Rapid quantitative detection kit for mycoplasma pneumoniae based on nucleic acid-free extraction and application of rapid quantitative detection kit
By combining chemical-physical lysis and hydrogel confinement technology, Mycoplasma pneumoniae DNA is directly released from pharyngeal swab samples. Combined with loop-mediated isothermal amplification, this method solves the problem of cumbersome nucleic acid extraction steps in existing technologies, and achieves rapid, accurate, and absolute quantitative detection, which is suitable for primary healthcare institutions and on-site testing.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-30
- Publication Date
- 2026-04-14
AI Technical Summary
Existing technologies for detecting Mycoplasma pneumoniae suffer from cumbersome nucleic acid extraction steps, long processing time, high cost, and strong equipment dependence, making them difficult to promote in primary healthcare institutions and on-site rapid testing. Furthermore, existing nucleic acid extraction-free methods lack sufficient sensitivity and absolute quantitative capabilities.
A chemical-physical combined lysis system was used to directly release Mycoplasma pneumoniae DNA from pharyngeal swab samples. By combining loop-mediated isothermal amplification and hydrogel confinement technology, a simplified detection method was constructed. A three-dimensional PEG network was used to confine macromolecular inhibitors to achieve absolute quantitative detection.
It enables rapid and accurate absolute quantitative detection of Mycoplasma pneumoniae without the need for nucleic acid extraction, simplifies the sample pretreatment process, reduces equipment and time costs, and is suitable for primary healthcare institutions and on-site point-of-care testing.
Smart Images

Figure CN121852364A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of nucleic acid detection technology, specifically to a rapid quantitative detection kit for Mycoplasma pneumoniae based on nucleic acid extraction-free assay and its application. Background Technology
[0002] Mycoplasmal pneumonia (MPP) is a lower respiratory tract infection caused by Mycoplasma pneumoniae, commonly affecting children and young adults. Typical clinical manifestations include progressive headache, muscle aches, sore throat, and respiratory symptoms primarily characterized by a dry cough. Peripheral white blood cell counts are often normal or slightly elevated. While these manifestations are somewhat characteristic, they overlap with various respiratory viral or bacterial infections. Clinical symptoms and routine laboratory indicators are often insufficient for etiological classification; therefore, accurate etiological diagnosis largely depends on specific laboratory tests.
[0003] Currently, the main methods used in clinical laboratory diagnosis of mycoplasma pneumoniae include serological testing, pathogen culture, and nucleic acid amplification. Serological testing detects specific IgM antibodies to indicate recent or acute infection. IgM antibodies typically appear about one week after infection, peaking at 3-4 weeks. This method is relatively simple to perform, but it has a "window period" in the early stages of infection, resulting in low sensitivity, a high likelihood of false negatives, and difficulty in distinguishing between acute and past infections. Pathogen culture can provide live bacteria for drug susceptibility testing, but Mycoplasma pneumoniae grows slowly, requires stringent culture conditions, is time-consuming, and has a limited positive rate, making it unsuitable for routine rapid diagnosis. Since its introduction into the diagnosis of mycoplasma pneumoniae in the late 1980s, nucleic acid amplification technology has been widely used due to its high sensitivity and specificity. Among these, real-time quantitative PCR (qPCR) has become an important tool for clinical nucleic acid detection.
[0004] However, qPCR typically requires the centralized collection of clinical samples such as throat swabs, which are then transported to a laboratory for nucleic acid extraction and purification before amplification and analysis on specialized instruments. This multi-step process relies on centrifuges, nucleic acid extraction kits, and large-scale quantitative PCR instruments, resulting in long sample turnaround times, complex operations, and high costs, making it difficult to promote in primary healthcare institutions or on-site rapid testing scenarios. Furthermore, qPCR uses Ct values as readings, usually requiring the establishment of standard curves for relative quantification, making it difficult to directly obtain the absolute copy number of pathogens. With the development of digital nucleic acid detection technology, digital PCR based on microfluidic chips or droplet systems can achieve absolute quantification at the single-molecule level; however, these systems are usually complex in structure, expensive, and require highly skilled operators, limiting their application in routine clinical and point-of-care testing (POCT).
[0005] Loop-mediated isothermal amplification (LAMP) is a nucleic acid amplification method performed under isothermal conditions, eliminating the need for complex thermal cycling equipment and making it suitable for resource-constrained environments and on-site testing. While LAMP detection for Mycoplasma pneumoniae has been reported, most protocols still rely on conventional nucleic acid extraction steps or require pretreatment to remove inhibition in complex matrix samples. In recent years, hydrogels have been widely used in nucleic acid amplification due to their excellent biocompatibility and three-dimensional nanoporous structure. Amplification using hydrogels can confine the amplification products around the template, enabling absolute quantitative analysis of DNA. Furthermore, the confined environment and crowding effect of the pores in hydrogels can enhance polymerase activity, accelerating enzyme-catalyzed reactions and offering the potential for rapid and convenient nucleic acid detection.
[0006] On the other hand, current clinical mycoplasma pneumoniae nucleic acid testing generally requires a separate sample pretreatment process, such as nucleic acid extraction and purification via silica gel column or magnetic beads after lysis. This not only increases time and labor costs but also increases reliance on reagents, consumables, and equipment, hindering its promotion at the grassroots level or bedside. To simplify the process, some studies have attempted to adopt a "nucleic acid extraction-free" strategy, directly introducing chemically lysed samples into the amplification system. However, existing lysis systems often contain high concentrations of surfactants, denaturants, or strong bases. These components, when retained in the reaction system, can easily inhibit the activity of DNA polymerase or reverse transcriptase, leading to decreased sensitivity or amplification failure. Therefore, most extraction-free methods are still primarily qualitative or semi-quantitative, making it difficult to balance speed, sensitivity, and absolute quantification. Furthermore, existing hydrogel-based digital nucleic acid amplification methods are mostly designed for extracted and purified nucleic acid templates, and still suffer from insufficient compatibility with direct clinical samples (such as throat swab lysis products), limited tolerance to inhibitors in complex matrices, and an overall operational procedure that is not simplified enough.
