Lassa virus rapid nucleic acid detection kit, detection method and application

Abstract

The invention relates to a lassa virus rapid nucleic acid detection kit, a detection method and application, and belongs to the technical field of molecular diagnosis, the lassa virus rapid nucleic acid detection kit comprises the following components: 1) a group of (RT) RAA primers for lassa virus rapid nucleic acid detection; 2) a CRISPR-Cas13a system for rapid nucleic acid detection of the Lassa virus, wherein the CRISPR-Cas13a system comprises Cas13a protein and crRNA or a complex formed by the Cas13a protein and the crRNA; the crRNA comprises an anchoring sequence used for being combined with Cas13a protein and a guide sequence targeting a Lassa virus nucleoprotein conserved region target sequence. The target sequence of the Lassa virus nucleoprotein conserved region is located at the 1462nd-1691th sites of the Lassa virus nucleoprotein gene; and the Cas13a protein is an LwCas13a protein. According to the invention, high-sensitivity and high-specificity detection of the Lassa virus can be realized; according to the scheme, complex and accurate temperature control equipment is not needed, the whole process can be achieved only through simple and small constant-temperature heating equipment, and limitation of scenes and conditions is greatly eliminated.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular diagnosis, and specifically relates to a Lassa virus rapid nucleic acid detection kit, a detection method and an application. Background Art

[0002] Lassa Virus (LASV) is a member of the genus Arenavirus. Its genetic material is single-stranded RNA. The virus particles are polymorphic and enveloped. Lassa fever caused by this virus is an endemic disease that occurs frequently in West Africa. The disease can be transmitted between humans and animals, and patients show typical symptoms of viral hemorrhagic fever. Rodents such as multimammate rats, brown rats, and small mice are the main natural hosts. Human infection is usually caused by contact with rodent excrement or secretions through damaged skin and mucous membranes or by eating contaminated food. Patients often show severe multisystem symptoms. Lassa fever is still likely to be prevalent in Guinea, Liberia and other parts of West Africa, so it is necessary to strengthen surveillance and prevention of the virus. Timely and effective detection of pathogens and enhanced surveillance are essential for disease control and prevention. Existing Lassa virus detection technologies such as real-time fluorescence quantitative PCR are not simple enough and rely on expensive, sophisticated professional equipment. Therefore, a rapid, simple and highly sensitive Lassa virus detection method is urgently needed. Summary of the invention

[0003] Based on the technical problems existing in the prior art, the present invention provides a Lassa virus rapid nucleic acid detection kit, a detection method and an application, which can detect Lassa virus quickly, simply and highly sensitively.

[0004] According to the first aspect of the technical solution of the present invention, the present invention first provides a Lassa virus rapid nucleic acid detection kit, comprising the following components: 1) A set of (RT)RAA primers for rapid nucleic acid detection of Lassa virus; 2) A CRISPR-Cas13a system for rapid nucleic acid detection of Lassa virus, comprising Cas13a protein and crRNA, or a complex formed by the two; The crRNA includes an anchor sequence for binding to the Cas13a protein and a guide sequence targeting a target sequence in a conserved region of the Lassa virus nucleoprotein; the target sequence in the conserved region of the Lassa virus nucleoprotein is located at positions 1462-1691 of the Lassa virus nucleoprotein gene; and the Cas13a protein is a LwCas13a protein.

[0005] In certain embodiments, the Lassa virus nucleoprotein conserved region target sequence is shown as SEQ ID No. 1; the crRNA sequence is shown as SEQ ID No. 8.

[0006] According to the second aspect of the technical solution of the present invention, a kit for rapid nucleic acid detection of Lassa virus is provided, which comprises the above-mentioned (RT)RAA primer for rapid nucleic acid detection of Lassa virus or / and the CRISPR-Cas13a system for rapid nucleic acid detection of Lassa virus. In a preferred embodiment, the kit also includes a primer combination for specific amplification of Lassa virus target sequence; the primer combination consists of a single-stranded DNA molecule as shown in SEQ ID No. 3 and a single-stranded DNA molecule as shown in SEQ ID No. 5.

[0007] According to the third aspect of the technical solution of the present invention, the present invention also provides the use of the above-mentioned kit in preparing a product having the following functions: 1) Detect whether the target nucleic acid is pathogen nucleic acid; The present invention also provides any of the following substances: A1) the above-mentioned crRNA; A2) the above-mentioned Cas13a protein and crRNA, or a complex formed by the two; A3) The primer combination described above.

