Construction method and application of pdhB gene mutant strain of mycoplasma bovis PG45 strain

Abstract

The invention relates to the technical field of prevention and control of animal infectious diseases, in particular to a construction method of a pdhB gene mutant strain of a mycoplasma bovis PG45 strain, which comprises the following steps: by taking M. bovis PG45 as parent bacteria, collecting thalli in a logarithmic later stage, washing the thalli with a sucrose-Tris / Cl buffer solution, resuspending the thalli in 0.1 M CaCl, and carrying out ice bath for 30 minutes; the method comprises the following steps: mixing competent cells with 20 [mu] g of pMT / mNeonGreen-RR, 10 [mu] g of yeast tRNA and 2 mL of 70% PEG 8000, incubating for 2 min, and washing with a sucrose-Tris / Cl buffer solution; culturing for 3 hours at 37 DEG C by utilizing 0.6 mL of nonreactive PPLO broth; after the incubation is finished, coating on a solid culture medium containing 100 mu g / mL kanamycin, culturing for 3-7 days at 37 DEG C, observing and screening out a green monoclonal colony by using a fluorescence microscope, culturing, preserving at-80 DEG C, and establishing a mycoplasma bovis PG45 random mutant library; a pdhB gene mutant strain, namely a Mycoplasma bovis PG45 delta pdhB strain, is obtained by identifying and screening through a specific primer PCR (Polymerase Chain Reaction). Compared with a wild type, the growth speed of the Mycoplasma bovis PG45 [delta] pdhB strain is obviously slowed down, and the adhesive force of the Mycoplasma bovis PG45 [delta] pdhB strain to EBL cells is obviously weakened.

Description

Technical Field

[0001] This invention relates to the field of animal infectious disease prevention and control technology, specifically to a strain of Mycoplasma bovis PG45. pdhB Methods for constructing and applying gene mutant strains. Background Technology

[0002] Bovine mycoplasma ( Mycoplasma bovis , M. bovis Mycoplasma is a major causative agent of respiratory diseases in cattle, causing various clinical manifestations such as pneumonia, mastitis, arthritis, otitis, and reproductive system inflammation. Because its pathogenic mechanism is not fully understood, there is currently a lack of safe and effective commercial vaccines; antibiotic treatment is lengthy, has limited efficacy, and is prone to drug resistance, resulting in severe economic losses for the beef and dairy cattle industries. Although mycoplasma possesses one of the most concise genomes known among bacteria, the techniques suitable for its genetic manipulation remain scarce, leading to a significant lag in gene function annotation, primarily due to low homologous recombination efficiency. Transposon-based mutation technology has become an important tool for studying mycoplasma gene function. Among them, the Tn4001 transposon derived from Staphylococcus aureus is widely used due to its numerous insertion sites and ease of phenotypic screening.

[0003] With the increasing prevalence of antibiotic resistance, bacterial infectious diseases pose a significant public health burden globally. Live attenuated vaccines are considered an effective strategy for preventing bacterial infections due to their ability to induce broad and durable mucosal and cellular immunity. Within the bacterial virulence regulatory network, metabolic pathways are closely related to pathogenicity.

[0004] In recent years, numerous studies have shown that multiple core metabolic enzymes can directly or indirectly regulate bacterial growth rate, adhesion ability, and the expression of virulence factors. With the development of genetic engineering technology, deleting key virulence or metabolic genes has become one of the mainstream strategies for constructing safe and controllable attenuated strains. pdhB The encoded pyruvate dehydrogenase complex (PDHc) E1β subunit is a key enzyme in bacterial metabolism, responsible for converting the substrate pyruvate into acetyl-CoA, providing the necessary substrate for downstream energy and precursor molecule synthesis. pdhB The gene has become a candidate key mutant gene for obtaining novel attenuated live vaccine strains of Mycoplasma bovis. Summary of the Invention

[0005] To address the shortcomings of existing technologies, this invention provides a strain of Bovine Mycoplasma PG45. pdhB The method for constructing gene mutant strains involves transforming bovine mycoplasma with a plasmid containing transposons under polyethylene glycol (PEG) 8000-mediated transformation, randomly inserting the transposon into the bovine mycoplasma genome, and obtaining mutant strains through selection. pdhB Gene insertion mutant strain.

