Rice gene OsWR1 and application thereof in rice blast resistance of rice

Abstract

The invention discloses a rice protein related to plant disease resistance as well as a coding gene OsWR1 and application thereof. The protein sequence provided by the invention is A1) or A2): A1) a protein with an amino acid sequence as a sequence 2; a2) a protein which is obtained by substitution and / or deletion and / or addition of one or more amino acid residues on the amino acid sequence shown in the sequence 2 in the sequence table and has the same function as the protein shown in the sequence 2. Researches find that the rice blast resistance of rice can be remarkably improved by knocking out the rice OsWR1 gene by adopting a CRISPR-Cas9 technology, and the resistance of the rice to the rice blast can be weakened by overexpressing the OsWR1 gene in the rice.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering, specifically relating to a rice gene. OsWR1 The application of its encoded proteins in resistance to rice blast. Background Technology

[0002] Rice ( Oryza sativa Rice is the world's most important food crop, consumed by over 50% of the world's population. It is also a significant economic crop, used in industries such as textiles, leather, and cosmetics. It is caused by rice blast fungus (…). Magnaporthe oryzae Rice blast, caused by fungal infection, is a significant fungal disease threatening global rice production. It can occur at any stage of rice growth, from seedling to late vegetative growth, affecting leaves, nodes, neck, panicles, panicle necks, and roots, causing devastating losses in severe cases. Current strategies for controlling this disease primarily focus on developing resistant varieties and applying fungicides. Chemical fungicides are favored due to their availability and short-term effectiveness; however, continuous use can lead to fungal resistance, excessive pesticide residues in grains, environmental pollution, and disruption of the ecological balance. Developing broad-spectrum, long-lasting blast-resistant rice varieties is the most economical, effective, and safe strategy for controlling rice blast. Traditional breeding methods are cumbersome and time-consuming, and the continuous genetic mutations of the pathogen hinder the persistence of genetic resistance in varieties. In recent years, the rapid development of biotechnology has become an effective tool for understanding the biological pathways of host pathogen infection, plant immune responses, and disease development, laying the foundation for more accurate and precise development of blast-resistant rice varieties in a short period. Recent practices, such as mutation breeding, transgenic breeding, marker-based breeding, and genome editing-based breeding, are being used as the main tools for developing durable resistant varieties, and their use in monitoring, mitigating, and controlling pathogens and their infection is sustainable.

[0003] Transcription factors are proteins containing one or more specific DNA-binding domains that control the transcription of genetic information from DNA to mRNA, thereby activating or inhibiting the expression of target genes. Currently, over 60 transcription factor families have been identified in plants, such as the AP2 / ERF, ARF, bHLH, bZIP, C2H2, DOF, HSF, MYB, NAC, and WRKY families. Different families of transcription factors bind to the DNA-binding domains of different target genes. Transcription factors play an indispensable role in the complete life cycle of higher plants, participating in the regulation of various biological processes and are of great significance. OsWR1 is a SHN-type transcription factor belonging to group V of the ERF subfamily within the AP2 / ERF family. It responds to drought, abscisic acid, and salt stress, is mainly expressed in rice leaves, and is a positive regulator of the transcription of genes related to rice wax synthesis. It works by binding to genes related to rice wax layer synthesis. OsLACS2 and OsFAE1’-LThe cis-elements DRE and GCC boxes in the promoter region combine to regulate its expression. OsWR1 Overexpression of OsWR1 helps reduce water loss from plants and enhances drought resistance. However, to date, there are no reports on the application of OsWR1 protein in rice disease resistance, and its specific biochemical functions are unknown. Summary of the Invention

[0004] The technical problem to be solved by this invention is how to improve the resistance of rice to rice blast.

[0005] This invention has found that knocking out the rice OsWR1 gene using biotechnology can significantly improve the rice's resistance to rice blast, while overexpressing the OsWR1 gene in rice will weaken the rice's resistance to rice blast.

[0006] To address the aforementioned technical problems, this invention provides a rice gene OsWR1 and its encoded protein. Specifically, the OsWR1 gene is knocked out using the CRISPR / Cas9 method and overexpressed through Agrobacterium transformation. This demonstrates that the OsWR1 gene has a negative regulatory function on rice resistance to rice blast, providing an endogenous target gene for the control of rice blast.

[0007] The protein related to rice blast resistance provided by this invention is named OsWR1, as shown in A1) or A2). A1) The amino acid sequence is that of the protein listed in SEQ ID NO.2; A2) A protein having the same function as the protein shown in Sequence 2, by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO.2 in the sequence listing.

[0008] To facilitate the purification of the protein in A1), a fusion protein can also be obtained by attaching a tag to the N-terminus and / or C-terminus of the protein as shown in Sequence 2; the tag can be a Poly-Arg (RRRRR), Poly-His (HHHHHH), FLAG (DYKDDDDK), Strep-tag II (WSHPQFEK), c-myc (EQKLISEEDL), etc.