[0008] According to the fourth aspect of the technical solution of the present invention, the present invention also provides any of the following applications: B1) Use of the above-mentioned kit or the above-mentioned substance in detecting or assisting in detecting Lassa virus; B2) Use of the above-mentioned kit or the above-mentioned substance in the preparation of a product for detecting or assisting in the detection of Lassa virus; B3) Use of the above-mentioned kit or the above-mentioned substance in detecting or assisting in detecting whether a sample to be tested contains Lassa virus; B4) Use of the above-mentioned kit or the above-mentioned substance in the preparation of a product for detecting or assisting in detecting whether a sample to be tested contains Lassa virus; B5) Use of the above-mentioned kit or the above-mentioned substance in screening or assisting screening of Lassa virus prevention and treatment drugs; B6) Use of the above-mentioned kit or the above-mentioned substance in the preparation of a product for screening or assisting in screening of Lassa virus prevention and treatment drugs; B7) Use of the above-mentioned substance in the preparation of the above-mentioned kit.

[0009] In certain embodiments, the use is for non-diagnostic purposes.

[0010] According to the fifth aspect of the technical solution of the present invention, the present invention provides a method for detecting or assisting in the detection of Lassa virus, wherein the method is for non-diagnostic purposes, and the method comprises using the above-mentioned kit to detect whether the sample to be tested is or is a candidate for Lassa virus.

[0011] Compared with the prior art, the Lassa virus rapid nucleic acid detection kit, detection method and application of the present invention have the following beneficial effects: 1. The present invention provides a Lassa virus detection kit based on (RT)RAA / CRISPR-Cas13a nucleic acid detection technology, which, through design, construction and screening, ultimately provides a (RT)RAA amplification primer combination for detecting Lassa virus, a target sequence to be detected and a specific crRNA that can target the target sequence, thereby achieving highly sensitive and specific detection of Lassa virus.

[0012] 2. The solution of the present invention does not require complex and precise temperature control equipment. It can be realized by simple and compact constant temperature heating equipment throughout the process, which greatly gets rid of the limitations of scenarios and conditions. The solution of the present invention is short in time; compared with traditional detection solutions, the time is shortened by nearly half, and the sensitivity reaches 100 copies / μL, which has important application value in the field of detection and identification of Lassa virus infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 This is a schematic diagram of the present invention.

[0014] Figure 2A Schematic diagram for target selection.

[0015] Figure 2B This is the electrophoresis result of the first preliminary screening of (RT)RAA primers; Figure 2C Grayscale analysis diagram for the first preliminary screening of (RT)RAA primers; Figure 2D The electrophoresis results of the preliminary screening of (RT)RAA primers are shown in Figure 2. Figure 2E Grayscale analysis graph for preliminary screening of (RT)RAA primers again; Figure 2F This is a graph of crRNA screening results; Figure 2G This is a crRNA screening result analysis diagram; Figure 3A-Figure 3F The results and analysis of the further screening of (RT)RAA primers are shown in Figure 1, where: Figure 3A For (RT)RAA primer amplification 10 2 CRISPR fluorescence detection results after plasmid concentration of copies / μL; Figure 3B For (RT)RAA primer amplification 10 1 CRISPR fluorescence detection results after plasmid concentration of copies / μL; Figure 3C For (RT)RAA primer amplification 10 0 CRISPR fluorescence detection results after plasmid concentration of copies / μL; Figure 3D For (RT)RAA primer amplification 10 2 CRISPR fluorescence detection result heat map after the concentration of plasmid copies / μL; Figure 3E For (RT)RAA primer amplification 10 1 CRISPR fluorescence detection result heat map after the concentration of plasmid copies / μL; Figure 3F This is the overall analysis diagram of CRISPR fluorescence detection results after plasmid amplification with (RT)RAA primers; Figure 4A This is a sensitivity result diagram of the LASV virus wild-type plasmid detected by combining the lateral flow chromatography test strip detection method; Figure 4B This is a sensitivity analysis chart of the LASV virus wild-type plasmid detected by combining the lateral flow chromatography test strip detection method; Figure 4C This is a graph showing the specific results of detecting the wild-type plasmid of LASV virus by combining the lateral flow chromatography test strip detection method; Figure 4D This is a specific result analysis diagram of the detection of LASV virus wild-type plasmid combined with the lateral flow chromatography test paper detection method. DETAILED DESCRIPTION

[0016] The following examples are provided for a better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The test materials used in the following examples are purchased from conventional biochemical reagent stores unless otherwise specified. The quantitative tests in the following examples were repeated three times, and the results were averaged.

[0017] The reagents and their sources involved in the following embodiments are as follows: NTP mix (NEB, N0466S), RNase inhibitor (Murine RNase inhibitor, NEB, M0314L), T7 RNA polymerase (NEB, M0251L), 2×Taq PCRMasterMix (Jiangsu Kangwei Century, CW2965M), NEB T7 Fast and Efficient RNA Synthesis Kit (NEB, USA, E2050S), Tris balanced phenol (Solaibao, T0250), chloroform (Sinopharm Group, 10006818), RNA purification magnetic beads (BeckmanCoulter, A63987), (RT) RAA amplification kit (Hangzhou Zhongce, S001ZC), (RT) RAA amplification kit (fluorescence type) (Hangzhou Zhongce, S002ZC), test paper reporting RNA (Beijing Tianyi Huiyuan Biological Company, FAM-20U-Biotin), RNase-free ddH2O (TaKaRa, 9012), HEPES buffer (ThermoFisher, 15630080), MgCl2 solution (ThermoFisher, AM9530G), LwCas13a protein (Nanjing GenScript, P50502002).