[0006] To achieve the above objectives, the following technical solution is provided: A strain of bovine mycoplasma PG45 pdhB A method for constructing a gene mutant strain, characterized by comprising the following steps: Step 1, with M. bovis PG45 was used as the parent bacterium. Log-phase cells were collected, washed with sucrose-Tris / Cl buffer, resuspended in 0.1 M CaCl2, and incubated on ice for 30 min to obtain bovine mycoplasma competent cells. Step 2: Mix bovine mycoplasma competent cells with 20 μg pMT / mNeonGreen-RR plasmid, 10 μg yeast tRNA and 2 mL 70% PEG 8000, incubate for 2 min, wash with sucrose-Tris / Cl buffer, and centrifuge to obtain cell pellet. Step 3: Resuspend the bacterial pellet in 0.6 mL of antibiotic-free PPLO broth and incubate at 37 ℃ for 3 h; after incubation, spread it on solid medium containing 100 μg / mL kanamycin and incubate at 37 ℃ for 3-7 days. Observe and screen green monoclonal colonies using a fluorescence microscope for further culture and store at -80 ℃ to establish a random mutant library of bovine mycoplasma PG45. Step 4: Identification and screening using specific primer PCR. pdhB Gene mutant strain.

[0007] Preferably, in step two, the Tn4001 transposon-derived plasmid pMT / mNeonGreen-RR is used in... pdhB The mNeonGreen gene is inserted into the coding region of the gene to express green fluorescent protein.

[0008] Specifically, transposon elements (fluorescent gene and kanamycin resistance gene KanR) from the transposon plasmid pMT / mNeonGreen-RR are randomly inserted into the bovine mycoplasma genome, disrupting the integrity of the bovine mycoplasma gene and forming a bovine mycoplasma green fluorescent mutant library.

[0009] Preferably, in step two, in the presence of yeast tRNA and PEG 8000, the pMT / mNeonGreen-RR transposon plasmid carrying Tn4001 is transformed into bovine mycoplasma competent cells.

[0010] Preferably, in step three, resistant clones are obtained through kanamycin resistance screening.

[0011] Preferably, in step four, the pdhB The gene sequence is SEQ ID NO: 1: ATGGAAAAAATTTCATTAAATAACATTGGTGCCTTAAATCACGCATTAGATTTAGCAATGGAAAAATTCCCTAATGTAGTTATTTATGGTGAAGATGCAGGTTTTGAAGGTGGTGTATTCCGTGCTACTGAAGGTCTTCAAAAGAAAATATGGTGACCAAAGAGTATGAGACTCACCAATTTCTGAAGGTGGTATTGCAGGATCAGCTGTTGGTGCATCTGCTGCAGGATTAAGACCAGTTGTTGAAATTCAATTCTCAGGTTTCTCATTCCCTGCTATGAACCAAATTTTTACAAACGCTGCACGTTATAGAACAAGATCACACGGTGTTTACTCATGTCCAATGGTTGTTAGAATGCCTTGTGGTGGTGGGGTTAAAGCTCTAGAACACCACTCAGAAGCTCTTGAAACAATTTACTCACACGTTCCAGGTCTAAAGGTTATAATGCCTGCTACACCTTATGACACAAAAGGTTTAATGTTAGCAGCTATCG AAGATAATGACCCAGTTATTTTCTTAGAACATAAACATGACTACCGTGCTTTCAAACAAGAAATCCCAGCTGAATACTACACAATTGAAATTGGTAAAGCAAATGTTGTTGTTCCTGGTGAAGACTTGACAATTACAGCATACGGTCACGTATTGCATGAAACTCTTGGTGCTCTTAAGTTACTACAAGAAAAAGGCAAAGATTACTCAATCGAAGTTATCGACTTAAGAACTCTTAAACCACTTGA CAAAGAAACTATTGTTTCTTCAGTTAAGAAAACAGGTCGTCTATTAGCAATTTCTGAAGCTGTTGAAACACTTTCAATTAACTCAGAAATTATTACAATTGTTAACGAAGAGTGTTTTGATGATTTAGTTGCTAAACCAAGAAGACTAAACAGCTGACGTAACAGTTCCTCTTCCTGTTTTAGAAAAACAATTCTTCTTCAGCAAAGAACACATTGCTAAAGTTATCGAAGAAATGTTAGGCTAA The sequence of the identification primers is: SEQ ID NO: 2 pdhB _F:ATGGAAAAAATTTCATTAAATAAC with SEQ ID NO: 3 pdhB _R:TTAGCCTAACATTTCTTCGA.