[0007] In summary, existing technologies for Mycoplasma pneumoniae detection still have the following requirements: while ensuring detection sensitivity and specificity, further reduce or omit sample pretreatment steps such as nucleic acid extraction, and construct a simple, rapid, and cost-controllable detection kit and method that can directly perform isothermal amplification from pharyngeal swab lysis products and achieve absolute quantification by combining hydrogel confinement, thus making it more suitable for primary healthcare institutions and point-of-care testing scenarios. Summary of the Invention
[0008] The purpose of this invention is to provide a test kit and its usage method that can achieve rapid, accurate and absolute quantitative detection of Mycoplasma pneumoniae directly from pharyngeal swab samples without the need for nucleic acid extraction. It is suitable for resource-limited scenarios such as primary laboratories and point-of-care testing (POCT).
[0009] To achieve the above objectives, the present invention adopts the following technical solution: This invention provides a rapid quantitative detection kit for Mycoplasma pneumoniae without nucleic acid extraction. The kit includes a lysis buffer for releasing Mycoplasma pneumoniae DNA from a sample without nucleic acid extraction, a loop-mediated isothermal amplification reaction premix, a hydrogel monomer, and a planar reaction chamber for forming a hydrogel reaction layer. The lysis buffer comprises: 20-100 mM tris(hydroxymethyl)aminomethane hydrochloride, 5-30 mM disodium ethylenediaminetetraacetate, 0.5%-2% sodium dodecyl sulfate, 0.5%-2% sodium hydroxide, 0.5%-2% Triton X-100, and 0.2%-0.6% octyl glucoside.
[0010] This invention proposes a sample pretreatment strategy that eliminates the traditional nucleic acid extraction step, constructing a chemical-physical combined lysis system highly compatible with hydrogel LAMP reactions. The lysis buffer provided by this invention is used to pretreat nucleic acid samples such as throat swabs, and the resulting lysis buffer is directly used as a template for the hydrogel LAMP reaction. Specifically, incubation with the throat swab sample at room temperature for 3-5 minutes is sufficient to fully lyse cells and pathogens, releasing Mycoplasma pneumoniae DNA.
[0011] Compared with commercially available lysis buffers, the lysis buffer provided by this invention has no significant inhibitory effect on loop-mediated isothermal amplification. In terms of quantitative detection performance, the sample pretreatment method provided by this invention is not significantly different from that of traditional nucleic acid extraction samples, and the time thresholds for hydrogel loop-mediated isothermal amplification are nearly identical, indicating that omitting the DNA purification step has no substantial impact on amplification kinetics.
[0012] The method of pretreatment of nucleic acid pharyngeal swab samples using the lysis buffer provided by this invention simplifies the detection process without affecting downstream nucleic acid detection, and can replace the traditional nucleic acid extraction step.
[0013] Preferably, the lysis buffer is composed of the following components at the following final concentrations: 40 mM tris(hydroxymethyl)aminomethane hydrochloride, 15 mM disodium ethylenediaminetetraacetate, 1% sodium dodecyl sulfate (by weight / volume), 0.8% sodium hydroxide (by weight / volume), 1% Triton X-100 (by volume), and 0.4% octyl glucoside (by weight / volume).
[0014] Preferably, the kit also includes zirconia beads for physical grinding during the pyrolysis process, the zirconia beads having a diameter of 2 mm and a volume ratio of zirconia beads to pyrolysis solution of 1:10.
[0015] Furthermore, this invention provides a specific primer set for detecting Mycoplasma pneumoniae using loop-mediated isothermal amplification (LAMP) reaction. Specifically, the LAMP premix contains outer primers F3 and B3, inner primers FIP and BIP, and loop primers LF and LB for specifically amplifying the target sequence of Mycoplasma pneumoniae. The primer sequences are as follows: F3: GAGACTTGAACTTCACG (SEQ ID NO.1); B3: CAGTTACCAAGCACG (SEQ ID NO.2); FIP: GTACGCACCCCACTCGCTTTGTGGACCAGTGTCA (SEQ ID NO.3). BIP: AGAAAGTCGACCAACCCCCCCTCCACCAACAACCT (SEQ ID NO. 4); LF: CAGGAAGGGGTAGATTGTCA (SEQ ID NO. 5); LB: CATCATTCCCCGTATTAGTATTA (SEQ ID NO. 6).
[0016] This primer set targets the conserved P1 region of the Mycoplasma pneumoniae genome. In an optimized LAMP reaction system, it generates amplification signals only for Mycoplasma pneumoniae nucleic acids, without specifically amplifying nucleic acids of other common respiratory pathogens (such as respiratory syncytial virus, influenza virus, adenovirus, rhinovirus, etc.), demonstrating high specificity. The amplification results show good reproducibility and batch-to-batch consistency under different target DNA concentrations.
[0017] Preferably, in the hydrogel reaction system, the concentrations of FIP and BIP are both 0.2~1.6 μM, the concentrations of F3 and B3 are both 0.1~0.3 μM, and the concentrations of LF and LB are both 0.2~0.8 μM.
[0018] More preferably, in the hydrogel reaction system, the final concentrations of FIP and BIP are both 0.928 μM, the final concentrations of F3 and B3 are both 0.116 μM, and the final concentrations of LF and LB are both 0.232 μM.
[0019] Furthermore, the loop-mediated isothermal amplification reaction premix also contains a LAMP mixture and a fluorescent dye; the LAMP mixture contains a reaction buffer, DNA polymerase, dNTPs, etc. The fluorescent dye is used to label the nucleic acid amplification products. Preferably, the fluorescent dye is SYBR Green I.
[0020] Preferably, the final concentration of the fluorescent dye SYBR Green I in the hydrogel reaction system is 0.2~1.0 μM. More preferably, the final concentration of the fluorescent dye SYBR Green I is 0.5 μM.
