Application of miR528 in production and breeding of gramineous forage grass

Abstract

The invention discloses application of miR528 in production and breeding of gramineous forage grass, and the tillering capability and / or regeneration capability of the gramineous forage grass can be obviously enhanced by down-regulating the expression and / or function of the miR528, so that the biomass accumulation of the gramineous forage grass is facilitated, and the cultivation of a new gramineous forage grass strain with enhanced tillering capability and / or regeneration capability is facilitated.

Description

Application of miR528 in grass production and breeding Technical Field

[0001] The present application relates to the application of miR528 in the production and breeding of grasses. Specifically, the present application relates to the application of miR528 expression / function downregulation in improving the yield, tillering ability and regeneration ability of grasses. Background Art

[0002] Grasslands are a crucial component of ecological agriculture and are crucial to the sustainable development of modern agriculture and animal husbandry and the ecological environment for human survival. However, due to long-term overexploitation and predatory exploitation, grasslands are increasingly suffering from the "three degradations" (degradation, desertification, and salinization). This has led to increasingly acute conflicts between grasslands and livestock, severe soil erosion, and a deteriorating ecological environment, severely impacting the development of the economy, ecology, and various social undertakings. Therefore, grassland ecological protection and restoration are imperative. Comprehensively improving and selecting high-yield, high-quality forage grass varieties is one of the most effective approaches to grassland ecological protection and restoration.

[0003] Grasses, a major group of forage grasses, are generally characterized by their tender texture, good palatability, and rich nutrition. Besides being high-quality forage, some grass species can also be used for bioenergy production. Switchgrass (Panicum virgatum), native to North America, boasts fast growth, high yield, and strong environmental adaptability. In particular, its high lignocellulose content allows for ethanol conversion rates of up to 57%. Consequently, its use in bioenergy has attracted widespread attention in the United States.

[0004] Leymus chinensis is widely distributed across Eurasia and is a key forage grass found in natural grasslands. Due to its high quality and tolerance to cold, drought, and alkali, it is also known as the "King of Grasses." In addition to its usefulness as a forage grass, Leymus chinensis's rhizomes possess strong penetrating and spreading abilities, forming a well-developed underground rhizome network that effectively binds and stabilizes the soil, making it an excellent plant for grassland restoration and soil and water conservation.

[0005] Tillering is a special branching characteristic that occurs independently of the main stem at the base of the stem during the growth and development of grasses. It is one of the important agronomic traits of grasses and directly affects their forage and seed yield. Regeneration ability is the main characteristic of grasses and is directly related to their yield and mowing tolerance. Grazing by cattle and sheep or manual mowing during grazing can remove the plant's apical meristem, promote the germination or elongation of hidden tillers and buds at the base, and thus stimulate grass regeneration. Cultivating grasses with strong tillering and regeneration abilities is one of the important ways to fundamentally resolve the current contradiction between grass and livestock, restore and protect grassland resources, and safeguard a green ecological environment.

[0006] Summary of the Invention

[0007] Through extensive research, the inventors of this application discovered that miR528 plays an important regulatory role in the tillering and regeneration capacity of grasses, such as switchgrass and Leymus chinensis. Specifically, downregulating the expression and / or function of miR528 in grasses can significantly increase tillering number and / or regeneration capacity.

[0008] Therefore, the present invention provides a method for improving the tillering ability and / or regeneration ability of grasses, comprising downregulating the expression and / or function of miR528 in the grasses.

[0009] In some embodiments, the grass includes but is not limited to Panicum virgatum, Leymus chinensis, Brachypodium distachyon, Miscanthus, Elytrigia intermedia, Uraria crinita, Setaria viridis, Anastatica, Elymus sibiricus, Panicum miliaceum, and Bromus inermis. In some embodiments, the grass is Panicum virgatum and Leymus chinensis.