[0018] The present invention is based on the rapid development of nucleic acid detection technology, especially the next generation molecular diagnostic technology based on nucleic acid detection technology based on clustered regularly interspaced short palindromic repeats (CRISPR). The inventors have developed a platform for nucleic acid detection of pathogens based on the CRISPR-Cas13a (CRISPR-associated protein 13) system, and its detection sensitivity can reach attomole (aM). It can be combined with isothermal amplification technology such as recombinase-aid Amplification (RT)RAA to detect single-copy pathogen nucleic acids. CRISPR-Cas13a detection technology can be combined with lateral flow chromatography test strips to realize naked eye visualization of test results. The technology has the advantages of being fast, simple, and capable of on-site detection. Based on this nucleic acid detection technology, detection methods for various pathogens such as Ebola virus, Marburg virus, Zika virus, and new coronavirus can be developed.

[0019] According to the first aspect of the technical solution of the present invention, the present invention first provides a Lassa virus rapid nucleic acid detection kit, comprising the following components: 1) A set of (RT)RAA primers for rapid nucleic acid detection of Lassa virus; 2) A CRISPR-Cas13a system for rapid nucleic acid detection of Lassa virus, comprising Cas13a protein and crRNA, or a complex formed by the two; The crRNA includes an anchor sequence for binding to the Cas13a protein and a guide sequence targeting a target sequence in a conserved region of the Lassa virus nucleoprotein; the target sequence in the conserved region of the Lassa virus nucleoprotein is located at positions 1462-1691 of the Lassa virus nucleoprotein gene; and the Cas13a protein is a LwCas13a protein.

[0020] In certain embodiments, the Lassa virus nucleoprotein conserved region target sequence is shown as SEQ ID No. 1; the crRNA sequence is shown as SEQ ID No. 8.

[0021] According to the second aspect of the technical solution of the present invention, a kit for rapid nucleic acid detection of Lassa virus is provided, which comprises the above-mentioned (RT)RAA primer for rapid nucleic acid detection of Lassa virus or / and the CRISPR-Cas13a system for rapid nucleic acid detection of Lassa virus. In a preferred embodiment, the kit also includes a primer combination for specific amplification of Lassa virus target sequence; the primer combination consists of a single-stranded DNA molecule as shown in SEQ ID No. 3 and a single-stranded DNA molecule as shown in SEQ ID No. 5.

[0022] According to the third aspect of the technical solution of the present invention, the present invention also provides the use of the above-mentioned kit in preparing a product having the following functions: 1) Detect whether the target nucleic acid is pathogen nucleic acid; The present invention also provides any of the following substances: A1) the above-mentioned crRNA; A2) the above-mentioned Cas13a protein and crRNA, or a complex formed by the two; A3) The primer combination described above.

[0023] According to the fourth aspect of the technical solution of the present invention, the present invention also provides any of the following applications: B1) Use of the above-mentioned kit or the above-mentioned substance in detecting or assisting in detecting Lassa virus; B2) Use of the above-mentioned kit or the above-mentioned substance in the preparation of a product for detecting or assisting in the detection of Lassa virus; B3) Use of the above-mentioned kit or the above-mentioned substance in detecting or assisting in detecting whether a sample to be tested contains Lassa virus; B4) Use of the above-mentioned kit or the above-mentioned substance in the preparation of a product for detecting or assisting in detecting whether a sample to be tested contains Lassa virus; B5) Use of the above-mentioned kit or the above-mentioned substance in screening or assisting screening of Lassa virus prevention and treatment drugs; B6) Use of the above-mentioned kit or the above-mentioned substance in the preparation of a product for screening or assisting in screening of Lassa virus prevention and treatment drugs; B7) Use of the above-mentioned substance in the preparation of the above-mentioned kit.

[0024] In certain embodiments, the use is for non-diagnostic purposes.

[0025] According to the fifth aspect of the technical solution of the present invention, the present invention provides a method for detecting or assisting in the detection of Lassa virus, wherein the method is for non-diagnostic purposes, and the method comprises using the above-mentioned kit to detect whether the sample to be tested is or is a candidate for Lassa virus.

[0026] The technical solution of the present invention is further described below in conjunction with specific embodiments.

[0027] Example 1. Principle of Lassa virus detection based on (RT)RAA / CRISPR.