[0012] A strain of bovine mycoplasma PG45 pdhB Gene mutant strain, the pdhB The mutant strain was named as follows: Mycoplasma bovis PG45Δ pdhB The strain was deposited on October 11, 2025 at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, with accession number M20252201.

[0013] A strain of bovine mycoplasma PG45 pdhB Application of gene mutant strains in the preparation of immunomodulatory agents.

[0014] Specifically, the bovine mycoplasma PG45 strain pdhB Application of gene mutant strains in the preparation of novel attenuated live vaccines.

[0015] This invention first constructs a library of bovine mycoplasma random insertion mutants using the pMT / mNeonGreen-RR transposon plasmid, and then screens for mutants by identifying primers. pdhB Clones with inserted and disrupted genes were subsequently identified; this was confirmed by fluorescence microscopy, whole-genome sequencing, and Western blot analysis. pdhB The gene was disrupted by transposon insertion, and the protein was not expressed in the mutant strain; growth curves and colony morphology analysis showed that, compared with the wild-type strain, Mycoplasma bovis PG45Δ pdhB The mutant strain exhibited a significantly decreased growth rate and smaller colony size. EBL cell adhesion assays showed that... Mycoplasma bovis PG45Δ pdhB The cell adhesion rate of the mutant strain was significantly lower than that of the wild-type strain.

[0016] The beneficial effects of this invention are as follows: 1. The mutant strain obtained in this invention is based on M. bovis PG45 (GenBank: CP002188.1) was used as the parent strain. Transformation was performed using polyethylene glycol 8000 (PEG 8000) to introduce the transposon plasmid pMT / mNeonGreen-RR, derived from the Tn4001 plasmid, into the bacterial cells. After initial screening for kanamycin resistance, secondary screening under fluorescence microscopy, primer identification, and whole-genome sequencing, a transposon insertion strain was obtained. pdhBMutants of genes are named Mycoplasma bovis PG45Δ pdhB .

[0017] 2. Compared with the wild type, the mutant strain showed a significantly reduced growth rate and a significantly reduced ability to adhere to EBL; pdhB The acquisition of gene mutant strains not only provides effective biological materials for in-depth research on the etiology and molecular pathogenic mechanisms of bovine mycoplasma, but also lays the foundation for the development of novel attenuated live vaccines.

[0018] 3. Compared with wild type M. bovis Compared to PG45, Mycoplasma bovis PG45Δ pdhB The strain showed significantly reduced adhesion to EBL cells, thus laying an experimental foundation and demonstrating application potential for elucidating the etiology and pathogenic mechanism of bovine mycoplasma growth and metabolism, as well as developing immunomodulatory control measures. Attached Figure Description

[0019] Figure 1 PCR verification in this embodiment of the invention Mycoplasma bovis PG45Δ pdhB In the missing strains pdhB Gene; where M is the DNA Marker; 1 is the wild-type PG45 genome. pdhB Gene amplification; 2 is Mycoplasma bovis PG45Δ pdhB strain genome pdhB Gene amplification; 3 is the negative control water.