[0010] In some embodiments, the downregulation of miR528 expression is achieved by gene knockout or gene editing of the miR528 encoding gene MIR528. In some embodiments, the downregulation of miR528 expression is achieved by gene editing of the transcription region of the encoding gene MIR528, and / or its upstream regulatory region, and / or its downstream regulatory region. In some embodiments, the CRISPR / Cas9 system is used to perform gene editing on the transcription region of the encoding gene MIR528, and / or its upstream regulatory region, and / or its downstream regulatory region. In some embodiments, the CRISPR / Cas9 system is used to use an sgRNA: CAGTGGAAGGGGCATGCAG (SEQ ID NO: 4) that is reverse complementary to the encoding gene MIR528. By using the CRISPR / Cas9 system, the Cas9 protein is targeted to the encoding gene MIR528, causing changes in the sequence of the encoding gene, thereby causing downregulation of miR528 expression.

[0011] In some embodiments, the function of miR528 is downregulated by the STTM method. In some embodiments, the function of miR528 is downregulated by expressing a sequence that can be recognized by miR528 and interact with miR528 in gramineous forage. In some embodiments, the function of miR528 is downregulated by expressing an artificial simulation target sequence or a short tandem simulation target that can be recognized by miR528 and interact with miR528 without being cut by miR528 in gramineous forage. In some embodiments, the function of miR528 is downregulated by introducing a vector expressing an artificial simulation target sequence and / or a short tandem simulation target into gramineous forage, wherein the vector constitutively expresses the artificial simulation target sequence or the short tandem simulation target. In some embodiments, the artificially synthesized simulation target sequence comprises or consists of the nucleotide sequence shown in SEQ ID NO:1. In some embodiments, the short tandem mimic target is a sequence (SEQ ID NO: 3) obtained by connecting two artificially synthesized mimic target sequences (SEQ ID NO: 1) via a 48 nt spacer sequence (SEQ ID NO: 2), which functions to downregulate the function of miR528.

[0012] The present invention also provides the application of down-regulating the expression and / or function of miR528 in improving the tillering ability and regeneration ability of grass.

[0013] The present invention also provides an artificial mimic target sequence and a short tandem mimic target (STTM) capable of downregulating the function of miR528 in grasses. In some embodiments, the artificial mimic target sequence comprises or consists of the nucleotide sequence shown in SEQ ID NO: 1. In some embodiments, the short tandem mimic target comprises or consists of the nucleotide sequence shown in SEQ ID NO: 3.

[0014] The present invention also provides a CRISPR-Cas9 vector and sgRNA thereof, which can achieve knockout of the miR528 encoding gene MIR528 in Gramineae forage or perform gene editing on the same.

[0015] The inventors of the present invention have discovered that downregulating miR528 expression and / or function has no adverse effects on the plant height of grasses. Consequently, while significantly enhancing their tillering ability, it can significantly increase their biomass accumulation. Furthermore, downregulating miR528 expression and / or function enhances grass regeneration, contributing to an increase in the total forage supply. For grasses, which can serve as both forage and bioenergy plants, an increase in their total supply is beneficial to the development of both the livestock and ethanol fuel industries.

[0016] Those skilled in the art can utilize these findings to improve and cultivate new forage grass lines with downregulated expression and / or function of miR528, thereby facilitating the dissemination of this technology. Therefore, the present invention also provides a method for cultivating new grass forage lines with enhanced tillering and / or regeneration capacity, comprising downregulating the expression and / or function of miR528 in the new grass forage lines. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] The contents of this application will be further described below in conjunction with the accompanying drawings, wherein the accompanying drawings are only for illustrative purposes and do not limit the scope of the present invention.

[0018] FIG1 shows the alignment results of miR528 precursor sequences in several sequenced grasses.

[0019] FIG2 shows that the mature sequence of miR528 exists in various grasses.

[0020] FIG3 shows the STTM sequence used to inhibit the function of miR528 in Example 3. The sequence contains two miR528 binding sites, each of which contains a "bulge" of 3 bases (CTA) in the middle, and thus cannot be cleaved by miR528.