[0009] The rice blast resistance-related proteins mentioned in A1)-A2) above are generally derived from rice in nature; that is, they are generally natural products. They can also be artificially expressed or synthesized, or their encoding genes can be synthesized first and then expressed biologically. The encoding gene of the protein in A2) above can be obtained by deleting one or more amino acid residues from the codons in the DNA sequence shown in Sequence 1 of the sequence listing, and / or by performing a missense mutation on one or more nucleotide pairs, and / or by attaching the coding sequence of the aforementioned tag to its 5' end and / or 3' end. Among them, Sequence 2 (OsWR1) in the sequence listing consists of 205 amino acid residues.

[0010] The gene encoding the rice blast resistance-related protein, OsWR1, also falls within the scope of protection of this invention. Preferably, the encoding gene is as follows: 1) or 2) or 3) or 4): 1) The coding sequence is the cDNA or DNA molecule located at positions 1-618 of sequence 1 in the sequence listing; 2) The cDNA or DNA molecule shown in sequence 1 of the sequence listing; 3) A cDNA molecule or DNA molecule that has 75% or more identity with the nucleotide sequence defined in 1) or 2) and encodes the rice blast resistance-related protein; 4) A cDNA molecule or DNA molecule that hybridizes to the nucleotide sequence defined in 1) or 2) under stringent conditions and encodes the said rice blast resistance-related protein.

[0011] In one embodiment of the present invention, the rice blast resistance-related protein and its encoding gene are the following genes or proteins: A rice gene, OsWR1, has an open reading frame nucleotide sequence as shown in SEQ ID NO.1.

[0012] The amino acid sequence of the protein encoded by the rice gene OsWR1 is shown in SEQ ID NO.2.

[0013] Because those skilled in the art can easily mutate the nucleotide sequence encoding OsWR1 in this invention using existing techniques, such as sequence recombination and point mutation, those artificially modified nucleotides that have 75% or higher identity with the nucleotide sequence of OsWR1 isolated in this invention, as long as they encode the OsWR1 protein and have the same function, are nucleotide sequences derived from and equivalent to the sequences of this invention. The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes having 75% or higher nucleotide sequence similarity to the nucleotide sequence encoding SEQ ID NO.1 of this invention. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0014] This invention also provides an application of the rice gene OsWR1 in regulating rice resistance to rice blast.

[0015] The application of biomaterials related to the aforementioned rice blast resistance-related proteins in regulating rice resistance to rice blast is also within the scope of protection of this invention; the biomaterials are any one of B1) to B9) below: B1) Nucleic acid molecules encoding the aforementioned rice blast resistance-related proteins; B2) An expression cassette containing the nucleic acid molecule described in B1); B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3); B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2); B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2); B7) Transgenic plant organs containing the nucleic acid molecules described in B1), or transgenic plant organs containing the expression cassette described in B2); B8) Nucleic acid molecules that inhibit the expression of genes encoding proteins related to rice blast resistance described in the text; B9) Expression cassettes, recombinant vectors, recombinant microorganisms or transgenic plant cell lines containing the nucleic acid molecules described in B8).

[0016] The application of the aforementioned rice blast resistance-related proteins or their encoding genes as targets for screening pesticides resistant to rice blast is also within the scope of protection of this invention.

[0017] The application of the aforementioned rice blast resistance-related proteins or their encoding genes as targets for screening pesticides resistant to rice blast is also within the scope of protection of this invention.

[0018] The present invention also provides a method for cultivating disease-resistant transgenic plants, comprising: inhibiting the expression of the gene encoding the protein related to rice blast resistance in the target plant to obtain a disease-resistant transgenic plant with higher resistance than the target plant.

[0019] The method for inhibiting the rice blast resistance-related protein in the target plant is to knock out the coding gene of the rice blast resistance-related protein using the CRISPR / Cas9 method.

[0020] The specific procedures included: selecting a CRISPR / Cas9 editing target site in the open reading frame coding region of the OsWR1 gene, constructing an OsWR1 gene knockout vector, and then transforming the recombinant vector into Agrobacterium. The knockout mutant oswr1 was obtained through Agrobacterium-mediated transformation of rice callus tissue and subsequent screening. Simultaneously, an OsWR1 overexpression vector was constructed using a homologous approach, and rice callus tissue was transformed using Agrobacterium-mediated transformation to obtain OsWR1-overexpressing rice lines. After successfully constructing the knockout and overexpression lines, rice blast resistance was identified through leaf scuffing inoculation. The rice blast resistance of the knockout mutant oswr1 was also evaluated under field conditions. These studies indicate that the rice gene OsWR1 has potential application in rice blast resistance, specifically, knocking out the OsWR1 gene significantly improves rice blast resistance. Overexpression of OsWR1 in rice shows increased susceptibility to the disease compared to the wild type. Therefore, OsWR1 is a gene that negatively regulates rice resistance to rice blast. Editing this gene provides a potential endogenous gene target for breeding resistant varieties and controlling the occurrence of rice blast fungus.