[0020] Figure 2 for Mycoplasma bovis PG45Δ pdhB Whole genome map of the strain.

[0021] Figure 3 For the purpose of Western blot verification of wild-type strains and Mycoplasma bovis PG45Δ pdhB Expression of pdhB protein in mutant strains; where M is the pre-stained protein marker.

[0022] Figure 4 Wild-type strains and Mycoplasma bovis PG45Δ pdhB Growth curve determination of mutant strains.

[0023] Figure 5 Wild-type strains and Mycoplasma bovis PG45Δ pdhB Colony morphology of mutant strains under an optical microscope.

[0024] Figure 6Wild-type strains and Mycoplasma bovis PG45Δ pdhB Comparison of the adhesion ability of mutant strains in EBL cells. Detailed Implementation

[0025] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0026] Example 1: Construction of a library of randomly inserted mutants The plasmid pMT / mNeonGreen was donated by Professors Francois Thiaucourt and Lucía Manso-Silván of CIRAD, France (Bonnefois T et al, 2016). This plasmid is a derivative of the Tn4001 transposon plasmid. aacA-aphD The gene that confers kanamycin resistance is located between two inverted repeat (IR) sequences; while the transposase gene... tnpA Located outside the IR, it can prevent re-transposition. Subsequently, our laboratory further modified this plasmid to generate a transposon plasmid with high transposition efficiency, pMT / mNeonGreen-RR (Lan S et al, 2023).

[0027] First of all, with M. bovis PG45 was used as the parent bacterium. Log-phase cells were collected, washed twice with sucrose-Tris / Cl buffer, and then resuspended in 0.1 M CaCl2 and incubated on ice for 30 min to obtain bovine mycoplasma competent cells. Subsequently, bovine mycoplasma competent cells were mixed with 20 μg pMT / mNeonGreen-RR, 10 μg yeast tRNA and 2 mL 70% PEG 8000, incubated for 2 min, washed with sucrose-Tris / Cl buffer, and centrifuged to obtain cell pellet. Finally, the bacterial pellet was resuspended in 0.6 mL of antibiotic-free PPLO broth and cultured at 37 °C for 3 h. After incubation, it was spread on solid medium containing 100 μg / mL kanamycin and cultured at 37 °C for 3-7 days. Green monoclonal antibodies were observed and screened using a fluorescence microscope and cultured for further study. The clones were then stored at -80 °C to establish a random mutant library of bovine mycoplasma PG45.

[0028] Example 2: pdhB Screening of gene mutant strains Detection of inserted genes in the mutant library: Genomic DNA was extracted from the strains in the mutant library using the Tiangen Bacterial Genomic DNA Extraction Kit. Primers SEQ ID NO: 2 were used to extract the genome of the mutant strains. pdhB _F:ATGGAAAAAATTTCATTAAATAAC with SEQ ID NO: 3 pdhB PCR amplification was performed using the mutant strain TTAGCCTAACATTTCTTCGA. Electrophoresis results showed that the wild-type strain amplified a band of approximately 1000 bp, while the mutant strain amplified a band exceeding 5000 bp. This allowed for the selection of strains with bands different from the wild-type strain. pdhB Gene mutant strain ( Figure 1 ).

[0029] Example 3: pdhB Identification of gene mutant strains Whole genome sequencing analysis: The QIAGEN DNeasyUltraClean / NoviPure Microbial Kits were used for sequencing... Mycoplasma bovis PG45Δ pdhB Genomic DNA was extracted from the mutant strain and then processed using PacBio technology by Beijing Novogene Technology Co., Ltd. Mycoplasma bovis PG45Δ pdhB Sequencing of the complete genome map of the mutant strain's third generation bacteria. Subsequent alignment analysis with the complete genome of PG45 in NCBI showed that the pMT / mNeonGreen-RR transposon plasmid was inserted into... pdhB After the 603rd bp of the gene ( Figure 2 The mutant strain was named Mycoplasma bovis PG45Δ pdhB .