[0021] FIG4 shows the STTM expression vector constructed in Example 4, wherein the STTM sequence that specifically binds to miR528 is driven by the constitutive ubiquitin promoter.

[0022] FIG. 5 shows the expression level of STTM in switchgrass into which the STTM expression vector was introduced in Example 5. FIG.

[0023] FIG6 shows the phenotype of switchgrass introduced with the STTM expression vector in Example 6, wherein the switchgrass introduced with the STTM expression vector has increased tiller number and biomass compared to switchgrass introduced with an empty vector.

[0024] FIG7 shows the regeneration phenotype of switchgrass introduced with the STTM expression vector 10 days after mowing in Example 7, wherein the regeneration ability of switchgrass introduced with the STTM expression vector after mowing is enhanced compared with switchgrass introduced with an empty vector.

[0025] FIG8 shows the results of sequence editing identification of switchgrass miR528 after the introduction of the miR528 CRISPR / Cas9 vector in Example 9.

[0026] FIG9 shows the results of sequence editing identification of Leymus chinensis miR528 after the introduction of the miR528 CRISPR / Cas9 vector in Example 9.

[0027] FIG. 10 shows that the transgenic switchgrass with miR528 knockout in Example 10 exhibits a phenotype of enhanced regeneration ability.

[0028] FIG. 11 shows that the transgenic Leymus chinensis with miR528 knocked out in Example 10 exhibits a phenotype of enhanced regeneration ability. DETAILED DESCRIPTION

[0029] The content of this application will be further elaborated below in conjunction with the description of specific embodiments, wherein the specific embodiments are merely illustrative and do not limit the scope of the invention. Each element in the embodiments of this application may be changed, substituted, omitted, etc. without departing from the essence of the invention. The scope of protection of this application is determined by the claims and their equivalents.

[0030] In this article, the term "miRNA" refers to a class of endogenous small RNA molecules, 21-24 nt in length. These do not encode proteins, but instead negatively regulate target gene expression at the post-transcriptional level through complementary base pairing, thereby participating in processes such as biological growth and development and environmental response. In plants, miRNAs primarily negatively regulate target gene expression by degrading target mRNA, thereby exercising regulatory functions in various biological processes.

[0031] As used herein, the term "Short Tandem Target Mimic (STTM)" or "STTM" refers to a method for inhibiting miRNA function. Specifically, STTM consists of two synthetic miRNA mimic target sequences in tandem. Both mimic targets have a three-base protrusion at the miRNA cleavage site. This structure allows the miRNA to bind to the mimic target but prevents it from cleaving it. Therefore, the mimic target binding can attract the miRNA, thereby inhibiting its regulation of the true endogenous target gene.

[0032] In this article, the term "CRISPR-Cas9 (Clustered Regularly Interspaced Short Palindromic repeats / CRISPR associated 9) system" refers to a gene editing system. Due to the accuracy and ease of use of the CRISPR-Cas9 system, it has gradually replaced traditional genome editing technologies such as zinc finger nucleases (ZFN) and transcription activator-like effector nucleases (TALEN), and is widely used in gene therapy and crop improvement. The principle is that the endonuclease Cas9 cuts the double-stranded DNA at the target site under the targeting action of the guide RNA (sgRNA), and the broken DNA introduces mutations during the repair process, thereby achieving sequence changes in the target gene. Studies have shown that CRISPR / Cas9 technology can be used to target and edit miRNA coding regions to inhibit the function of miRNA.

[0033] Here, the term "miR528" refers to one of the earliest reported members of the miRNA family in rice and is conserved across monocots. Chinese patent application CN201410423077.X describes the role of miR528 in rice heading timing and viral resistance. Specifically, overexpression of miR528 advances rice heading time, while downregulation of its expression enhances resistance to RSV and delays heading time.

[0034] Through extensive research, the inventors of this application have discovered that miR528 plays an important regulatory role in the tillering and regeneration capacity of grasses, such as switchgrass and Leymus chinensis. Specifically, downregulating the expression and / or function of miR528 in grasses can significantly increase tillering number and / or regeneration capacity. Therefore, the present invention provides the application of miR528 in grass production and breeding.