[0021] In this invention, the three-dimensional confined reaction space of a hydrogel is used to achieve in situ amplification of Mycoplasma pneumoniae DNA. Preferably, the hydrogel monomer in this invention is a polyethylene glycol-based four-arm structure, including four-arm polyethylene glycol-vinyl sulfone (4-Arm-PEG-VS) and four-arm polyethylene glycol-thiol (4-Arm-PEG-SH), which are rapidly crosslinked into a gel in aqueous solution within 3-5 min at room temperature via Michael addition reaction.
[0022] Preferably, 4-Arm-PEG-VS has a molecular weight of 5 kDa and a mass concentration of 0.016–0.032 mg / μL in the hydrogel reaction system; 4-Arm-PEG-SH has a molecular weight of 2 kDa and a mercapto / vinyl molar ratio of 0.8–1.2:1 between the four-arm-polyethylene glycol-vinyl sulfone and the four-arm-polyethylene glycol-mercapto group in the hydrogel reaction system.
[0023] The three-dimensional PEG network formed under these conditions has an average pore size of less than 200 nm, which allows macromolecular inhibitors such as mucin and cell debris in the pharyngeal swab sample to be preferentially confined to the outer layer of the hydrogel or the pore interface, while LAMP reaction components and Mycoplasma pneumoniae DNA can diffuse freely inside the network, thereby improving the isothermal amplification tolerance in complex pharyngeal swab matrices.
[0024] More preferably, in the hydrogel reaction system, the molar ratio of thiol / vinyl groups of the four-arm-polyethylene glycol-vinyl sulfone to the four-arm-polyethylene glycol-thiol group is 1:1. Specifically, the mass concentration of 4-Arm-PEG-VS is 0.016 mg / μL, and the mass concentration of 4-Arm-PEG-SH is 0.0064 mg / μL.
[0025] In this invention, the planar reaction chamber has a tank for forming a hydrogel reaction layer. A ring-mediated isothermal amplification reaction mixture containing hydrogel monomers is introduced into the tank of the planar reaction chamber and allowed to stand at room temperature to form a hydrogel reaction layer of a certain thickness. Preferably, the thickness of the tank is 250-280 μm. Controlling the thickness of the hydrogel reaction layer to 250-280 μm facilitates subsequent monolayer fluorescence imaging.
[0026] Specifically, the planar reaction chamber uses a frame-seal culture chamber.
[0027] In this invention, the kit also includes a positive control and a negative control.
[0028] The present invention also provides a method for using the kit, comprising the following steps: (1) Insert the pharyngeal swab sampling head into the lysis tube containing lysis buffer, and shake or vortex at room temperature for 3-5 minutes to obtain lysed nucleic acid samples; (2) Take the lysed nucleic acid sample and add it to the mixture containing hydrogel monomer and premixed solution at a volume ratio of 1:1 to 1:2. After mixing, inject it into the planar reaction chamber to form a hydrogel reaction layer. (3) The planar reaction chamber was incubated at a constant temperature of 65°C for 15 min to allow the Mycoplasma pneumoniae DNA to undergo a loop-mediated isothermal amplification reaction in the hydrogel and generate a fluorescent signal. (4) A fluorescence imaging device was used to acquire fluorescence images of the hydrogel reaction layer, the fluorescence amplification spots were counted, and the absolute molecular concentration of Mycoplasma pneumoniae DNA in the sample to be tested was calculated based on the Poisson distribution model.
[0029] During amplification, the Mycoplasma pneumoniae DNA template and LAMP reaction components are distributed within the nanopores of the hydrogel. The amplification products are confined to their respective local microregions, where they bind with fluorescent dyes to form discrete fluorescent amplification spots. Each fluorescent spot corresponds to a single or a limited number of template molecules, thus enabling absolute quantification of the target nucleic acid through fluorescence imaging and spot count.
[0030] In practice, a portable blue light source can be used to excite the fluorescence signal in the hydrogel, and a smartphone or other image acquisition and recognition device can be used to image the hydrogel reaction layer. The fluorescent amplification spots can be automatically identified and counted using a preset image analysis program, and the absolute molecular concentration of Mycoplasma pneumoniae DNA in the sample can be calculated using a Poisson distribution model.
[0031] Specifically, the fluorescence imaging device is a portable imaging module connected to a mobile terminal, which is pre-installed with analysis software for automatically identifying and counting fluorescent amplification spots and outputting Mycoplasma pneumoniae DNA concentration results.
[0032] The entire testing process, from sample lysis to result readout, can be completed within tens of minutes, with a total time of no more than 30 minutes. The required equipment is simple, making it suitable for applications such as primary healthcare institutions, fever clinics, and on-site emergency testing. Furthermore, the absolute value of the logarithmic concentration deviation between the obtained results and those obtained using conventional nucleic acid extraction combined with real-time fluorescence PCR does not exceed 0.378.
[0033] Compared with the prior art, the present invention has the following beneficial effects: (1) The lysis system constructed in this invention can efficiently lyse pharyngeal swab samples and release Mycoplasma pneumoniae DNA at room temperature in a short time through the synergistic effect of Tris-EDTA buffer, high alkaline conditions, and anionic / nonionic surfactants (SDS, Triton X-100, and glucosinolates). At the same time, it has a small inhibitory effect on the LAMP reaction, and the lysis products can be directly introduced into the amplification system without additional nucleic acid extraction and purification steps, which significantly simplifies the sample pretreatment process and shortens the total detection time.
[0034] (2) The primer set provided by the present invention for loop-mediated isothermal amplification reaction has high specificity for identifying Mycoplasma pneumoniae and cannot amplify the nucleic acids of other common respiratory pathogens (including respiratory syncytial virus, influenza virus, adenovirus and rhinovirus); and has good repeatability when detecting different concentrations of targets.
[0035] (3) This invention utilizes PEG four-arm monomers with specific ratios and molecular weights to construct a three-dimensional hydrogel network with controllable thickness and nanoscale pore size in a planar reaction chamber. On the one hand, it generates spatial repulsion or buffering effect on macromolecular impurities and inhibitors, improving the tolerance of the amplification system to complex clinical matrices. On the other hand, it divides the reaction system into a large number of independent microreaction units, realizing the "digitalization" of the LAMP reaction. The absolute copy number of Mycoplasma pneumoniae DNA can be obtained by counting fluorescent dots, with high quantitative accuracy.