[0030] Protein expression validation: wild-type strain and Mycoplasma bovis PG45Δ pdhB The mutant strain was cultured in PPLO broth for 24 h, and the bacterial cells were collected and lysed. The cells were then separated by SDS-PAGE and transferred to a membrane. A self-made anti-rpdhB mouse polyclonal antibody (1:1000) was used as the primary antibody, and HRP-labeled goat anti-mouse IgG (H+L) (1:5000, Abcam) was used as the secondary antibody. Detection was performed by ECL chemiluminescence. Results: The wild-type strain showed a band at 36 kDa, while... Mycoplasma bovis PG45Δ pdhB The mutant strain showed no detection signal. Figure 3 ), indicating that the mutant strain pdhB The gene coding region is disrupted by transposon insertion, thus preventing the expression of pdhB protein.

[0031] Example 4: Mycoplasma bovis PG45Δ pdhB Growth characteristics of mutant strains Growth curve: (1) Preparation of frozen bacterial solution: Bovine mycoplasma PG45 strain and Mycoplasma bovis PG45Δ pdhB The mutant strain was revived and cultured twice. The strain from the last subculture was cultured to mid-logarithmic growth, then centrifuged, washed, CFU counted, and frozen. (2) Preparation of bacterial culture before experiment: dilute according to the CFU count results before freezing, and uniformly set the initial bacterial culture concentration to 10. 3 CFU / mL, with a total volume of 25 mL. Titers were measured every 4 hours for the first 48 hours, then every 6 hours thereafter, and every 12 hours thereafter, until 120 hours of growth. 100 μL of the bacterial culture was diluted and plated. After 3-5 days of incubation, CFU levels were tallied, and growth curves were plotted. Results showed that the wild-type strain and... Mycoplasma bovine PG45Δ pdhB The growth rates of the mutant strains differed significantly: wild-type strains exhibited a logarithmic growth phase from 0-24 h, a plateau phase from 24-72 h, and subsequently entered a decline phase, while... Mycoplasma bovis PG45Δ pdhB The mutant strain exhibited a logarithmic growth phase from 4 to 54 hours, a plateau phase from 54 to 96 hours, and subsequently entered a decline phase. These results suggest that... pdhB The deletion of genes led to Mycoplasma bovine PG45Δ pdhB The growth rate is slower than that of wild plants. Figure 4 ).

[0032] Colony morphology: Logarithmic-phase cells were spread onto PPLO solid medium and incubated at 37 ℃ for 72 h. Both strains formed pinpoint-shaped "fried egg" colonies with neat edges, but... Mycoplasma bovis PG45Δ pdhB The colonies were significantly smaller than those of the wild-type strain. Figure 5 ),hint pdhB The absence of [a specific substance] significantly affected the proliferation and colony size of bovine mycoplasma.

[0033] Example 5: Functional Verification Mycoplasma bovis PG45Δ pdhB Adhesion of EBL cells: Bovine mycoplasma PG45 strain, Mycoplasma bovis PG45Δ pdhB The mutant strain was revived and passaged at a ratio of 1:10. After centrifugation, CFU were counted and the culture was stored at -80°C. The culture was then divided into 2 × 10⁻⁶ cells / year. 5EBL cells were seeded into 12-well plates at a cell / well ratio. After obtaining CFU results, the bacterial culture was diluted with DMEM complete medium at a ratio of 100 MOI and used to infect EBL cells for 1.5 h. Then, unattached bovine mycoplasma was washed with PBS at 100 r / min for 3 min each time, for a total of 3 times. Trypsin digestion was performed, and after digestion, the cells were thoroughly mixed by pipetting. 100 μL of the liquid was serially diluted 10-fold and plated. CFU was counted within 3-5 days of culture. Five independent experiments were performed, with three replicates each. The results showed that: Mycoplasma bovis PG45Δ pdhB The mutant strain's ability to adhere to EBL cells was significantly lower than that of the wild-type strain (p < 0.05). Figure 6 ),hint pdhB The absence of bovine mycoplasma reduces the adhesion of EBL cells.