[0035] (1) Application of miR528 in Gramineae forage production

[0036] A first aspect of the present invention provides a method for improving the tillering and / or regeneration capacity of grasses, thereby increasing the biomass accumulation of grasses and contributing to an increase in the total grass supply. For grasses that can serve as both forage and bioenergy plants, increasing their total supply will benefit the development of animal husbandry and the ethanol fuel industry. The method comprises downregulating the expression and / or function of miR528 in the grasses.

[0037] In some embodiments, the grasses may include, but are not limited to, Panicum virgatum, Leymus chinensis, Brachypodium distachyon, Miscanthus, Elytrigia intermedia, Uraria crinita, Setaria viridis, Anastatica, Elymus sibiricus, Panicum miliaceum, and Bromus inermis. In some embodiments, the grasses are Panicum virgatum and Leymus chinensis.

[0038] In some embodiments, the downregulation of miR528 expression can be achieved by gene knockout or gene editing of the miR528 encoding gene MIR528.

[0039] In some embodiments, the downregulation of miR528 expression can be achieved by gene editing the transcription region of the gene encoding MIR528, and / or its upstream regulatory region, and / or its downstream regulatory region.

[0040] In some embodiments, the CRISPR / Cas9 system can be used to edit the transcription region of the coding gene MIR528, and / or its upstream regulatory region, and / or its downstream regulatory region. In some embodiments, the CRISPR / Cas9 system uses an sgRNA that is reverse complementary to the coding gene MIR528: CAGTGGAAGGGGCATGCAG (SEQ ID NO: 4), and by using the CRISPR / Cas9 system to target the Cas9 protein to the coding gene MIR528, the sequence of the coding gene is changed (including deletion, substitution or insertion of bases), thereby causing downregulation of miR528 expression.

[0041] In some embodiments, the function of miR528 can be down-regulated by the STTM method. In some embodiments, the STTM method may include expressing a sequence that can be recognized by miR528 and interact with miR528 in gramineous forage. In some embodiments, the STTM method may include expressing an artificial simulation target sequence or a short tandem simulation target that can be recognized by miR528 and interact with miR528 without being cut by miR528 in gramineous forage. In some embodiments, the STTM method may include importing a vector expressing an artificial simulation target sequence and / or a short tandem simulation target into gramineous forage so that the function of miR528 is down-regulated, wherein the vector constitutively expresses the artificial simulation target sequence or the short tandem simulation target.

[0042] In some embodiments, the artificially synthesized mimic target sequence may comprise or consist of the nucleotide sequence shown below: CTCCTCTGCATCTAGCCCCTTCCA (SEQ ID NO: 1).

[0043] In some embodiments, two tandem artificially synthesized mimic target sequences are separated by a 48nt spacer sequence to obtain a short tandem mimic target that can also function to downregulate miR528, wherein the spacer sequence is as follows: gttgttgttgttatggtctaatttaaatatggtctaaagaagaagaat (SEQ ID NO: 2). The final functional short tandem mimic target comprises or consists of the nucleotide sequence shown below:

[0044] CTCCTCTGCATCTAGCCCCTTCCAgttgttgttgttatggtctaatttaaatatggtctaaagaagaagaatCTCCTCTGCATCTAGCCCCTTCCA (SEQ ID NO: 3).

[0045] (2) Application of miR528 in the breeding of grasses

[0046] The second aspect of the present invention also provides a method for cultivating a new grass line with enhanced tillering ability and / or regeneration ability, which comprises downregulating the expression and / or function of miR528 in the new grass line, for example relative to the mother grass or the wild-type grass.

[0047] In some embodiments, the method for downregulating the expression and / or function of miR528 in the new grass line can be the method described in section (1) above.

