Method for regulating and controlling asparagine content in wheat grains by recognizing transcription factor TaBLZ1

Abstract

The invention relates to the field of gene engineering, in particular to a method for reducing the content of asparagine in wheat grains by recognizing a transcriptional regulation factor TaBLZ1. A promoter functional element of a key gene TaASN1 for regulating and controlling asparagine synthesis is analyzed, yeast one-hybridization and gel migration retardation tests are combined, a transcription factor TaBLZ1 possibly interacting with the TaASN1 is recognized, and gene editing proves that the TaBLZ1 plays a regulating and controlling role in the asparagine synthesis process. By analyzing the function of the TaBLZ1 transcription factor, a foundation is laid for reducing the asparagine content through a genetic engineering means and cultivating a wheat variety with low asparagine content.

Description

Technical Field

[0001] The invention relates to the field of genetic engineering, in particular to a method for regulating the asparagine content in wheat grains by identifying a transcription factor TaBLZ1. Background Art

[0002] During the high-temperature food processing process, wheat is prone to produce acrylamide, a Class 2A carcinogen with neurotoxic, genetic and reproductive toxicity.

[0003] In 2002, Nature magazine first showed that the Maillard reaction involving asparagine and reducing sugars under heating conditions is the main pathway leading to the formation of acrylamide, and in cereal crops, asparagine is the main determinant of this reaction compared to reducing sugars. Several studies have also confirmed that free asparagine in wheat grains is the main precursor for the formation of acrylamide, and the content of free asparagine is significantly correlated with the content of acrylamide formed during high-temperature processing, with a correlation coefficient of up to 0.998.

[0004] It should be pointed out that industry often adds asparaginase during the processing of food raw materials to reduce the asparagine content and thus reduce the formation of acrylamide, but the high cost limits the application of this method in food crops such as wheat. Selecting cereal varieties with low asparagine content as raw materials is a key measure to control the acrylamide content of cereal foods. Through genetic engineering, clarifying the regulation of asparagine synthesis pathways and genetically improving wheat varieties with high asparagine content will be an important development direction to ensure wheat food safety. The biosynthesis pathway of asparagine is strictly regulated by transcription factors to form a complex metabolic network. Analyzing and clarifying the functions of these transcription factors is crucial to a deep understanding of the molecular regulatory mechanism of the asparagine synthesis pathway.

[0005] In recent years, studies have found that the bZIP family basic leucine zipper transcription factor 11 may regulate the expression of the Arabidopsis AtASN1 gene through the bZIP binding site near the TATA box, and bZIP10 has also been reported to be related to the gene regulation of Arabidopsis asparagine synthetase. bZIP9, bZIP25 and bZIP63 in the bZIP transcription factor family may be involved in the regulation of wheat asparagine synthesis, but to date, no clear transcription factor plays a role in regulating the function of asparagine. Although we already know that bZIP transcription factors regulate the expression of functional genes by participating in multiple signal transduction pathways, thereby affecting plant development, stress resistance and amino acid synthesis, however, in current research, there is no report on which member of the bZIP transcription factor family can clearly regulate the synthesis of asparagine.

[0006] Elucidating the synthesis pathway and mechanism of asparagine, obtaining information on key regulatory factors, and thus genetically improving metabolic pathways and promoting the directional synthesis of asparagine have become powerful tools for screening and breeding new varieties with low asparagine content. Transcription factors can regulate the expression of a series of key biosynthetic genes recognized by them, which is more advantageous than simply modifying one or more structural genes, and is of great significance to achieving the goal of "economical and efficient" genetic engineering.