[0036] (4) The hydrogel LAMP detection kit based on nucleic acid extraction-free proposed in this invention integrates sample lysis, isothermal amplification, hydrogel confinement and fluorescence imaging. It has fewer operation steps, does not require large and precision instruments, supports the use of portable light sources and smart terminals for result interpretation, significantly shortens the detection time, and has detection performance close to the level of traditional nucleic acid extraction combined with qPCR or digital PCR. It has the advantages of speed, sensitivity and practicality, which is conducive to its application in POCT and resource-limited areas. It is of great significance for guiding the precise medication and public health prevention and control of Mycoplasma pneumoniae infection. Attached Figure Description
[0037] Figure 1 The performance of LAMP primers for four groups of Mycoplasma pneumoniae was evaluated.
[0038] Figure 2The performance evaluation of the self-made lysis buffer provided by this invention is as follows: (a) compares the compatibility of the lysis buffer provided by this invention and commercially available lysis buffers in the Mycoplasma pneumoniae hydrogel counting system reaction; (b) shows the effects of proteinase K and guanidine salt on the Mycoplasma pneumoniae hydrogel counting system reaction; (c) compares the hydrogel counting system detection results of lysed samples obtained with the lysis buffer provided by this invention and corresponding DNA extracted samples; and (d) compares the real-time loop-mediated isothermal amplification kinetics of lysed samples obtained with the lysis buffer provided by this invention and corresponding DNA extracted samples.
[0039] Figure 3 A schematic diagram illustrating the workflow and principle of rapid quantitative detection of Mycoplasma pneumoniae without nucleic acid extraction.
[0040] Figure 4 To optimize the reaction temperature (a), reaction time (b), SYBR GreenI dye concentration (c), and hydrogel concentration (d) of the Mycoplasma pneumoniae hydrogel counting system.
[0041] Figure 5 This study evaluates the quantitative detection capability of a hydrogel counting system for Mycoplasma pneumoniae. (a) shows the relative quantification of Mycoplasma pneumoniae samples using qPCR, serving as a reference for quantification using the hydrogel counting system; (b) shows the standard curve for Mycoplasma pneumoniae detection using the hydrogel counting system, correlating the endpoint fluorescence amplification point count with the qPCR reference concentration; and (c) shows the fluorescence image of the hydrogel at the endpoint of the hydrogel counting system, demonstrating the detection results for a series of diluted samples. Error bars represent the standard deviation of three experiments.
[0042] Figure 6 To verify the specificity of the rapid quantitative detection method for Mycoplasma pneumoniae without nucleic acid extraction.
[0043] Figure 7 To evaluate the reproducibility of a rapid quantitative detection method for Mycoplasma pneumoniae without nucleic acid extraction.
[0044] Figure 8 This study analyzes the clinical performance and quantitative consistency of a rapid quantitative detection method for Mycoplasma pneumoniae without nucleic acid extraction. (a) compares the detection results of this method with clinical diagnostic results, presented as a confusion matrix heatmap; (b) shows the Bland-Altman consistency analysis between this method and traditional qPCR Ct values. Detailed Implementation
[0045] To clarify the objectives, overall process, and application scheme of this invention, the following description further details the invention to provide a better understanding, but it is not intended to limit the scope of the invention. Any substitutions or modifications made by those skilled in the art to this system and process, which still fall within the spirit and scope of this invention, should be included within the protection scope of this invention.
[0046] The following instructions all use standard reagents for preparation and use. The accuracy of the results of the Mycoplasma pneumoniae hydrogel counting system is determined by comparing the count of the hydrogel system of the Mycoplasma pneumoniae pharyngeal swab sample lysis solution with the theoretical concentration.
[0047] In the examples described below, the 2×LAMP mixture was purchased from New England Biolab, and SYBR Green I was purchased from Thermo Fisher Scientific. Four-arm polyethylene glycol-vinyl sulfone (4-Arm-PEG-VS, 5 kDa) and four-arm polyethylene glycol-thiol (4-Arm-PEG-SH, 2 kDa) were purchased from Laysan Bio. The Mycoplasma pneumoniae real-time fluorescence PCR kit was purchased from Liferiver. LAMP primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. DNA extracts of Mycoplasma pneumoniae (MP), respiratory syncytial virus (RSV), influenza A / B virus (IV), adenovirus (Adv), and rhinovirus (RV) were provided by Hangzhou KingMed Diagnostics Laboratory. All other reagents were purchased from Sinopharm Chemical Reagent Co., Ltd.
[0048] In this invention, the nucleotide sequence is written from left to right in the direction from 5' to 3'.
[0049] Example 1: Primer Design and Performance Evaluation I. Primer Design The conserved gene P1 sequence of Mycoplasma pneumoniae was retrieved from the NCBI database (GenBank accession number LC388569.1:3996-4903). Four sets of LAMP primers were designed using Primer Explorer V5. The primer sequence information is as follows: MP-1 F3: GAGACTTGAACTTCACG; B3: CAGTTACCAAGCACG; FIP: GTACGCACCCACTCGCTTTGTGGACCAGTGTCA; BIP: AGAAAGTCGACCAACCCCCCTCCACCAACAACCT; LF: CAGGAAGGGGTAGATTGTCA; LB: CATCATTCCCCGTATTAGTATTA.
[0050] MP-2 F3: TCAGCTGTTTGTCCTTC; B3: GGGCAGTTACCAAGC; FIP:TTTCTGAAAGCAACGCCGCTGGGGTGCGTACAATAC; BIP: ACCAACCCCCACCACATCGTGACGGAACACCTCC; LF: TTGTAGCAGTAAGTAGA; LB:CCCGTATTAGTATTAGGCGCGAGGTTGTT.