[0048] (3) CRISPR-Cas9 vector and its sgRNA for knocking out or editing the miR528 encoding gene MIR528 in grasses

[0049] The third aspect of the present invention also provides a CRISPR-Cas9 vector and its sgRNA that can achieve knockout or gene editing of the miR528 encoding gene MIR528 in grass. In some embodiments, the sgRNA comprises or consists of a nucleotide sequence as shown below: CAGTGGAAGGGGCATGCAG (SEQ ID NO: 4). By using the CRISPR-Cas9 vector, the Cas9 protein can be targeted to the miR528 encoding gene MIR528, and the encoding gene can be edited, such as to produce a deletion, insertion or mutation of a base, thereby producing a decreased abundance expression of miR528.

[0050] (4) Artificial target sequence and short tandem target mimic (STTM)

[0051] The fourth aspect of the present invention also provides an artificial mimic target sequence and a short tandem target mimic (STTM) capable of achieving functional downregulation of miR528 in grasses. Both can be used in the STTM method to achieve functional downregulation of miR528 in grasses.

[0052] In some embodiments, the artificially synthesized mimetic target sequence comprises or consists of the nucleotide sequence shown in SEQ ID NO: 1. In some embodiments, the short tandem mimetic target comprises or consists of the nucleotide sequence shown in SEQ ID NO: 3.

[0053] The present invention is described in detail below through specific embodiments.

[0054] Example 1. miR528 precursor blast and sequence alignment

[0055] The mature region coding sequence of rice miR528, TGGAAGGGGCATGCAGAGGAG (SEQ ID NO: 5), was blasted against plant species whose genomes have been sequenced using the Phytozome V13 (https: / / phytozome-next.jgi.doe.gov / ) library. The fully matched sequences and their flanking sequences (200 bp before and after) were subjected to secondary sequence folding analysis. Sequences that could fold the stem-loop were retrieved and saved in fasta format. Sequence alignment and editing were performed using Clustal X2 and Genedoc.

[0056] The comparison results are shown in Figure 1. The results showed that miR528 precursors existed in the genomes of various grasses.

[0057] Example 2: Detection of mature miR528 in various forages

[0058] An artificially synthesized DNA sequence complementary to the mature sequence of miR528, CTCCTCTGCATGCCCCTTCCA (SEQ ID NO: 6), and a DNA sequence complementary to the U6 snRNA sequence, TGTATCGTTCCAATTTTATCGGATGT (SEQ ID NO: 7), were used as internal references for the loading amount between different materials. The two DNA sequences were γ-terminal cleaved using polynucleotide kinase T4PNK (NEB, M0201S). 32 The labeled DNA sequence was used as a hybridization probe.

[0059] T4PNK labeling probe system: (10μM) DNA probe 1μl, 10×T4kinase Buffer 5μl, γ- 32 5 μl of P isotope-labeled ATP, 1 μl of T4PNK (10 U / μl), and 38 μl of ultrapure water were added and reacted at 37°C in a heating block for 1 hour.

[0060] Total RNA from different forage materials was extracted using TRNzol (TIANGEN) and electrophoresed through a 15% polyacrylamide gel containing 7 M urea at 200 V for 2 hours. The gel was transferred to a membrane and used for hybridization. Hybridization was incubated overnight at 42°C. The membrane was washed twice with a wash buffer (2X SSC, 0.2% SDS) and then wrapped with plastic wrap. Isotope signals were acquired using a Typhoon FLA9500 laser scanning imager, and the accumulation of miR528 was characterized based on signal intensity.

[0061] The hybridization results are shown in Figure 2 , indicating that mature miR528 could be detected in all the forages tested.

[0062] Example 3. Design of STTM sequence specific for mature miR528

[0063] The STTM sequence specific for mature miR528 was designed as shown in Figure 3. Specifically, a miR528 binding site was designed at each end of a 96-base sequence, and an additional 3 bases were added between bases 10 and 11 of the miR528 binding region.

[0064] The specific sequence is shown in SEQ ID NO: 3, which can bind to miR528 but will not be cleaved by miR528-mediated post-transcriptional regulation.