[0007] The transcription factor BLZ1 was first found to be expressed in the endosperm of barley, and later in the roots and leaves of barley, and the embryo and endosperm of wheat. This gene is a single-copy gene on chromosome 5, containing 6 exons, 5 introns, and a 442-nucleotide 5′ untranslated leader sequence. In the early stage, the function of this gene was mainly to regulate the expression of storage protein genes (such as group B-gliadin genes), and its role in affecting wheat asparagine synthesis has not been reported. Summary of the invention

[0008] The purpose of the present invention is to provide a method for regulating the asparagine content in wheat grains through the transcription factor TaBLZ1, thereby affecting the synthesis of acrylamide in wheat food, and providing a theoretical basis for reducing the formation of acrylamide in wheat processed food from the source of agricultural production and cultivating wheat varieties that meet food safety requirements. By analyzing the function of the TaBLZ1 transcription factor, it lays the foundation for reducing the asparagine content through genetic engineering means, providing candidate genetic manipulation targets, and cultivating wheat varieties with low asparagine content.

[0009] In order to achieve the above object, the present invention adopts the following scheme:

[0010] 1. Analysis of the asparagine synthetase gene family: A total of five asparagine synthetase genes have been identified in wheat: TaASN1, TaASN2, TaASN3.1, TaASN3.2 and TaASN4. The enzyme kinetics analysis of asparagine synthesis in wheat revealed that TaASN1 has a high efficiency in catalyzing the synthesis of asparagine.

[0011] 2. Identification of transcription factor TaBLZ1: By comparing the ASN1 promoter nucleotide sequences of wheat, wild wheat, barley and Brachypodium distichum, the conserved sequence of the nutrient response element ATGAGTCAT ( Figure 2 Red area), this site is similar to the binding site of yeast transcription factor GCN4, and the transcription factor TaBLZ1 that specifically binds to this sequence site was obtained.

[0012] 3. Interaction between transcription factor TaBLZ1 and TaASN1 gene: Yeast single-hybrid and competitive gel retardation experiments were used to verify the interaction between transcription factor TaBLZ1 and TaASN1 gene.

[0013] 4. The function of TaBLZ1 in regulating asparagine synthesis: TaBLZ1 mutant material was obtained through gene editing technology. Compared with the wild type, it was found that the asparagine content in its grains was significantly lower than that of the wild type.

[0014] The present invention identified the TaBLZ1 transcription factor of the bZIP transcription activator family through preliminary analysis of the promoter region of the key gene TaASN1 in the asparagine synthetase gene family. At the same time, combined with yeast single hybridization and gel migration experiments, it was found that TaBLZ1 and the TaASN1 gene promoter may have an interactive relationship. The CRISPR / Cas9 technology was further used to clarify that TaBLZ1 has the function of regulating asparagine content.

[0015] The specific steps include:

[0016] (a) Analysis of asparagine synthetase gene family TaASN1, TaASN2 and TaASN3: The full-length coding sequences of TaASN1, TaASN2 and TaASN3 were obtained by molecular cloning and heterologously expressed in Escherichia coli. The "forward" and "reverse" primers of TaASN1 were 5'-ccgg aattcATGTGCGGCATACTGGC (SEQ ID NO.1, lowercase letters indicate additional nucleotides for adding EcoRI and XhoI restriction sites at both ends of the PCR product, the same below) and 5'-ccgctcgagAACTCTCAATTGCGACACCAG (SEQ ID NO.2), respectively. The "forward" and "reverse" primers of TaASN2 are 5'-ccggaattcATGTGCGGCATACTAGCGGTG (SEQ ID NO.3) and 5'-ccgctgagaagtCTCAATGGCAAC (SEQ ID NO.4), respectively, and the "forward" and "reverse" primers of TaASN3 are 5'-ccggaattcATGTGCGGCATCCTCGC (SEQ ID NO.5) and 5'-ataagaggcggccgcaaaCAGCAGCTGCTGGAACA (SEQ ID NO.6), respectively.