[0051] MP-3 F3: GGCTTTGGTGGTACTG; B3: GAATCCCAATGCACAAG; FIP: AGGTATCAGTCAAGCGCCAAGGGTGCTCCTGGTT; BIP: ACACTACCAACCGCTTTGGTGGCTGGGTTTGCGCTA; LF: GTGACCAAACAAAGTTCGC; LB: ACACATCAACCTTTTGGT.
[0052] MP-4 F3: CGCTTTGGTCAACACAT; B3: TTACCACTGTTAACGGC; FIP:ACTTGCCATTGGAATCCCAGGTTTGATAGCGCAAACC; BIP: TACAGTGATCGCTAACGGCTTCCAGTCAAGGTCCC; LF: GTTCCGGACAAACAAGAACAC; LB: GGTCACTGGTTAAACGGACTAAA.
[0053] II. Primer Performance Evaluation The amplification efficiencies of the primer sets designed above were compared. Primer performance was evaluated based on the peak time of the fluorescence curves of positive samples and the quantitative results of the hydrogel system.
[0054] Hydrogel amplification system (total system 25 μL): 1×LAMP reagent mix (commercially available), 1×SYBR Green I, 0.928 μM FIB and BIP, 0.116 μM F3 and B3, 0.232 μM LF and LB, a certain amount of Mycoplasma pneumoniae DNA sample, hydrogel monomer and enzyme-free water.
[0055] The hydrogel is composed of two monomers: a tetra-armed polyethylene glycol-vinyl sulfone with a molecular weight of 5 kDa and a tetra-armed polyethylene glycol-thiol with a molecular weight of 2 kDa. Stock solutions of 4-Arm-PEG-AC (16 mg / 50 μL) and SH-PEG-SH (6.4 mg / 50 μL) were prepared, and 1.25 μL of each solution was added to a 25 μL total reaction system to obtain a hydrogel concentration of 5%.
[0056] The above reaction mixture was injected into a planar reaction chamber, coated evenly, and covered with a layer of polyester film to seal the system. After 5 minutes, the mixture was allowed to crosslink and form a hydrogel.
[0057] For real-time quantitative PCR, the sample was heated at 65°C for 40 min, and fluorescence detection was performed at each amplification stage using a real-time quantitative PCR instrument (Applied Biosystems™, USA).
[0058] For quantitative experiments on hydrogel microfluidic chips, the chips were heated at a constant temperature of 65℃ for 15 min and observed and analyzed using a fluorescence microscope or other portable excitation light source.
[0059] The results show that ( Figure 1 Primer set 1 exhibited the shortest fluorescence peak time and the highest number of fluorescent spots counted on the hydrogel, demonstrating superior amplification efficiency compared to the other three primer sets. Therefore, this primer set was selected for subsequent experiments.
[0060] Example 2: Performance Evaluation of the Lysis Buffer 1. The formulation of the lysis buffer is as follows: The self-made lysis buffer consisted of: 40 mM Tris-HCl, 15 mM EDTA-Na2, 1% (w / v) sodium dodecyl sulfate (SDS), 0.8% (w / v) sodium hydroxide (NaOH), 1% (w / v) Triton X-100, and 0.4% (w / v) octyl glucoside; supplemented with 2 mm zirconia beads at a volume ratio of 1:10 for physical grinding.
[0061] Commercially available lysis buffer composition: 2 M guanidine isothiocyanate, 1% surfactant (w / v), 20 mM EDTA, 5 mM DTT, and 0.5 mg / mL proteinase K.
[0062] 2. The performance of the self-made lysis buffer was evaluated as follows: a. The same Mycoplasma pneumoniae DNA extract was diluted with a self-made lysis buffer and a commercially available lysis buffer, while ddH2O was used as a control. Each dilution was used as a template for hydrogel counting. The preparation of the loop-mediated isothermal amplification hydrogel system, isothermal amplification, and observation and counting of fluorescent amplification points were the same as in Example 1.
[0063] The results show that ( Figure 2 a) Only the homemade lysis buffer does not inhibit amplification, possibly because commercially available lysis buffers contain denaturants or high salt ions, which interfere with polymerase activity.
[0064] b. To investigate which component affects the compatibility of the lysis buffer with downstream amplification, we added 2 M guanidine isothiocyanate and 0.5 mg / mL proteinase K to the above-mentioned self-made lysis buffer components to obtain lysis buffer B and lysis buffer C. The above-mentioned self-made lysis buffer is lysis buffer A. These three lysis buffers were used as DNA diluents, and each diluent was used as a template for hydrogel counting. The preparation of the loop-mediated isothermal amplification hydrogel system, isothermal amplification, and observation and counting of fluorescent amplification points were the same as in Example 1.
[0065] The results show that ( Figure 2 (b) High concentrations of guanidine salt and proteinase K inhibit loop-mediated isothermal amplification, so these two components are removed.
[0066] c. Hydrogel counting analysis was performed on pharyngeal swab samples treated with self-made lysis buffer (samples were obtained from the Children's Hospital Affiliated to Zhejiang University School of Medicine and approved by the Ethics Committee of the Children's Hospital Affiliated to Zhejiang University School of Medicine (approval number: 2023-IRB-0243-P-01)) and corresponding DNA extraction samples.
[0067] Preparation of pharyngeal swab samples treated with self-made lysis buffer: After pharyngeal swab samples are collected, they are inserted into lysis tubes containing lysis buffer and zirconium oxide beads, capped and vortexed for 3-5 minutes to ensure complete lysis of pathogens. The resulting lysis buffer is used directly as an amplification template.
[0068] The DNA samples were extracted using an automated nucleic acid extractor (Guangzhou Guorui) via magnetic bead extraction. The extraction steps included sample lysis, nucleic acid binding, magnetic field separation and washing, and nucleic acid elution. This extraction process took approximately 20 minutes. In this embodiment, 200 μL of the same pharyngeal swab sample treated with a self-made lysis buffer was used for DNA extraction, yielding 80 μL of extract (indicating that the nucleic acid concentration was concentrated 2.5 times compared to the original sample).
