and long-lasting rice blast-resistant varieties will help reduce the use of related pesticides and increase the promotion area of ​​related varieties, thereby promoting the sustainable development of the rice industry.

[0003] At present, multiple rice blast resistance genes, including Pi2, Pi9, Pi50, Pizt, Pizh, and Pigm, have been cloned in the NBS-LRR gene cluster near 10Mb of rice chromosome 6. Studies have shown that the Pi2 gene from the donor material C101A51 is a broad-spectrum rice blast resistance gene and has been widely used in rice disease resistance breeding. So far, the molecular markers developed for the rice blast resistance gene Pi2 are mainly tightly linked co-dominant markers and dominant markers within the gene. These markers provide convenience in the molecular breeding of Pi2, but there are also many shortcomings, such as the easy occurrence of recombination exchange in linked markers and the inability of dominant markers to distinguish between homozygous and heterozygous genotypes, which limits the efficient use of the Pi2 gene in rice blast resistance breeding. In order to accurately apply the Pi2 gene to rice blast resistance breeding, it is of great significance to develop co-dominant molecular markers within the Pi2 gene. Summary of the invention

[0004] In order to solve the above technical problems, the present invention provides a CAPS molecular marker, a primer set and application of a rice blast resistance gene Pi2.

[0005] The specific technical solutions of the present invention are as follows.

[0006] In a first aspect, the present invention provides a CAPS molecular marker of a rice blast resistance gene Pi2, wherein the nucleotide sequence of the CAPS molecular marker is as shown in SEQ ID NO.1.

[0007] The present invention compares and analyzes the genome sequences of the rice blast resistance genes Pi2, Pi9, Pi50, PigmR, PigmS, Pizh1, Pizh2, and Pizt, and finds a specific nucleotide sequence in the Pi2 gene sequence, which is located at the 10389726-10389731bp of the sixth chromosome of the rice variety Nipponbare, and is 5'-CTGCAG-3'; while PigmS is 5'-CTGGGT-3', Pizt and Pizh1 are 5'-CTGTGT-3', and the remaining genes are 5'-CTGCGT-3'. The present invention develops a co-dominant molecular marker for accurately identifying the Pi2 genotype and a method for detecting the genotype of the rice blast resistance gene Pi2 for this specific nucleotide sequence, and determines the Pi2 genotype of the rice material to be detected by detecting the nucleotide sequence located at the 10389726-10389731bp of the sixth chromosome of rice.

[0008] The second aspect of the present invention provides a primer set for amplifying the CAPS molecular marker of the rice blast resistance gene Pi2, the primer set consisting of an upstream primer with a nucleotide sequence such as SEQ ID NO.2 and a downstream primer with a nucleotide sequence such as SEQ ID NO.3.

[0009] The third aspect of the present invention provides a kit, which comprises the primer set.

[0010] The fourth aspect of the present invention provides the use of the primer set or the kit in detecting the rice blast resistance Pi2 gene.

[0011] The fifth aspect of the present invention provides the use of the primer set or the kit in identifying the Pi2 genotype type of rice materials, wherein the Pi2 genotype type is a rice blast-resistant genotype, a rice blast-susceptible genotype, and a heterozygous genotype.

[0012] The sixth aspect of the present invention provides the use of the CAPS molecular marker in detecting rice resistance to rice blast.

[0013] The seventh aspect of the present invention provides the use of the primer set in detecting rice resistance to rice blast.

[0014] The eighth aspect of the present invention provides the use of the kit in detecting rice resistance to rice blast.

[0015] A ninth aspect of the present invention provides a method for detecting the rice blast resistance Pi2 gene, comprising the following steps:

[0016] Rice genomic DNA extraction;

[0017] Using the primer set to perform PCR amplification on rice genomic DNA;

[0018] The PCR amplification product is digested with restriction endonuclease Pst I to obtain a digestion product;

[0019] After 2% agarose electrophoresis of the digested products, the homozygous genotype resistant to rice blast showed two bands of 334 bp and 241 bp, the homozygous genotype susceptible to rice blast showed a band of 575 bp, and the heterozygous genotype showed three bands of 575 bp, 334 bp and 241 bp.

[0020] Preferably, the reaction system for PCR amplification is: 10 μL of 2×Rapid Taq MasterMix, 0.5 μL of the 10 mmol / L upstream primer, 0.5 μL of the 10 mmol / L downstream primer, 3 μL of template DNA, and 6 μL of ddH2O.

[0021] Preferably, the reaction procedure of PCR amplification is: denaturation at 94°C for 3 min; pre-denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, amplification for 30 cycles; extension at 72°C for 3 min; extension at 25°C for 1 s.

[0022] In another preferred embodiment, the enzyme digestion reaction system of the PCR product is: 1 μL of 15U / μL endonuclease Pst I, 2 μL of 10×H Buffer, 10 μL of PCR amplification product, 7 μL of ddH2O, and enzyme digestion at 37°C for 1 hour.