[0065] Example 4. Construction of miR528 STTM transgenic vector

[0066] First, DNA sequence CF3380 (SEQ ID NO: 8) and its reverse complementary sequence CF3381 (SEQ ID NO: 9) were synthesized.

[0067] CF3380 and CF3381 were mixed in equal moles, denatured at 95°C for 10 minutes, and then cooled to room temperature to anneal to form double-stranded DNA. TM / TEV / D-TOPO TM The double-stranded DNA was recombined into the intermediate vector using the cloning kit (ThermoFisher, K253520) to obtain the target DNA fragment; then, the Gateway TM LR Clonase TM The target DNA fragment was ligated into the binary expression vector pNIAC6B using a kit (ThermoFisher, 11791020) and positioned downstream of the strong maize Ubquintin promoter. The specific experimental procedures were performed in full accordance with the kit instructions. The final binary expression vector map is shown in Figure 4.

[0068] Example 5: Identification of miR528 STTM transgenic lines

[0069] The STTM transgenic vector constructed in Example 4 was transferred into switchgrass callus using an Agrobacterium-mediated callus infection system, and an empty vector was transferred into a portion of the callus as a control. After differentiation and emergence, the seedlings were transferred to vermiculite nutrient soil for cultivation, and total RNA of the transgenic switchgrass was extracted using TRNzol (TIANGEN) after 4 months. 2 μg of total RNA was taken from each sample and reverse transcribed to generate cDNA using the HiScript II 1st Strand cDNA Synthesis Kit (Vazyme, R211). Quantitative PCR was then used to detect the expression level of STTM RNA in each transgenic line. The primers used to detect STTM expression were CF6738 (SEQ ID NO: 10) and CF6739 (SEQ ID NO: 11), and the primers for amplifying the internal reference gene ACTIN were CF6095 (SEQ ID NO: 12) and CF6096 (SEQ ID NO: 13).

[0070] The expression levels of STTM in various transgenic lines are shown in Figure 5. High levels of STTM RNA expression were detected in multiple independent transgenic lines, while no STTM RNA expression was detected in the transgenic lines transformed with the empty vector.

[0071] Example 6: Identification of Tiller Number in miR528 STTM Transgenic Switchgrass

[0072] The phenotypes of four-month-old transgenic switchgrass cultivated in vermiculite soil were observed. As shown in Figure 6, compared to the control strain transformed with the empty vector, the transgenic strain with miR528 knockdown exhibited a greater number of branches, unaffected growth height, and increased total biomass. In other words, the transgenic strain with miR528 knockdown exhibited stronger tillering ability and greater biomass accumulation.

[0073] Example 7: Identification of the regeneration ability of miR528 STTM transgenic switchgrass after mowing

[0074] The tops of 4-month-old transgenic switchgrass seedlings cultured in vermiculite soil were uniformly mowed, leaving only 15 cm long stems on the aboveground parts of the plants. The plants were then divided into equal sizes from the root part and replanted in vermiculite soil. The new tillering phenotype was observed after 10 days.

[0075] The results are shown in Figure 7. Compared with the control strain transformed with the empty vector, the transgenic strain with miR528 suppressed had more newly sprouted buds and a larger number of branches, indicating that the transgenic strain with miR528 suppressed exhibited stronger regeneration ability.

[0076] Example 8. Construction of miR528 CRISPR / Cas9 transgenic vector

[0077] The CRISPR / Cas9 knockout vector pCXUN-Cas9 (see Chinese patent application CN201610639854.3) was a kind gift from Professor Wang Rongchen. To amplify the guide RNA expression cassette specifically targeting the miR528 coding sequence, we used the OsU3-sgRNA plasmid (see Chinese patent application CN201810059520.8) as a template, using forward primer U3-F (SEQ ID NO:14) and reverse primer HX8366 (SEQ ID NO:15) to amplify the first half of the guide RNA expression cassette; forward primer HX8365 (SEQ ID NO:16) and reverse primer U3-R (SEQ ID NO:17) to amplify the second half of the guide RNA expression cassette. These two fragments were ligated into the pCXUN-Cas9 KpnI restriction site via homologous recombination to construct a CRISPR / Cas9 vector specifically targeting the miR528 coding sequence.