[0069] The preparation of the loop-mediated isothermal amplification hydrogel system, the isothermal amplification, and the observation and counting of fluorescent amplification points were the same as in Example 1.
[0070] The results show that ( Figure 2 c) The lack of significant difference between the two methods suggests that nucleic acid loss during conventional DNA extraction may lead to slight biases in downstream quantification results. In contrast, the direct lysis method better preserves the target nucleic acid and achieves efficient lysis.
[0071] d. Repeat step c to prepare the same system and perform loop-mediated isothermal amplification using an ABI StepOne real-time PCR system (Thermo Fisher Scientific, USA), while recording fluorescence signals. The amplification program consisted of 40 cycles at 65 °C, each lasting 60 seconds, with fluorescence signals collected from the SYBR channel at minute intervals.
[0072] Further analysis shows that ( Figure 2 d) The threshold times for the two sample pretreatment methods were almost the same, indicating that omitting the DNA purification step under optimized conditions had no substantial impact on amplification kinetics.
[0073] Example 3: Construction of a rapid detection kit for Mycoplasma pneumoniae This embodiment uses the primer set obtained from Example 1 and the self-made lysis buffer from Example 2 to construct a kit system for detecting Mycoplasma pneumoniae. The kit includes lysis buffer, detection premix, hydrogel monomer, positive control, negative control, and planar reaction chamber.
[0074] The lysis buffer consisted of 40 mM Tris-HCl, 15 mM EDTA-Na2, 1% (w / v) sodium dodecyl sulfate (SDS), 0.8% (w / v) sodium hydroxide (NaOH), 1% (w / v) Triton X-100, and 0.4% (w / v) octyl glucoside; supplemented with 2 mm zirconia beads at a volume ratio of 1:10 for physical grinding.
[0075] The composition of the detection premix was: 1×LAMP mixed reagent, 1×SYBR Green I, 0.928 μM FIB and BIP, 0.116 μM F3 and B3, 0.232 μM LF and LB and enzyme-free water.
[0076] The hydrogel monomers were four-armed polyethylene glycol-vinyl sulfone (4-Arm-PEG-VS) with a molecular weight of 5 kDa and four-armed polyethylene glycol-thiol (4-Arm-PEG-SH) with a molecular weight of 2 kDa. Stock solutions of 4-Arm-PEG-VS (16 mg / 50 μL) and 4-Arm-PEG-SH (6.4 mg / 50 μL) were prepared, and the two solutions were added to the reaction system at a volume ratio of 5%.
[0077] The instructions for using the above reagent kit are as follows: (1) Sample lysis: After the pharyngeal swab sample is collected, it is inserted into a lysis tube containing lysis buffer, capped and vortexed for 5 minutes to ensure complete lysis of the pathogen. The resulting lysis buffer is used directly as an amplification template. (2) Construction of hydrogel counting system: The lysis buffer, positive control and negative control obtained in (1) were added to the corresponding detection premix, and then the hydrogel monomer was added and mixed. The mixture was then dropped into the planar reaction chamber, spread evenly, and covered with a layer of polyester film to seal the system. The system was allowed to stand at room temperature for 5 min to crosslink and form a hydrogel. (3) Isothermal amplification reaction: The above hydrogel reaction chip was placed on the heating block and reacted at 65°C for 15 minutes; (4) Imaging and counting of fluorescent amplification spots: Fluorescence images of the hydrogel reaction layer are acquired using a fluorescence imaging device, the fluorescent amplification spots are counted, and the absolute molecular concentration of Mycoplasma pneumoniae DNA in the sample to be tested is calculated based on the Poisson distribution model.
[0078] The above operating procedure is as follows: Figure 3 As shown, the entire procedure was completed within 30 minutes. First, the pharyngeal swab sample was vortexed for 5 minutes. The resulting lysate was mixed with a hydrogel loop-mediated isothermal amplification system and added to a planar reaction chamber to form a hydrogel chip. Subsequently, the chip was heated at 65°C for 15 minutes. Fluorescence images were acquired using a fluorescence imaging device, and the absolute molecular concentration of Mycoplasma pneumoniae DNA was obtained by counting the fluorescent amplification points.
[0079] The fluorescence imaging device is a portable imaging module connected to a mobile terminal. The mobile terminal is pre-installed with analysis software for automatically identifying and counting fluorescent amplification spots and outputting Mycoplasma pneumoniae DNA concentration results. This detection procedure has the advantages of being easy to operate and usable on-site, and can serve as a rapid and accurate alternative for Mycoplasma pneumoniae quantification.
[0080] Example 4: Optimization of reaction conditions for the Mycoplasma pneumoniae hydrogel counting system This embodiment optimizes the reaction conditions of the Mycoplasma pneumoniae hydrogel counting system, systematically optimizing key reaction parameters, including reaction temperature, reaction time, dye concentration, and hydrogel concentration. Mycoplasma pneumoniae DNA extract was used as a template during the optimization process. The construction process of the hydrogel counting system and the proportions of each component in the hydrogel LAMP reaction system are the same as in Example 1.
[0081] The effect of reaction temperature was evaluated at 61°C, 63°C, 65°C, and 67°C, and the results are as follows: Figure 4 As shown in Figure a, as the amplification temperature increased from 61℃ to 67℃, the endpoint fluorescence count of hydrogel LAMP showed a trend of gradually increasing and then decreasing, with the detection count reaching its maximum at 65℃.
[0082] The reaction time was measured by incubating the hydrogel chip for 5, 10, 15, and 20 minutes before fluorescence imaging, and the results are as follows: Figure 4 As shown in b, fluorescent amplification spots appeared after 5-10 min of amplification. As the amplification time increased, the number of amplification spots increased slightly. After 15 min of reaction, there was no significant change in the number of fluorescent spots, indicating that the amplification reaction was basically completed.
[0083] To investigate the effect of dye concentration, tests were conducted at 0.5×, 1×, and 1.5× concentrations of SYBR Green I, with 1× being 0.5 μM. The results are as follows: Figure 4 As shown in Figure c, when the concentration of SYBR Green I dye increased from 1× to 1.5×, the number of amplification points decreased significantly, indicating that excessively high dye concentration has a certain inhibitory effect on the amplification reaction.