[0034] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above, and that the invention can be implemented in other specific forms without departing from its spirit or essential characteristics. Therefore, the embodiments should be considered in all respects as exemplary and non-limiting, and the scope of the invention is defined by the appended claims rather than the foregoing description. Thus, all variations falling within the meaning and scope of equivalents of the claims are intended to be included within the present invention. No reference numerals in the claims should be construed as limiting the scope of the claims.

Claims

1. A strain of bovine mycoplasma PG45 pdhB Gene mutant strain, the pdhB The mutant strain was named as follows: Mycoplasma bovis PG45Δ pdhB The strain was deposited on October 11, 2025 at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, with accession number M20252201.

2. A strain of bovine mycoplasma PG45 pdhB A method for constructing gene mutant strains, characterized in that, Includes the following steps: Step 1, with M. bovis PG45 was used as the parent bacterium. Log-phase cells were collected, washed with sucrose-Tris / Cl buffer, resuspended in 0.1 M CaCl2, and incubated on ice for 30 min to obtain bovine mycoplasma competent cells. Step 2: Mix bovine mycoplasma competent cells with 20 μg pMT / mNeonGreen-RR plasmid, 10 μg yeast tRNA and 2 mL 70% PEG 8000, incubate for 2 min, wash with sucrose-Tris / Cl buffer, and centrifuge to obtain cell pellet. Step 3: Resuspend the bacterial pellet in 0.6 mL of antibiotic-free PPLO broth and incubate at 37 ℃ for 3 h. After incubation, spread the pellet on solid medium containing 100 μg / mL kanamycin and incubate at 37 ℃ for 3-7 days. Observe and screen green monoclonal antibodies using a fluorescence microscope for further culture and store at -80 ℃ to establish a bovine mycoplasma PG45 random mutant library. Step 4: Screening primers for specific identification to obtain... pdhB Gene mutant strain.

3. The bovine mycoplasma PG45 strain according to claim 2 pdhB The method for constructing gene mutant strains is characterized by: In step two, the Tn4001 transposon-derived plasmid pMT / mNeonGreen-RR was used in... pdhB The mNeonGreen gene is inserted into the coding region of the gene to enable it to express green fluorescent protein.

4. The bovine mycoplasma PG45 strain according to claim 3 pdhB The method for constructing gene mutant strains is characterized by: Transposon elements (fluorescent gene and kanamycin resistance gene KanR) from transposon plasmid pMT / mNeonGreen-RR were randomly inserted into the bovine mycoplasma genome, disrupting the integrity of the bovine mycoplasma gene and forming a bovine mycoplasma green fluorescent mutant library.

5. The bovine mycoplasma PG45 strain according to claim 4 pdhB The method for constructing gene mutant strains is characterized by: In step two, in the presence of yeast tRNA and PEG 8000, the pMT / mNeonGreen-RR transposon plasmid carrying Tn4001 was transformed into bovine mycoplasma competent cells.

6. The bovine mycoplasma PG45 strain according to claim 5 pdhB The method for constructing gene mutant strains is characterized by: In step three, resistant clones are obtained through kanamycin resistance screening.

7. The bovine mycoplasma PG45 strain according to claim 6 pdhB The method for constructing gene mutant strains is characterized by: In step four, the pdhB The gene sequence is shown in SEQ ID NO: 1; The sequence of the identification primer is: SEQ ID NO: 2 pdhB _F:ATGGAAAAAATTTCATTAAATAAC and SEQ ID NO: 3 pdhB _R: TTAGCCTAACATTTCTTCGA.

8. A strain of bovine mycoplasma PG45 pdhB Application of gene mutant strains in the preparation of immunomodulatory agents.

9. The application according to claim 8, characterized in that: The bovine mycoplasma PG45 strain pdhB Application of gene mutant strains in the preparation of novel attenuated live vaccines.

Images