[0078] The PCR system during vector modification was as follows: plasmid template 10 ng, forward primer (10 μM) 2 μl, reverse primer (10 μM) 2 μl, 2× Phanta Max Buffer 25 μl, dNTP Mix (10 mM each) 1 μl, Phanta Max Super-Fidelity DNA Polymerase (1 U / μl) (Nanjing Novozymes Biotech Co., Ltd., P505-d1) 1 μl, and ddH2O was added to make up to 50 μl.

[0079] The PCR reaction program was as follows: 94°C for 2 min; (94°C for 30 s, 58°C for 30 s, 72°C for 30 s) × 32 cycles; 72°C for 10 min, hold at 16°C.

[0080] The enzyme digestion system was as follows: 5 μl of 10× CutSmart Buffer, 1 μl of restriction endonuclease (KpnI, 4 U / μl), 1 μg of pCXUN-Cas9 plasmid, filled to 50 μl with ddH2O, and digested at 37°C for at least 8 hours.

[0081] Example 9: Identification of miR528 CRISPR / Cas9 gene editing in switchgrass and chinensis

[0082] The miR528 CRISPR / Cas9 vector constructed in Example 8 was transformed into Panicum virgatum and Leymus chinensis calli using the Agrobacterium-mediated callus infection system. The genotype of the obtained transgenic regenerated plants was identified. Forward primer CP1102 (SEQ ID NO: 18) and reverse primer CP1103 (SEQ ID NO: 19) were used to identify Panicum virgatum miR528 copy 1 (chr01N: 33956382-33956402 in Figure 8); forward primer CF8647 (SEQ ID NO: 20) and reverse primer CF8648 (SEQ ID NO: 21) were used to identify Panicum virgatum miR528 copy 2 (chr01N: 44585338-44585358 in Figure 8); forward primer CF8639 (SEQ ID NO: 22) and reverse primer CF8640 (SEQ ID NO: 23) were used to identify Panicum virgatum miR528 copy 2 (chr01N: 44585338-44585358 in Figure 8). 8 chr09K: 69181090-69181070 in FIG8 ); forward primer CF8641 (SEQ ID NO: 24) and reverse primer CF8642 (SEQ ID NO: 25) were used to identify miR528 copy 4 in switchgrass (chr09N: 80434960-80434940 in FIG8 ). Forward primer CP4085 (SEQ ID NO: 26) and reverse primer CF4086 (SEQ ID NO: 27) were used to identify miR528 copy 1 in chinensis; forward primer CP4089 (SEQ ID NO: 28) and reverse primer CF4090 (SEQ ID NO: 29) were used to identify miR528 copy 2 in chinensis. PCR products were sequenced to identify the editing type of each regenerated plant.

[0083] The PCR system was as follows: 50 ng of genomic DNA, 0.8 μl of forward primer (10 μM), 0.8 μl of reverse primer (10 μM), 10 μl of 2× Phanta Max Buffer, 0.4 μl of dNTP Mix (10 mM each), 0.4 μl of Phanta Max Super-Fidelity DNA Polymerase (1 U μl) (Nanjing Novozymes Biotech Co., Ltd., P505-d1), and ddH2O was added to make up to 20 μl.

[0084] The PCR reaction program was as follows: 94°C for 2 min; (94°C for 30 s, 58°C for 30 s, 72°C for 30 s) × 35 cycles; 72°C for 10 min, hold at 16°C.

[0085] The sequencing results were aligned with the reference genome sequence. The results of miR528 sequence editing detection in Panicum virgatum and Leymus chinensis are shown in Figures 8 and 9, respectively. In Figure 8, crispr-49, crispr-50, crispr-51, and crispr-54 indicate different transgenic Panicum virgatum regenerated plants, while in Figure 9, Leymus chinensis miR528 CR-1, Leymus chinensis miR528 CR-2, Leymus chinensis miR528 CR-6, and Leymus chinensis miR528 CR-7 indicate different transgenic Leymus chinensis regenerated plants. Thus, we used CRISPR / Cas9 technology to generate transgenic Panicum virgatum and Leymus chinensis regenerated plants with altered miR528 sequences.