[0028] (RT)RAA / CRISPR-based assay design Figure 1 As shown, it includes the following steps: Step S1, first extracting and processing viral nucleic acid, wherein the viral nucleic acid is used as a sample to be tested; Step S2, after the sample to be tested is processed, the viral nucleic acid is amplified using the selected (RT)RAA amplification primer with the T7 promoter sequence to obtain a targeting sequence containing the T7 promoter so that it can be recognized and transcribed by the T7 RNA polymerase in the subsequent step; Step S3, the (RT)RAA amplification product is then used for CRISPR detection, the DNA sequence with the T7 promoter is recognized by the T7 RNA polymerase in the system and transcribed into single-stranded RNA, crRNA can specifically recognize the target sequence, and after recognition, the non-specific trans-cleavage activity of Cas13a protein is activated, and the reporter RNA probe in the system is cut into FAM and biotin residues; Step S4, when the obtained reaction system passes through the sample pad of the "line elimination method" immunochromatographic test paper, it combines with the colloidal gold-labeled rabbit anti-FITC antibody to obtain a system containing the colloidal gold-labeled rabbit anti-FITC antibody-FAM group. When passing through the T line, it does not bind to streptavidin, and the T line does not show color. When it reaches the C line, it is captured by the C line antibody (sheep anti-rabbit IgG-colloidal gold-labeled rabbit anti-FITC antibody-FAM group) and then the colloidal gold is precipitated and colored, and the C line is colored (only one quality control line appears on the test paper).

[0029] The results are judged as follows: If the T line and C line appear on the test paper, the sample to be tested contains or the candidate contains the Lassa virus target nucleic acid, and it is judged as Lassa virus positive; if the T line of the test paper does not appear, but the C line appears, the sample to be tested does not contain or the candidate does not contain Lassa virus nucleic acid, and it is judged as negative; if the C line does not appear on the test paper, the test paper is invalid and the test paper needs to be replaced and repeated.

[0030] Establishment of pathogen detection method: 1. (RT)RAA amplification.

[0031] The nucleic acid in the sample to be tested is extracted as the target nucleic acid, which serves as a template for pre-amplification.

[0032] The target nucleic acid was pre-amplified using the (RT)RAA amplification kit. The steps are as follows: First, 5µL template, 2µL upstream primer (10µM), 2µL downstream primer (2µM), 13.5µL Rnase-free ddH2O and 25µL A Buffer were prepared into a mixture and added to the basic reaction unit containing lyophilized powder to fully dissolve the lyophilized powder. 2.5µL B Buffer solution was added to the cap of each reaction tube, the cap was closed, and the tube was mixed upside down 5-6 times, and centrifuged quickly for 10 seconds. The above reaction tubes were placed at 39°C for 30 minutes to obtain the (RT)RAA amplification product.

[0033] 2. CRISPR reaction.

[0034] The CRISPR reaction was performed using LwCas13a protein and reporter RNA (20U). The 50µL volume CRISPR reaction system was as follows: 5µL (RT) RAA product; 2µL LwCas13a protein (Nanjing GenScript, P50502002); 4µL NTP Mix (NEB, N0466S); 1µL T7 RNA polymerase (NEB, M0251L); 2µL RNase inhibitor (Murine RNaseinhibitor, NEB, M0314L); 0.5µL MgCl2 solution (1M, ThermoFisher, AM9530G); 1µL HEPES buffer (1M, ThermoFisher, 15630080); 3µL corresponding crRNA (100ng / µL); 5µL reporter RNA (20nM); 26.5µL RNase-free ddH2O.

[0035] The reaction tube of the above reaction system was capped, inverted 5-6 times to mix, centrifuged at low speed for 10 seconds, and then placed at 37°C for reaction for 30 minutes to obtain a CRISPR reaction product.

[0036] 3. Test paper testing.

[0037] Add all the CRISPR reaction products into the sample wells of the "line elimination method" immunochromatographic test paper, let it stand for 2-5 minutes, observe with the naked eye and take photos to record the results.

[0038] Negative control: Prepare a CRISPR system without (RT)RAA amplification products, and add all of them into the sample wells of the "line elimination method" immunochromatographic test paper. Let it stand for 2-5 minutes, observe with the naked eye, and take photos to record the results.

[0039] 4. Gel electrophoresis detection.

[0040] Preparation of agarose gel: Weigh 3g (1.5%) agarose with an electronic balance and put it into a conical flask. Pour 100 ml 1×TAE solution into the conical flask with a measuring cylinder, shake and mix well, and then heat it in a microwave for 4 minutes. Take it out and wait for it to cool to 50-60°C, add 20μL EB replacement dye, pour it into the gel plate, insert the comb and cool it at room temperature until it solidifies. Sample addition: Add 10μL 500bp DNA Marker to the comb well of the agarose gel, mix 2μL 6×DNA LoadingBuffer with 10μL PCR amplification product, and then add the mixture to the comb well. Adjust the voltage to 125V and start electrophoresis for 30min. Observation: After 30 minutes, take out the gel and put it into the AlphaImager HP gel imager to observe the results.

[0041] 5. CRISPR testing.