[0017] (b) Biochemical function analysis of asparagine synthetase TaASN1 and TaASN2: A monoclonal antibody that recognizes asparagine synthetase TaASN1 protein was prepared, and the monoclonal antibody sequence is SKKPRMIEVAAP (SEQ ID NO.7). Based on the enzyme-catalyzed reaction kinetics, a reaction model for the synthesis of asparagine by asparagine synthetase was constructed. The content of asparagine was detected by LC-MS, indicating that the catalytic efficiency of asparagine synthetase TaASN1 in the glutamate to asparagine synthesis pathway is the highest, indicating that the asparagine synthetase gene TaASN1 is a key gene for the synthesis of asparagine.

[0018] (c) Expression pattern of TaASN1 gene in grains of wheat varieties with different asparagine contents: The relative expression level of TaASN1 gene in wheat varieties with different asparagine contents was detected by fluorescence quantitative PCR. It was found that there was no difference in the amino acid region sequence of the protein encoded by the materials. It is speculated that the promoter region or upstream transcription factors may play a role.

[0019] (d) Identification of the transcription factor TaBLZ1: By comparing the nucleotide sequences of the ASN1 promoter of wheat, wild wheat, barley and Brachypodium distichum using bioinformatics, we discovered the conserved sequence of the nutrient response element ATGAGTCAT ( Figure 1 Red area), this site is similar to the binding site of yeast transcription factor GCN4, and the transcription factor TaBLZ1 that specifically binds to this sequence site was obtained.

[0020] (e) Interaction between transcription factor TaBLZ1 and TaASN1 gene: Yeast one-hybrid and competitive gel retardation interactions revealed that TaBLZ1 protein can interact with TaASN1.

[0021] (f) Functional verification of TaBLZ1 regulating asparagine synthesis: Fluorescence quantitative PCR revealed significant differences in the relative expression levels of the TaBLZ1 gene among wheat varieties with different asparagine contents. Wheat mutant materials after gene editing of TaBLZ1 were constructed, and it was found that the asparagine content in the grains of this material was significantly reduced compared with that of the wild type.

[0022] The present invention finally identified the transcriptional regulatory factor TaBLZ1 through the above steps, and found that it plays a role in reducing the asparagine content of wheat grains.

[0023] The invention is innovative in that:

[0024] 1) The transcription factor TaBLZ1 that binds to TaASN1 was identified through the key nutritional element "ATGAGTCAT" in the promoter core of TaASN1.

[0025] 2) The binding between TaASN1 promoter and TaBLZ1 transcription factor was confirmed by yeast one-hybridization and gel electrophoresis migration.

[0026] 3) By constructing a TaBLZ1 mutant, we demonstrated that this transcription factor plays a role in regulating the asparagine content in wheat grains.

[0027] Based on the above technical solution, the first aspect of the present invention provides the use of TaBLZ1 gene in reducing the asparagine content in wheat grains, and the nucleotide sequence of the TaBLZ1 gene is shown in SEQ ID NO.9.

[0028] The second aspect of the present invention provides the use of transcription factor TaBLZ1 in reducing the asparagine content in wheat grains, wherein the amino acid sequence of the transcription factor TaBLZ1 is shown in SEQ ID NO.8; the nucleotide sequence of the coding gene of the transcription factor TaBLZ1 is shown in SEQ ID NO.9.

[0029] The third aspect of the present invention provides a use of a recombinant expression vector or a recombinant bacterium in reducing the asparagine content in wheat grains, wherein the recombinant expression vector or the recombinant bacterium contains the TaBLZ1 gene SEQ ID NO.9 as described above.

[0030] Furthermore, the recombinant expression vector is pCXB053.

[0031] Furthermore, the recombinant bacteria is Agrobacterium, more preferably Agrobacterium EHA105.

[0032] A fourth aspect of the present invention provides a transgenic method for reducing the asparagine content in wheat grains, wherein the transgenic method for reducing the asparagine content in wheat grains is to genetically transform wheat with a recombinant bacterium containing the TaBLZ1 gene as shown in SEQ ID NO.9.