[0086] Example 10: Identification of the Regeneration Ability of Panicum virgatum and Leymus chinensis Edited by miR528 CRISPR / Cas9

[0087] The top parts of 4-month-old transgenic switchgrass seedlings with miR528 knockout cultured in vermiculite nutrient soil were uniformly mowed to leave only 15 cm long stems on the aboveground part of the plants. Each plant was divided into equal sizes from the root part and replanted in vermiculite nutrient soil for culture. The new tillering phenotype was observed after one and two weeks, respectively.

[0088] As shown in FIG10 , the transgenic switchgrass with miR528 knockout exhibited a faster sprouting rate, indicating that the transgenic switchgrass with miR528 knockout had a stronger ability to regenerate after mowing.

[0089] A single tiller of 6-month-old transgenic miR528-knockout Leymus chinensis grown in nutrient soil was retained and planted in new vermiculite nutrient soil. The phenotype of the new tillers was observed after one and two months, respectively.

[0090] As shown in Figure 11, the transgenic Leymus chinensis with miR528 knockout had stronger regeneration ability and more tillers, indicating that miR528 knockout can improve the regeneration and tillering ability of Leymus chinensis.

[0091] The embodiments described herein are for illustration only (as examples), and various modifications or changes made by technicians should also be included in the essential scope of the patent application.

[0092] Industrial Applicability

[0093] The present invention provides the application of miR528 in the production and breeding of gramineous forage grasses. By downregulating the expression and / or function of miR528 in gramineous forage grasses, the tiller number and regeneration ability of gramineous forage grasses can be significantly increased, thereby facilitating the production and breeding of gramineous forage grasses and being suitable for industrial applications.

Claims

1. A method for enhancing the tillering ability and / or regeneration ability of a grass, comprising downregulating the expression and / or function of miR528 in the grass.

2. The method according to claim 1, wherein the downregulation of miR528 expression is performed by gene knockout or gene editing of the miR528 encoding gene MIR528.

3. The method according to claim 2, wherein the gene editing is to edit the gene of the transcription region, and / or its upstream regulatory region, and / or its downstream regulatory region of the coding gene MIR528.

4. The method according to claim 2 or 3, wherein the gene editing is performed by the CRISPR / Cas9 system.

5. The method according to claim 1, wherein the function of miR528 is downregulated by expressing artificial mimic target sequences and / or short tandem mimic targets in grasses that can be recognized by miR528, interact with miR528 and are not cut by miR528.

6. The method according to claim 5, wherein a vector expressing the artificial simulated target sequence and / or short tandem simulated target is introduced into the grass, wherein the vector constitutively expresses the artificial simulated target sequence and / or short tandem simulated target.

7. The method according to claim 5 or 6, wherein the artificial mimic target sequence comprises or consists of the nucleotide sequence shown in SEQ ID NO:

1.

8. The method according to claim 5 or 6, wherein the short tandem analog target comprises or consists of the nucleotide sequence shown in SEQ ID NO:

3.

9. The method of any one of claims 1 to 8, wherein the grasses include switchgrass (Panicum virgatum), Leymus chinensis, Brachypodium distachyon, Miscanthus, Elytrigia intermedia, Uraria crinita, Setaria viridis, Anastatica, Elymus sibiricus, Panicum miliaceum, and Bromus inermis.

10. A method for breeding a new grass line with enhanced tillering ability and / or regeneration ability, comprising down-regulating the expression and / or function of miR528 in the new grass line.

11. An artificial mimic target sequence, comprising or consisting of the nucleotide sequence shown in SEQ ID NO:

1.

12. A short tandem mimetic target comprising or consisting of the nucleotide sequence shown in SEQ ID NO: 3.

Images