[0042] Place the prepared RISPR reaction system in a fluorescent quantitative PCR instrument under the following reaction conditions: 37°C; FAM channel (excitation wavelength 490nm, light emission wavelength 520nm). Collect fluorescence every 2 minutes for 30 consecutive times to continuously detect changes in fluorescence intensity in the system.

[0043] Example 2: Design and screening of (RT)RAA primers.

[0044] 1. Analysis of conserved region sequences and plasmid synthesis.

[0045] The sequence information of 563 Lassa virus full genes was downloaded from the NCBI website (https: / / www.ncbi.nlm.nih.gov / ), and the MAFFT program was used to align the sequences to find the conserved sequences. The wild-type plasmid was converted to the following sequence: TGGATTGTACAAACATCCTGGTGTACCAGTCAAATGGAAGAGATAGAAACAGACCCATTGACGGGCCCCCGTGACCCACCGCCGAAAGGCGGTGGGTCACGGGGGCGTCCATTTACAGGACGACTTTGGGACTTGAAGTTCTGAACACCATGTCTCTTGGGAGAACAGCCCTCAAAATTGGTATATTGAGTCCTCCTGACACAGCTGCGTCAAACATTATGCAATCCATT (SEQ ID No. 1); The plasmid obtained by insertion into the pUC57 vector; 2. Design of (RT)RAA primers.

[0046] According to the (RT)RAA primer design principle in the reference (PMID: 27246147), the (RT)RAA primer that can be used for CRISPR-Cas13a detection was designed, with a T7 transcription sequence at the 5' end of the primer, so that the double-stranded DNA (dsDNA) amplified by (RT)RAA can be recognized and transcribed by T7 RNA polymerase (see Table 1). The above sequence was synthesized by Beijing Tianyi Huiyuan Biotechnology Co., Ltd.

[0047] Table 1. (RT)RAA amplification primers for Lassa virus detection

[0048] 3. Use (RT)RAA isothermal amplification combined with gel electrophoresis to screen primers.

[0049] The RT-RAA amplification kit (basic type) was purchased from Hangzhou Zhongce Biotechnology Co., Ltd. (Cat. No.: S003ZC). (RT)RAA fluorescence detection was performed according to the instructions. The specific reaction system of the detection unit tube was prepared as follows: 5µL template, 2µL of upstream and downstream primers (10µM), 13.5µL RNase-free ddH2O and 25µL A Buffer were prepared into a mixed solution and added to the basic reaction unit containing lyophilized powder to fully re-dissolve the lyophilized powder. 2.5µL B Buffer solution was added to the cap of each reaction tube, the cap was closed, and the mixture was mixed by inverting 5-6 times, and centrifuged quickly for 10 seconds. The above reaction tubes were placed in a constant temperature metal bath and reacted at 39°C for 30 minutes.

[0050] According to the copy number calculation formula: copies / μL=6.02×10 23 × concentration (ng / μL) × 10 9 / plasmid length × 660, dilute the Lassa virus wild-type plasmid to a concentration of 10 5 The experiment was performed with 3 upstream primers and 3 downstream primers in Table 1 in pairs, and the amplification results were detected by gel electrophoresis. Figure 2A , Figure 2B , Figure 2C , Figure 2D and Figure 2E As shown: F2 and R1 (i.e., SEQ ID No.3 and SEQ ID No.5) and F2 and R3 (i.e., SEQ ID No.3 and SEQ ID No.7) had obvious amplification bands after reaction. Grayscale analysis using Image J software showed that F2 and R1 primers had better amplification effects. Therefore, F2 and R1 primers were preliminarily selected as the optimal primers.

[0051] Example 3. Design and screening of crRNA 1. Design of crRNA.

[0052] According to the crRNA design principle (reference PMID: 27246147), the present invention designs 5 crRNAs at the target site of Lassa virus nucleoprotein. The crRNA1 detection target sequence is as follows: TCTTGGGAGAACAGCCCTCA (SEQ ID No. 13, Lassa virus gene positions 1616-1635); the crRNA2 detection target sequence is as follows: GGCGTCCATTTACAGGACGA (SEQ ID No. 14, Lassa virus gene positions 1565-1584); the crRNA3 detection target sequence is as follows: GGTCACGGGGGCGTCCATTT (SEQ ID No. 15, Lassa virus gene positions 1556-1575); the crRNA4 detection target sequence is as follows: CATTTACAGGACGACTTTGG (SEQ ID No. 16, Lassa virus gene positions 1571-1590), and the crRNA5 detection target sequence is as follows: GAAGTTCTGAACACCATGTC (SEQ ID No.17, Lassa virus gene positions 1596-1615).

[0053] 2. Preparation of crRNA.

[0054] 1. Synthesis of nucleic acid sequences.

[0055] crRNA was prepared by PCR amplification followed by in vitro transcription. First, the nucleic acid sequence used in PCR was synthesized (Table 2); Table 2. Nucleic acid sequences used to prepare crRNA

[0056] 2. PCR amplification.