[0033] Furthermore, the transgenic method for reducing the asparagine content in wheat grains comprises the following steps:

[0034] A. constructing a recombinant expression vector containing the TaBLZ1 gene as shown in SEQ ID NO.9;

[0035] B. Transforming Agrobacterium with the recombinant expression vector constructed in step A to obtain recombinant bacteria;

[0036] C. genetic transformation of wheat by the recombinant bacteria obtained in step B;

[0037] D. Identify T0 plants and screen to obtain transgenic positive plants;

[0038] E. Obtained stable inherited T2 generation plants, compared the T2 generation mutants and wild type, found that the mutant material had a lower asparagine content.

[0039] The fifth aspect of the present invention provides a wheat transgenic plant or germplasm obtained by using the above-mentioned transgenic method for reducing the asparagine content in wheat grains.

[0040] The advantages of the present invention are:

[0041] 1. TaBLZ1 is the first transcription factor clearly confirmed to play a role in reducing the asparagine content in wheat grains.

[0042] 2. Taking TaBLZ1 transcription factor as a candidate target has more advantages than simply modifying one or more structural genes, and is of great significance to achieving the goal of "economical and efficient" genetic engineering.

[0043] 3. Through the functional analysis of TaBLZ1 transcription factor, we lay the foundation for reducing asparagine content through genetic engineering and breeding wheat varieties with low asparagine content. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 .Relative values ​​of TaASN1 gene expression in materials with significant differences in asparagine content.

[0045] Figure 2 .Partial sequence analysis of TaASN1 promoter in wheat, wild wheat, barley and Brachypodium distichum.

[0046] Figure 3 .Yeast one-hybrid interaction between TaBLZ1 and the cis-acting element of the TaASN1 gene promoter.

[0047] Figure 4 .Gel blocking results: Column 1: biotin-labeled probe; Column 2: biotin-labeled probe + TaBLZ1 protein; Column 3: biotin-labeled probe + cold probe not labeled with biotin + TaBLZ1 protein.

[0048] Figure 5 .Expression pattern of TaBLZ1 gene in wheat grains with significant differences in asparagine content.

[0049] Figure 6 .Constructed TaBLZ1 gene vector.

[0050] Figure 7 .Genetic transformation of vectors. DETAILED DESCRIPTION

[0051] The specific implementation methods provided by the present invention are described in detail below in conjunction with examples.

[0052] Example 1: Analysis of the promoter of the asparagine synthetase gene family TaASN1

[0053] Fluorescence quantitative PCR analysis showed that the relative expression of TaASN1 gene under sulfur deficiency conditions was significantly different between varieties compared with normal sulfur supply (p = 0.018), but there was no difference in the amino acid sequence of the protein encoding between materials. It is speculated that the promoter region or upstream transcription factors may play a role. Among them, Spark, Rialto, SR3, SR7, SR41 and SR107 (asparagine content was 5.71mmol / kg, 4.45mmol / kg, 1.68mmol / kg, 2.13mmol / kg, 3.23mmol / kg and 2.63mmol / kg, respectively, and the significant difference coefficient between materials was p = 0.003) were selected, and the soilless cultivation method of Hoagland nutrient solution irrigation was adopted. 1mM MgSO was normally supplied in the control. 4 MgSO is not supplied in sulfur deficiency treatment 4 , and keep the concentrations of other nutrients unchanged compared with the control. When the grain filling period reached 28 days, samples were taken to measure the expression pattern of TaASN1 gene in the grains. The relative value was calculated as the relative expression of TaASN1 gene under sulfur deficiency treatment / relative expression of TaASN1 gene under normal sulfur supply conditions ( Figure 1 By comparing the ASN1 promoter nucleotide sequences of wheat, wild wheat, barley and Brachypodium distichum using bioinformatics, we found the conserved sequence of the nutrient response element ATGAGTCAT ( Figure 1 The red area) is similar to the binding site of yeast transcription factor GCN4, and the transcription factor TaBLZ1 ( Figure 2 ).