[0084] To optimize the hydrogel matrix, stock solutions of 4-Arm-PEG-VS (16 mg / 50 μL) and 4-Arm-PEG-SH (6.4 mg / 50 μL) were prepared, and 1.25 μL of each solution was added to a 25 μL total reaction system to obtain a 5% hydrogel concentration as a reference. Based on this formulation, hydrogels at concentrations of 2.5%, 5%, and 10% were subsequently evaluated to determine the optimal hydrogel composition for hydrogel counting system detection. The results are as follows: Figure 4 As shown in d, when the hydrogel concentration is 2.5%, the number of amplification points is significantly less than 5%, while there is no significant difference between concentrations of 5% and 10%. Therefore, a hydrogel concentration of 5% was chosen to save costs.
[0085] In summary, the optimal conditions for the hydrogel counting system of Mycoplasma pneumoniae are a reaction temperature of 65°C, a reaction time of 15 minutes, a dye concentration of 1×, and a hydrogel concentration of 5%. Under these conditions, the signal-to-noise ratio is maximized, and the amplification performance is optimal. This combination was selected as the best reaction setting and applied to subsequent experiments.
[0086] Example 5: Evaluation of the quantitative detection capability of the Mycoplasma pneumoniae hydrogel counting system This embodiment verifies the quantitative detection capability of the hydrogel counting optimization system. The operation is as follows: (1) First, relative quantification was performed by real-time fluorescence qPCR to obtain the reference concentration value.
[0087] (2) Hydrogel counting was performed on serially diluted Mycoplasma pneumoniae DNA samples. The system preparation, isothermal amplification, and observation and counting of fluorescent amplification points were the same as in Example 1.
[0088] (3) Correlate the number of fluorescent spots at the endpoint obtained in step 2 with the actual concentration measured by qPCR in step 1 to construct a standard curve.
[0089] like Figure 5 As shown, the number of fluorescent clusters decreases proportionally with decreasing target concentration, and this is highly consistent with qPCR results. At 10 0 ~10 3 Within the concentration range of copies / μL, the hydrogel counting system exhibited good linearity, ensuring quantitative accuracy within the clinically relevant concentration range. Furthermore, no amplification signal was observed in the blank control group, further validating the specificity of this detection method. Analysis showed that the limit of detection (LOD) of this system reached 1.2 copies / μL, and the correlation coefficient R0 was [value missing]. 2 It has a sensitivity of not less than 0.98, which is sufficient to detect low pathogen load in clinical samples.
[0090] Example 6: Specificity of the Mycoplasma pneumoniae hydrogel counting method without nucleic acid extraction This embodiment verifies the specificity of the rapid quantitative detection method for Mycoplasma pneumoniae without nucleic acid extraction. The procedure is as follows: (1) Pharyngeal swab samples of various common respiratory pathogens (samples were obtained from the Children's Hospital Affiliated to Zhejiang University School of Medicine and approved by the Ethics Committee of the Children's Hospital Affiliated to Zhejiang University School of Medicine (approval number: 2023-IRB-0243-P-01)) were selected as control groups, including respiratory syncytial virus (RSV), influenza A / B virus (IV), adenovirus (Adv), and rhinovirus (RV). In addition, mixed infection model samples simulating pediatric co-infection (e.g., M. pneumoniae + RSV + IV, M. pneumoniae + Adv + RV) were constructed.
[0091] (2) The sample lysis pretreatment and hydrogel counting system construction process is the same as in Example 3.
[0092] (3) The heating process of the isothermal amplification reaction is the same as that in Example 3.
[0093] (4) The imaging and counting of fluorescent amplification points are the same as in Example 3.
[0094] The results showed that ( Figure 6 The number of amplified fluorescent spots in mixed infection samples was comparable to that in single Mycoplasma pneumoniae samples, while no amplification signal was detected in non-target pathogens and template-free blank groups, indicating that this method has high specificity for detecting Mycoplasma pneumoniae.
[0095] Example 7: Reproducibility of a Nucleic Acid Extraction-Free Hydrogel Counting Method for Mycoplasma pneumoniae This embodiment evaluates the reproducibility of a rapid quantitative detection method for Mycoplasma pneumoniae without nucleic acid extraction. The procedure is as follows: (1) Five pharyngeal swab samples of Mycoplasma pneumoniae with high, medium and low concentrations were selected.
[0096] (2) The sample lysis pretreatment and hydrogel counting system construction process is the same as in Example 3.
[0097] (3) The heating process of the isothermal amplification reaction is the same as that in Example 3.
[0098] (4) The imaging and counting of fluorescent amplification points are the same as in Example 3.
[0099] The results are as follows Figure 7 As shown, the intra-batch and inter-batch hydrogel quantification results were relatively stable in high, medium, and low concentrations of Mycoplasma pneumoniae pharyngeal swab samples, indicating that the hydrogel counting system for Mycoplasma pneumoniae without nucleic acid extraction has excellent repeatability and stability and can meet the requirements of clinical diagnosis.
[0100] Application Example 1 This embodiment applies the above-described system to detect clinical Mycoplasma pneumoniae pharyngeal swab samples. A total of 50 pharyngeal swab samples were collected from pediatric patients at the Children's Hospital Affiliated to Zhejiang University School of Medicine, and the results were approved by the Ethics Committee of the Children's Hospital Affiliated to Zhejiang University School of Medicine (Approval No.: 2023-IRB-0243-P-01). All participants or their guardians signed written informed consent forms. All participants exhibited respiratory symptoms and were clinically suspected of having Mycoplasma pneumoniae infection. The infection status of each patient was determined by routine qPCR testing at the hospital, serving as a reference standard for assessing the diagnostic accuracy and consistency of this method.
[0101] The process of constructing the sample lysis pretreatment and hydrogel counting system, the isothermal amplification reaction, and the observation and counting of fluorescent amplification points are the same as in Example 3.