[0057] Dilute the sequence synthesized in step 1 (synthesis of nucleic acid sequence) to a solution with a concentration of 10 μL using RNase-free ddH2O, and prepare the PCR reaction system as follows: 2 μL each of T7-crRNA-F, crRNA-R, and crRNA-template, 25 μL of 2×TaqPCR MasterMix (CW2965M), 19 μL of RNase-free ddH2O, and a total reaction volume of 50 μL. Place in a PCR instrument, and set the reaction conditions to thermal denaturation at 95°C for 5 minutes; 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 15 seconds, for a total of 38 cycles; and 72°C automatic extension for 10 minutes. After amplification, store the PCR product in a refrigerator at 4°C.

[0058] 3. Purification of PCR products.

[0059] The PCR product in the above PCR amplification step was purified as follows: 500 µL of Tris-equilibrated phenol (Solebol) and an equal volume of chloroform (Sinopharm Group) were added to a centrifuge tube, vortexed and mixed, and then briefly centrifuged (12,000 rpm, 10 sec), and the supernatant was discarded to obtain a mixed solution; 150 µL of the mixed solution was added to the PCR product, vortexed and mixed, and then placed in a centrifuge, and centrifuged at 12,000 rpm for 10 min; 30 µL of the supernatant was placed in a new centrifuge tube, 70 µL of anhydrous ethanol was added, vortexed and mixed, and then placed in a centrifuge, and centrifuged at 12,000 rpm for 10 min, and the supernatant was discarded; 200 µL of 75% ethanol was added, placed in a centrifuge, and centrifuged at 12,000 rpm for 10 min, and the supernatant was discarded (this step was repeated three times). The obtained white precipitate was dried at room temperature (no liquid residue), 50 µL RNase-free ddH2O was added to dissolve the precipitate, the concentration was detected with an ultra-micro spectrophotometer, and the precipitate was stored at -20°C to obtain the purified PCR product.

[0060] 4. T7 in vitro transcription.

[0061] Take 1µg of the purified PCR product obtained in step 3 and transcribe the purified PCR product into crRNA using the NEB T7 Fast and Efficient RNA Synthesis Kit. The transcription system is as follows: NTP Buffer Mix 10µL, T7 RNA Polymerase Mix 2μL, cDNA template 1μg, and use RNase-free ddH2O to make the reaction system up to 20µL. After mixing the above T7 in vitro transcription system, place it in a constant temperature incubator at 37°C overnight to obtain the transcription product; add 20μL RNase-freeH2O to the transcription product, then add 2μL DNase Ⅰ (to remove excess DNA), mix well, and incubate at 37°C for 15min to obtain crRNA.

[0062] 5. Purification of crRNA.

[0063] Purify the crRNA obtained by the above transcription according to the instructions of Agencourt RNA Clean XP (Beckman Coulter). The specific steps are as follows: shake the magnetic beads in the bottle to mix well, add 1.8 times the volume of magnetic beads to the centrifuge tube containing the transcription product, gently blow 10 times to mix, and let it stand at room temperature for 3 minutes. Place the centrifuge tube in the magnetic rack and let it stand for 10 minutes. The magnetic beads are adsorbed on the wall of the tube. Gently aspirate the liquid in the tube to prevent the magnetic beads from being aspirated. Add 200µL 70% ethanol (prepared with RNase-free H2O) to the centrifuge tube, incubate at room temperature for 30 seconds, and discard (repeat this process 3 times to wash the magnetic beads). Dry the centrifuge tube at room temperature and remove the residual liquid in the tube. Add 50 µL RNase-free H2O, pipette 10 times to mix, put it into the magnetic rack, aspirate the clear liquid after the magnetic beads adhere to the wall, put it into a new centrifuge tube, measure the concentration of the purified crRNA with an ultra-micro spectrophotometer, dilute it to 100 ng with RNase-free H2O, and store it at -80℃ for standby use.

[0064] 3. Screening of crRNA.

[0065] Dilute the Lassa virus wild-type plasmid to a concentration of 10 7The experiment was conducted with 1000 copies / μL, and the primer combination F2R1 selected in Example 2 was used to perform (RT)RAA amplification on the Lassa virus plasmid. The amplification system was as follows: 5μL template, 2μL of upstream and downstream primers (10μM), 13.5μL RNase-free ddH2O and 25μL A Buffer were prepared as a mixed solution, and added to the basic reaction unit containing lyophilized powder to fully dissolve the lyophilized powder. 2.5μL BBuffer solution was added to the cap of each reaction tube, the cap was closed, and the mixture was mixed by inverting 5-6 times, and centrifuged quickly for 10 seconds. The above reaction tube was placed at 39°C for 30 minutes to obtain the (RT)RAA amplification product.

[0066] The (RT)RAA amplification products were amplified using crRNA1, crRNA2, crRNA3, crRNA4, and crRNA5, and the amplification results were detected by fluorescence. The template was set as a negative control in which RNase-free H2O replaced crRNA.