[0023] Compared with the prior art, the present invention has the following beneficial effects:

[0024] The present invention develops a co-dominant CAPS molecular marker primer Pi2-CF / Pi2-CR and a matching restriction endonuclease Pst I for distinguishing the disease-resistant homozygous genotype, susceptible homozygous genotype and heterozygous genotype of the rice blast resistance gene Pi2, thereby accurately and efficiently identifying the Pi2 allele type, providing a powerful tool for the subsequent breeding of new rice varieties resistant to rice blast. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is a comparison result of some sequence difference sites of different rice blast resistance genes in the rice Pi2 gene cluster.

[0026] Figure 2The present invention is a gel image result diagram of identifying the Pi2 genotype of different rice materials using the CAPS marker primer and the restriction endonuclease Pst I; wherein A is the gel image result of the CAPS marker primer; B is the gel image result of the CAPS marker primer and the restriction endonuclease Pst I, in which 1 represents Gumei No. 4 (Pigm), 2 represents Digu (Pigm), 3 represents Shuhui 498 (Pizt), 4 represents Suxiu 867 (Pizt), 5 represents Shuhui 548 (Pi2), 6 represents Hua 2048B (Pi2), 7 represents Zhonghua 11 (Pizh), 8 represents 75-1-127 (Pi9), 9 represents Runong 11, 10 represents Huajing 5, 11 represents Huaidao 5, and 12 represents Nanjing 505.

[0027] Figure 3 This is the gel image result of identifying the generation population separation of Pi2 rice blast resistance introduction line using the CAPS marker primer and restriction endonuclease Pst I. In the figure, A represents H2048B, B represents Huajing 5, and 1 to 20 represent different individual plants of the separation population. DETAILED DESCRIPTION

[0028] The present invention is further described in detail below in conjunction with examples and drawings. According to the following description and these embodiments, those skilled in the art can determine the basic features of the present invention, but the embodiments of the present invention are not limited thereto.

[0029] Example 1

[0030] Establishment of a co-dominant molecular marker for the rice blast resistance gene Pi2

[0031] (1) Primer design

[0032] The genomic sequences of Pi2, Pi9, Pi50, PigmR, PigmS, Pizh1, Pizh2, and Pizt in the Pi2 gene cluster were extracted from the NCBI database. Multiple sequence alignment revealed that the Pi2 gene had a specific nucleotide sequence in the second exon, located at 10389726-10389731 bp on chromosome 6 of the rice variety Nipponbare. Figure 1 This site generates a restriction endonuclease Pst I cleavage site on the Pi2 gene, while the restriction endonuclease Pst I cleavage site does not exist in the corresponding sequences of other genes, and can be used as a CAPS marker development site.

[0033] The nucleotide sequence of the amplified fragment of the Pi2 gene of the CAPS molecule marker is shown in SEQ ID NO.1:

[0034] AACACAATATGCCTGCCTAAAGTATTCACACCTTTAGTTAGTCGCGATGATCGTGCAAAACAAATTGCTGAATTGCACATGGCCACCAAAAGTTGCTGGTCTGAATCAATCGGTGTGAAGGTACCCAAAGGAATAGGTAAGTTGCGAGACTTGCAGGTTCTAGAG TATGTAGATATCAGGCGGACCAGTAGTAGAGCAATCAAAGAGCTGGGGCAGTTAAGCAAGCTGAGGAAATTAGGTGTGACAACAAACGGGTCGACAAAGGAAAAAATGTAAGATACTTTATGCAGCCATTGAGAAGCTCTCTTCCCTCCAATCTCTCCATGTGGATG CTGCAG GAATCTCAGATGGTGGAACACTTGAGTGCCTAGATTCTATTTCATCTCCTCCTCCCCTACTGAGGACACTCGTGTTGGATGGAATTCTTGAGGAGATGCCTAACTGGATTGAGCAGCTCACTCACC TGAAGAAGATCTACTTATTGAGGAGCAAACTAAAGGAAGGTAAAACCATGCTGATACTTGGGGCACTGCCCAACCTCATGGTCCTTCATCTTTATCGGAATGCTTACCTTGG, where the underline is the PstI site.

[0035] According to the sequence differences, specific amplification primers were designed. The nucleotide sequences of the upstream primer Pi2-CF and the downstream primer Pi2-CR of the primer set are shown in SEQ ID NO.2 and SEQ ID NO.3:

[0036] SEQ ID NO. 2: 5'-AACACAATATGCCTGCCTAA-3'.

[0037] SEQ ID NO. 3: 5'-CCAAGGTAAGCATTCCGATA-3'.

[0038] (2) Enzyme digestion reaction

[0039] The genomes of different rice materials can amplify DNA fragments of 575 bp in length; after restriction endonuclease Pst I digestion, the Pi2 gene will produce two DNA fragments of 334 bp and 241 bp in length, while the non-Pi2 gene retains a DNA fragment of 575 bp, such as Figure 2 shown.