[0102] To further evaluate the comparability of this detection method with traditional qPCR quantitative detection, we used a pre-established standard curve to measure the copy number obtained from the detection. Figure 5 a) The value was converted to the theoretical Ct value and a Bland-Altman consistency analysis was performed.
[0103] like Figure 8 As shown in Figure a, this detection method accurately identified all 35 clinically confirmed positive samples as positive. Of the 15 clinically negative samples, 14 were correctly identified as negative. Based on these results, the diagnostic sensitivity of this method is 100%, and the specificity is 93.3%, indicating that this method maintains high diagnostic accuracy even in clinical throat swab samples that have not undergone nucleic acid extraction.
[0104] Depend on Figure 8 As shown in b, the average difference between the two methods is -0.01, indicating that the systematic bias between them is negligible. The 95% agreement range is -1.37 to +1.36, and more than 95% of the paired sample differences fall within the clinically acceptable range.
[0105] These results further demonstrate that this detection method is highly consistent with traditional qPCR in terms of quantitative detection, and is a rapid, reliable, and interchangeable method for quantitative detection of Mycoplasma pneumoniae.
[0106] The above description is merely a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.
Claims
1. A rapid quantitative detection kit for Mycoplasma pneumoniae based on nucleic acid extraction-free assay, characterized in that, The kit includes a lysis buffer for releasing Mycoplasma pneumoniae DNA from a sample without nucleic acid extraction, a loop-mediated isothermal amplification reaction premix, a hydrogel monomer, and a planar reaction chamber for forming a hydrogel reaction layer. The lysis buffer comprises: 20-100 mM tris(hydroxymethyl)aminomethane hydrochloride, 5-30 mM disodium ethylenediaminetetraacetate, 0.5%-2% sodium dodecyl sulfate, 0.5%-2% sodium hydroxide, 0.5%-2% Triton X-100, and 0.2%-0.6% octyl glucoside.
2. The rapid quantitative detection kit for Mycoplasma pneumoniae based on nucleic acid extraction-free method as described in claim 1, characterized in that, The lysis buffer is specifically composed of the following components at the following final concentrations: 40 mM tris(hydroxymethyl)aminomethane hydrochloride, 15 mM disodium ethylenediaminetetraacetate, 1% sodium dodecyl sulfate (by weight / volume), 0.8% sodium hydroxide (by weight / volume), 1% Triton X-100 (by volume), and 0.4% octyl glucoside (by weight / volume).
3. The rapid quantitative detection kit for Mycoplasma pneumoniae based on nucleic acid extraction-free method as described in claim 1, characterized in that, The kit also includes zirconia beads for physical grinding during the pyrolysis process. The zirconia beads have a diameter of 2 mm and the volume ratio of the zirconia beads to the pyrolysis solution is 1:
10.
4. The rapid quantitative detection kit for Mycoplasma pneumoniae based on nucleic acid extraction-free method as described in claim 1, characterized in that, The loop-mediated isothermal amplification reaction premix contains outer primers F3 and B3, inner primers FIP and BIP, and loop primers LF and LB, which specifically amplify the target sequence of Mycoplasma pneumoniae, with nucleotide sequences as shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6, respectively.
5. The rapid quantitative detection kit for Mycoplasma pneumoniae based on nucleic acid extraction-free method as described in claim 4, characterized in that, In the hydrogel reaction system, the concentrations of FIP and BIP were both 0.2–1.6 μM, the concentrations of F3 and B3 were both 0.1–0.3 μM, and the concentrations of LF and LB were both 0.2–0.8 μM.
6. The rapid quantitative detection kit for Mycoplasma pneumoniae based on nucleic acid extraction-free method as described in claim 5, characterized in that, In the hydrogel reaction system, the final concentrations of FIP and BIP were both 0.928 μM, the final concentrations of F3 and B3 were both 0.116 μM, and the final concentrations of LF and LB were both 0.232 μM.
7. The rapid quantitative detection kit for Mycoplasma pneumoniae based on nucleic acid extraction-free method as described in claim 2, characterized in that, The loop-mediated isothermal amplification reaction premix also contains LAMP mixing reagents and a fluorescent dye; the fluorescent dye is SYBR Green I, with a final concentration of 0.2~1.0 μM in the hydrogel reaction system.
8. The rapid quantitative detection kit for Mycoplasma pneumoniae based on nucleic acid extraction-free method as described in claim 1, characterized in that, The hydrogel monomers include tetra-armed polyethylene glycol-vinyl sulfone and tetra-armed polyethylene glycol-thiol; the tetra-armed polyethylene glycol-vinyl sulfone has a molecular weight of 5 kDa and a mass concentration of 0.016~0.032 mg / μL in the hydrogel reaction system; the tetra-armed polyethylene glycol-thiol has a molecular weight of 2 kDa and a thiol / vinyl molar ratio of 0.8~1.2:1 in the hydrogel reaction system.
9. The rapid quantitative detection kit for Mycoplasma pneumoniae based on nucleic acid extraction-free method as described in claim 1, characterized in that, The planar reaction chamber has a tank for forming a hydrogel reaction layer, the tank having a thickness of 250-280 μm.
10. The application of the rapid quantitative detection kit for Mycoplasma pneumoniae based on nucleic acid extraction-free method as described in claim 1 in the preparation of products for quantitative detection of Mycoplasma pneumoniae content in ex vivo samples, characterized in that, (1) Add the lysed nucleic acid sample to a mixture containing hydrogel monomer and premix, mix well and inject into a planar reaction chamber to form a hydrogel reaction layer; (2) The planar reaction chamber was incubated at a constant temperature of 65°C for 15 min to allow the Mycoplasma pneumoniae DNA to undergo a loop-mediated isothermal amplification reaction in the hydrogel and generate a fluorescent signal. (3) A fluorescence imaging device was used to acquire fluorescence images of the hydrogel reaction layer, the fluorescence amplification spots were counted, and the absolute molecular concentration of Mycoplasma pneumoniae DNA in the sample to be tested was calculated based on the Poisson distribution model.