[0067] Test results such as Figure 2F , Figure 2G As shown, both crRNA1 and crRNA2 can detect wild-type plasmids; Both crRNAs can recognize the wild-type plasmid, and the differences in their fluorescence values ​​are statistically significant (****: P < 0.0001, ***: P < 0.001; **: P < 0.01). The fluorescence value of crRNA1 was higher than that of crRNA2 during the entire detection process. Therefore, crRNA1 (GGGATTTAGACTACCCCAAAAACGAAGGGGACTAAAACACCAATTTTGAGGGCTGTTCTCCCAAGA, SEQ ID No. 8) was selected as the optimal crRNA for detecting Lassa virus.

[0068] Example 4: Further screening of amplification primers.

[0069] The Lassa virus wild-type low-concentration plasmid was diluted in a 10-fold concentration gradient, and the three upstream primers and the three downstream primers in Table 1 were paired in pairs, and amplified according to the amplification method of Example 1 (III, 1). Then, the best primers were used to perform fluorescence detection on the amplification results according to the method of Example 1 (III, 5), and the template was set as a negative control in which RNase-free H2O replaced crRNA to confirm whether the primers obtained by the preliminary screening can also effectively amplify in the case of low-concentration template plasmid.

[0070] Test results such as Figure 3A-Figure 3F As shown in the results, the three primer pairs F2R1, F2R3, and F3R2 can all be used at a substrate concentration of 10 1The amplification product was detected at 10 copies / µL and at 10 0 In comparison, the amplification ability of F2R1 is more stable, so F2 and R1 primers are selected as the optimal primers.

[0071] Example 5: Sensitivity evaluation.

[0072] The Lassa virus wild-type plasmid was diluted in a 10-fold concentration gradient and detected according to the method in Example 1 to evaluate the sensitivity of the detection method.

[0073] The reaction system includes the following substances: Reporter RNA (custom synthesized by Beijing Tianyi Huiyuan Biotechnology Co., Ltd.), reporter RNA (20U) consists of 20 U, namely FAM-UUUUUUUUUUUUUUUUUUU-Biotin (SEQ ID No. 19), and the two ends of the RNA are labeled with FAM and biotin, respectively, where FAM binds to colloidal gold-labeled rabbit anti-FITC antibody, and biotin binds to the T-line streptavidin on the test strip.

[0074] The primers are the primers screened in Example 4, the upstream primer is AATTCTAATACGACTCACTATAGGGTACAAACATCCTGGTGTACCAGTCAAATGG (SEQ ID No. 3), and the downstream primer is CATAATGTTTGACGCAGCTGTGTCAGGAGG (SEQ ID No. 5). The crRNA used is the crRNA1 with the target of SEQ ID No. 8 screened in Example 3. The specific steps are as follows: 1. The Lassa virus mutant plasmid and wild-type plasmid synthesized in Example 2 were diluted in a 10-fold concentration gradient, and the diluted plasmid was used as a template. At the same time, the amplification product using RNase-free H2O alternative primers as a template was set as a negative control. The plasmid was amplified by (RT) RAA according to the steps in Example 1.

[0075] 2. Take 5 µL of (RT)RAA amplification product and detect the (RT)RAA amplification product according to the method in the steps of Example 1.

[0076] Test results such as Figure 4A-4D As shown, when the Lassa virus wild-type plasmid was detected, when the concentration was greater than 1×10 2 If the concentration is less than 10 copies / μL and the T and C lines are both visible, the result is considered positive for Lassa virus; if the concentration is less than 10 copies / μL and the negative control (NC) is considered negative (see Figure 4A and Figure 4B). Therefore, this method can detect the concentration of 1×10 2 copies / μL of Lassa virus target nucleic acid.

[0077] Example 5. Specificity evaluation.

[0078] Twelve other common pathogen nucleic acids were used for detection according to the method in Example 1 to evaluate the specificity of the detection method.

[0079] The reaction system includes the following substances: Reporter RNA (custom synthesized by Beijing Tianyi Huiyuan Biotechnology Co., Ltd.), reporter RNA (20U) consists of 20 U, namely FAM-UUUUUUUUUUUUUUUUUUU-Biotin (SEQ ID No. 19), and the two ends of the RNA are labeled with FAM and biotin, respectively, where FAM binds to colloidal gold-labeled rabbit anti-FITC antibody, and biotin binds to the T-line streptavidin on the test strip.