[0054] Example 2: Verification of interaction between TaBLZ1 and TaASN1

[0055] Through yeast one-hybrid one-to-one verification, it was found that the positive control Y187 [p53-His2 & pGADT7-p53] grew normally on SD / -TLH / 20mM3-AT plates, while the negative control Y187 [pASN1-His2 & pGADT7] was significantly inhibited on SD / -TLH / 100mM3-AT plates; Y187 [pASN1-His2 & pGADT7-BLZ1:177-1406T.aestivum] also grew normally on SD / -TLH / 100mM3-AT plates; preliminary results showed that TaBLZ1 interacted with the cis-acting element of the TaASN1 gene promoter ( Figure 3 ).

[0056] The results of competitive gel retardation assay (EMSA) showed that the biotin-labeled probe and the sample protein TaBLZ1 could bind to each other. After adding the cold probe that was not labeled with biotin, the probe competed with the biotin-labeled probe and the binding with the sample protein became weaker, indicating that the biotin-labeled probe of the constructed TaASN1 functional element competed with the cold probe and the functional element could specifically bind to the sample protein TaBLZ1 ( Figure 4 ).

[0057] Example 3: Expression pattern of TaBLZ1 gene in wheat varieties with different asparagine contents

[0058] Based on 225 wheat varieties collected in the Yangtze River Delta region of China, 10 materials with significant differences in asparagine content were selected (P<0.01) to detect the expression pattern of the TaBLZ1 gene. It was found that the gene expression of TaBLZ1 in the materials was extremely significantly different in different varieties (P=0.007) ( Figure 5 ).

[0059] Example 4: Functional verification of TaBLZ1 regulating asparagine synthesis

[0060] 1. Obtain the cds sequence of TaBLZ1 from the target fragment

[0061] The sequence is shown as SEQ ID NO.9.

[0062] 2. Connection of carrier:

[0063] Construct a gene editing vector, connect the protein and RNA guide sequences of the gene editing tool to the constructed vector, and connect the connected vector Figure 6 :The reaction system is as follows:

[0064]

[0065] Run the Ligase program on the PCR instrument at 16°C for 1 hour and then place in the refrigerator for 3 hours or overnight.

[0066] 3. Transformation of DH5α and vector into Agrobacterium

[0067] Transform 100 μl of the above ligation product into 100 μl of competent E. coli, place on ice for 25 min, heat shock at 42°C for 45 s, place on ice for 2 min (do not shake), add 100 μl of LB without antibiotics, shake at 37°C, 200 rpm for 1 h, plate, LB+Kana selection, and culture at 37°C for one day. Randomly pick 8 single clones from the plate for bacterial liquid PCR, and finally select the correct bacterial liquid for sequencing. The sequencing primer information is as follows: QC2: TCCCAGTCACGACGTTGTAA (SEQ ID NO.10); QC4: TCAAACAAGTGTGACAAAAA (SEQ ID NO.11), and then transform the correctly sequenced plasmid into Agrobacterium.

[0068] 4. Genetic transformation of vector

[0069] The vector plasmid was transferred into Agrobacterium EHA105 by electroporation and identified by PCR. Freshly peeled wheat embryos of about 1.5-2 mm were used as materials. The peeled wheat embryos were placed in a 2 ml plastic centrifuge tube containing 1.8 mL of suspension. About 150 immature embryos were processed within 30 minutes. The suspension was removed, and 1.0 ml of Agrobacterium suspension was added to the remaining wheat embryos in the tube and left for 5 minutes. The immature embryos in the centrifuge tube were suspended and poured onto the co-culture medium, and the excess Agrobacterium liquid on the surface was removed with a pipette. The embryos were co-cultured at 23°C in the dark for 2 days. After co-cultivation, the young embryos were transferred to a resting medium, cultured in the dark at 28°C for 8 days, and then placed in a differentiation medium with corresponding resistance, cultured at 25°C, 5000lx, and light for 3 weeks; the differentiated seedlings were transferred to a rooting medium, cultured at 25°C, 5000lx, and light until roots were formed; the seedlings were transferred to small pots for growth, and transplanted to a greenhouse after a certain growth stage, and the offspring seeds were harvested after 3-4 months ( Figure 7 ).