[0040] Example 2

[0041] Analysis of the genotypes of Huajing 5, Hua2048B and BC3F2 segregating populations with Huajing 5 as the recurrent parent carrying the Hua2048B fragment using Pi2 co-dominant molecular markers

[0042] (1) Extraction of genomic DNA from rice leaves

[0043] The experimental materials include Hua 2048B No. A, Hua Jing 5 No. B, and 20 BC3F2 segregation populations No. 1-20; young leaves of individual rice plants were selected, and the genomic DNA of rice was extracted using the TPS method. The specific steps are as follows:

[0044] S1. Take a 2 cm long leaf and place it in a 2 mL centrifuge tube. Add 600 μL of TPS extract and 3 4 mm steel beads, and shake it with a tissue crusher for 40 seconds.

[0045] S2. Place the centrifuge tube in a 72°C water bath for 90 min, then let it stand until it cools to 25°C.

[0046] S3. Centrifuge at 10,000 rpm for 10 min and aspirate 350 μL of the supernatant into a new 1.5 mL centrifuge tube.

[0047] S4. Add an equal volume of pre-cooled isopropanol and mix by inversion. Incubate at 4°C for 60 min to allow the DNA to fully precipitate.

[0048] S4. Centrifuge at 12000 rpm for 10 min, discard the supernatant, add 500 μL 75% ethanol and rinse for 1 min.

[0049] S5. Centrifuge at 12000 rpm, discard the supernatant, and place the centrifuge tube on a centrifuge tube rack overnight to air dry naturally.

[0050] S6. Add 200 μL ddH2O to dissolve the DNA and store at -20°C for later use.

[0051] (2) Analysis of the genotypes of Huajing 5, Hua2048B and BC3F2 segregating populations using Pi2 CAPS markers

[0052] PCR amplification was performed using primers Pi2-CF / Pi2-CR, and then the amplified product was digested with restriction endonuclease Pst I. Finally, the digested product was separated by electrophoresis using 2% agarose gel.

[0053] The 2×Rapid Taq MasterMix reaction system of Novezan Biotech was used. The reaction system is:

[0054] 2×Rapid Taq Master Mix 10μL, 10mmol / L forward primer 0.5μL, 10mmol / L reverse primer 0.5μL, template DNA 3μL, ddH2O 6μL.

[0055] The reaction procedure of PCR amplification was as follows: denaturation at 94°C for 3 min; pre-denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, and amplification for 30 cycles; extension at 72°C for 3 min; and extension at 25°C for 1 s.

[0056] The enzyme digestion reaction system of PCR product is: 15U / μL endonuclease Pst I 1μL, 10×H Buffer 2μL, PCR amplification product 10μL, ddH2O 7μL.

[0057] The restriction enzyme digestion reaction program of PCR products was: 37°C for 1 h.

[0058] The electrophoresis reaction procedure of the enzyme-digested products was as follows: 2% agarose gel, 1×TAE electrophoresis buffer, voltage 120 V, and electrophoresis for 25 min.

[0059] (3) Genotype determination

[0060] After the enzyme digestion products were separated by electrophoresis, the disease-resistant homozygous genotype showed two bands of 334 bp and 241 bp, the disease-susceptible homozygous genotype showed one band of 575 bp, and the heterozygous genotype showed three bands of 575 bp, 334 bp and 241 bp. Figure 3 It was shown that the developed markers can accurately distinguish the disease-resistant genotype, susceptible genotype and heterozygous genotype of Pi2.

[0061] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0062] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. A CAPS molecular marker for the rice blast resistance gene Pi2, characterized in that: The nucleotide sequence of the CAPS molecular marker is shown in SEQ ID NO.

1.

2. A primer set for amplifying the CAPS molecular marker of the rice blast resistance gene Pi2 according to claim 1, characterized in that: The primer set consists of an upstream primer with a nucleotide sequence such as SEQ ID NO.2 and a downstream primer with a nucleotide sequence such as SEQ ID NO.

3.

3. A kit, characterized in that: The kit comprises the primer set according to claim 2.

4. Use of the primer set according to claim 2 or the kit according to claim 3 in detecting the rice blast resistance Pi2 gene.

5. Use of the primer set according to claim 2 or the kit according to claim 3 in identifying the Pi2 genotype type of rice materials, characterized in that: The Pi2 genotype types are rice blast resistant genotype, rice blast susceptible genotype and heterozygous genotype.

6. Use of the CAPS molecular marker according to claim 1 in detecting rice resistance to rice blast.

7. Use of the primer set according to claim 2 in detecting rice resistance to rice blast.

8. Use of the kit according to claim 3 in detecting rice resistance to rice blast.

9. A method for detecting the rice blast resistance Pi2 gene, characterized in that: The following steps are involved: Rice genomic DNA extraction; Performing PCR amplification on rice genomic DNA using the primer set described in claim 2; The PCR amplification product is digested with restriction endonuclease PstI to obtain a digestion product; After 2% agarose electrophoresis of the digested products, the homozygous genotype resistant to rice blast showed two bands of 334 bp and 241 bp, the homozygous genotype susceptible to rice blast showed a band of 575 bp, and the heterozygous genotype showed three bands of 575 bp, 334 bp and 241 bp.

Images