[0080] The primers are the primers selected in Example 2, the upstream primer is AATTCTAATACGACTCACTATAGGGTACAAACATCCTGGTGTACCAGTCAAATGG (SEQ ID No. 3), and the downstream primer is CATAATGTTTGACGCAGCTGTGTCAGGAGG (SEQ ID No. 5). The crRNA used is the crRNA1 with the target SEQ ID No. 8 selected in Example 3. The specific steps are as follows: 1. Using the pathogenic nucleic acids of Chikungunya virus, Japanese encephalitis virus, forest encephalitis virus, Hantavirus, yellow fever virus, polytypic human adenovirus, Zika virus, influenza B virus and Staphylococcus aureus as templates, the nucleic acids of 12 different pathogens were amplified by (RT)RAA according to the method of step (III, 1) in Example 1. At the same time, the amplification product using the wild-type plasmid of Lassa virus as the template was set as the positive control (PC), and the amplification product using the RNase-free H2O alternative plasmid as the template was set as the negative control (NC).

[0081] 2. Take 5 µL of (RT)RAA amplification product and detect the (RT)RAA amplification product according to the method in steps (iii, 2, 3) of Example 1.

[0082] Test results such as Figure 4A-4DAs shown, when the lateral flow strips were tested with nucleic acids from these 12 pathogens and the negative control (no pathogen nucleic acid), both "C" and "T" lines were displayed, so the test result was negative; the lateral flow strips with Lassa virus nucleic acid only displayed the "C" line without the "T" line, and the test result was considered positive (Figure 4 C, Figure 4D). These results show that this test method has good specificity.

[0083] The above is only a preferred specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Any changes or substitutions that can be easily thought of by a person skilled in the art within the technical scope disclosed by the present invention should be included in the protection scope of the present invention. Therefore, the protection scope of the present invention should be based on the protection scope of the claims.

Claims

1. A Lassa virus rapid nucleic acid detection kit, characterized in that: It includes the following components: 1) A set of (RT)RAA primers for rapid nucleic acid detection of Lassa virus; 2) A CRISPR-Cas13a system for rapid nucleic acid detection of Lassa virus, comprising Cas13a protein and crRNA, or a complex formed by the two; The crRNA includes an anchor sequence for binding to the Cas13a protein and a guide sequence targeting a target sequence in a conserved region of the Lassa virus nucleoprotein; the target sequence in the conserved region of the Lassa virus nucleoprotein is located at positions 1462-1691 of the Lassa virus nucleoprotein gene; and the Cas13a protein is a LwCas13a protein.

2. The Lassa virus rapid nucleic acid detection kit according to claim 1, characterized in that: The target sequence of the conserved region of the Lassa virus nucleoprotein is shown in SEQ ID No.

1.

3. The Lassa virus rapid nucleic acid detection kit according to claim 1 or 2, characterized in that: The crRNA sequence is shown in SEQ ID No.

8.

4. A kit for rapid nucleic acid detection of Lassa virus, characterized in that: It comprises the (RT)RAA primer for rapid nucleic acid detection of Lassa virus as described in any one of claims 1-3 or / and the CRISPR-Cas13a system for rapid nucleic acid detection of Lassa virus.

5. The kit for rapid nucleic acid detection of Lassa virus according to claim 4, characterized in that: The kit also includes a primer combination for specifically amplifying the Lassa virus target sequence; the primer combination consists of a single-stranded DNA molecule as shown in SEQ ID No. 3 and a single-stranded DNA molecule as shown in SEQ ID No.

5.

6. Use of the kit according to any one of claims 1 to 5 in the preparation of a product having the following function: detecting whether a target nucleic acid is a pathogen nucleic acid.

7. Any of the following substances: A1) the crRNA according to any one of claims 1 to 3; A2) the Cas13a protein and crRNA according to any one of claims 1 to 3, or a complex formed by the two; A3) The primer combination according to claim 5.

8. Any of the following applications: B1) Use of the kit according to any one of claims 1 to 5 or the substance according to claim 7 in detecting or assisting rapid nucleic acid detection of Lassa virus; B2) Use of the kit according to any one of claims 1 to 5 or the substance according to claim 7 in the preparation of a product for detecting or assisting in rapid nucleic acid detection of Lassa virus; B3) Use of the kit according to any one of claims 1 to 5 or the substance according to claim 7 in detecting or assisting in detecting whether a sample to be tested contains Lassa virus; B4) Use of the kit according to any one of claims 1 to 5 or the substance according to claim 7 in the preparation of a product for detecting or assisting in detecting whether a sample to be tested contains Lassa virus; B5) Use of the kit according to any one of claims 1 to 5 or the substance according to claim 7 in screening or assisting in screening Lassa virus prevention and treatment drugs; B6) Use of the kit according to any one of claims 1 to 5 or the substance according to claim 7 in the preparation of a product for screening or assisting in screening of Lassa virus prevention and treatment drugs; B7) Use of the substance according to claim 7 in the preparation of a kit according to any one of claims 1 to 5.

9. The use according to claim 8, characterized in that: The use described is for non-diagnostic purposes.

10. A method for rapid nucleic acid detection of Lassa virus, characterized in that: The method for rapid nucleic acid detection of Lassa virus is a method for non-diagnostic purposes, and the method comprises using the kit described in any one of claims 1-5 to detect whether the sample to be tested is or is a candidate for Lassa virus.

Images