[0070] 5. Positive identification

[0071] After transplanting into the plug tray, the T0 plants were tested for [plant resistance] genes. The primer information is as follows:

[0072] Bar-F1: CCATCGTCAACCACTACATCGAGACA (SEQ ID NO.12)

[0073] Bar-R1: CTTCAGCAGGTGGGTGTAGAGCGT (SEQ ID NO.13)

[0074] Amplicon size 269 bp

[0075] The reaction system (20ul) is as follows:

[0076] 10ul 2*PCR buffer,

[0077] 7ul H 2 Oh,

[0078] 1ul upstream primer (10uM)

[0079] 1ul downstream primer (10uM)

[0080] 1ul DNA

[0081] The reaction procedure is as follows:

[0082]

[0083] Example 5: Comparison of asparagine content in T2 generation TaBLZ1 mutant and wild type grains

[0084] Accurately weigh 0.2g of sample and asparagine standard, dissolve in water, and configure the standard into 5-6 standard solutions of different mass concentrations. After derivatization, according to the chromatographic conditions (Agilent 1100 high performance liquid chromatograph, UV detector wavelength 254nm. Chromatographic column Amethyst C18-H (250mm*4.6mm, 5μm), column temperature: 40℃, flow rate: 1mL / min, injection volume: 10μL mobile phase A: weigh 7.6g of anhydrous sodium acetate, add 925mL of water, then add 70mL of acetonitrile and mix. Filter with 0.45μm filter membrane; mobile phase B: 80% acetonitrile aqueous solution) detect the peak area of ​​each sample and concentration standard solution in turn, and use the peak area as the ordinate and the concentration as the abscissa to calculate the asparagine content. The final research results show that the asparagine content of the T2 generation mutant grains is significantly lower than that of the wild-type material (p=0.03).

[0085] The preferred embodiments of the present invention have been specifically described above, but the present invention is not limited to the embodiments. Those skilled in the art may make various equivalent modifications or substitutions without violating the spirit of the present invention. These equivalent modifications or substitutions are all included in the scope defined by the claims of this application.

Claims

1. The use of TaBLZ1 gene in reducing the asparagine content in wheat grains, characterized in that: The nucleotide sequence of the TaBLZ1 gene is shown in SEQ ID NO.

9.

2. The use of transcription factor TaBLZ1 in reducing the asparagine content in wheat grains, characterized in that: The amino acid sequence of the transcription factor TaBLZ1 is shown in SEQ ID NO.

8.

3. Use of a recombinant expression vector or a recombinant bacterium in reducing the asparagine content in wheat grains, characterized in that: The recombinant expression vector or recombinant bacteria contains the TaBLZ1 gene shown in SEQ ID NO.

9.

4. The use according to claim 3, characterized in that: The recombinant expression vector is pCXB053.

5. The use according to claim 3, characterized in that: The recombinant bacteria is Agrobacterium.

6. A transgenic method for reducing the asparagine content in wheat grains, characterized in that: The transgenic method for reducing the asparagine content in wheat grains is to genetically transform wheat with a recombinant bacterium containing the TaBLZ1 gene shown in SEQ ID NO.

9.

7. The transgenic method for reducing asparagine content in wheat grains according to claim 6, characterized in that: The following steps are involved: A. constructing a recombinant expression vector containing the TaBLZ1 gene shown in SEQ ID NO.9; B. Transforming Agrobacterium with the recombinant expression vector constructed in step A to obtain recombinant bacteria; C. genetic transformation of wheat by the recombinant bacteria obtained in step B; D. Identify T0 plants and screen to obtain transgenic positive plants; E. Obtain T2 generation plants with stable genetics.

Images