[0021] The plant material mentioned above is rice, specifically the rice variety Zhonghua 11 in this invention.

[0022] The above-mentioned CRISPR / Cas9 editing target nucleotide sequence (sgRNA sequence) is shown in SEQ ID NO.3.

[0023] The promoter for initiating transcription of the OsWR1 coding gene in the aforementioned recombinant expression vector can be the ubiquitin promoter, the 35S promoter, or the Actin1 promoter. In this invention, the promoter for initiating transcription of the OsWR1 coding gene is specifically the maize ubiquitin promoter.

[0024] In one embodiment of the present invention, a method for cultivating disease-resistant transgenic plants is also provided, comprising: transferring the gene encoding the protein related to rice blast resistance into a target plant, and screening to obtain a susceptible transgenic plant with lower disease resistance than the target plant.

[0025] The target plant is rice; the disease resistance is rice blast resistance.

[0026] The above experiments revealed that the rice gene OsWR1 has potential applications in rice blast resistance. Specifically, knocking out the OsWR1 gene significantly improves rice blast resistance; while overexpression of OsWR1 in rice results in greater susceptibility to the disease compared to the wild type. Therefore, OsWR1 is a gene in rice that negatively regulates rice blast resistance, and editing this gene provides a potential endogenous gene target for breeding resistant varieties and controlling the occurrence of rice blast fungus. Attached Figure Description

[0027] Figure 1 Amino acid sequence alignment analysis of OsWR1 with ERF family SHN transcription factors from other species. Note: HvWIN1 (AMN10039); TdSHN1 (ANY98960); OsWR2 (XP_015641433); HvHUD (AKF40403); AtWIN1 (AAO63284); SlSHN1 (XP_004235965); MtSHN1 (XP_003609337).

[0028] Figure 2 . OsWR1 Expression patterns during rice blast infection.

[0029] Figure 3 Knockout mutant oswr1 It enhanced resistance to rice blast fungus. A is... OsWR1 Knockout mutation diagram, WT is the reference gene sequence, #4 ( OsWR1-4 ) and #6 ( OsWR1-6 ) is a knockout body oswr1 The two strains, #4 with a 7 bp deletion in the coding region and #6 with a 1 bp insertion in the coding region, are both homozygous mutants. oswr1 Furthermore, it caused premature termination of OsWR1 translation at different positions. B represents wild-type ZH11 and the mutant. oswr1 Phenotypic diagram of *Magnapordia oryzae* SZ3005-1 inoculated with scab. C shows the lesion area statistics after inoculation in B. D shows the wild-type ZH11 and the mutant. oswr1 A field survey of rice blast disease incidence in Beijing. E represents ZH11 and its mutant. oswr1Field disease index statistics. (*: P<0.05, student t-test).

[0030] Figure 4 . OsWR1 Overexpression in rice makes it more susceptible to rice blast fungus. A represents the level of overexpression in the rice plant. OsWR1 Transcriptional level detection. B represents wild-type ZH11 and... OsWR1 Phenotypic diagram of plants overexpressing the strain inoculated with *Magnapordica oryzae* SZ3005-1 via scratch inoculation. C shows the lesion area statistics after inoculation in B. D shows the lesion area of ​​wild-type ZH11 and... OsWR1 A field survey of rice blast disease incidence in overexpressing plants (Beijing). E represents ZH11 and... OsWR1 Statistical analysis of field disease index of overexpressing plants. (*: P < 0.05 **: P < 0.01, Student t-test). In the figure, #10 represents OE-10, and #22 represents OE-22.

[0031] Figure 5 . OsWR1 Knockout or overexpression of the mutant did not affect the main agronomic traits of rice. A represents wild-type ZH11 and the mutant. oswr1 The appearance of the plant during the heading stage. B represents wild-type ZH11 and the mutant. oswr1 Tillering count statistics. C represents wild-type ZH11 and mutant. oswr1 Plant height statistics. D represents wild-type ZH11 and... OsWR1 The appearance of overexpressing plants during the heading stage. E represents wild-type ZH11 and... OsWR1 Tiller number statistics of overexpressing plants. F represents wild-type ZH11 and OsWR1 Statistics on plant height of overexpressing plants. Detailed Implementation

[0032] The present invention will be further described in detail below with reference to specific embodiments.

[0033] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0034] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0035] In the quantitative experiments described below, three replicate experiments were conducted, and the average value of the results was taken.

[0036] Example 1: Rice OsWR1 Cloning of genes In the initial stage of this experiment, we used *Magnaporum oryzae* effector proteins as bait to screen rice cDNA libraries infected with *Magnaporum oryzae*. A potential candidate gene was identified, and sequencing and sequence alignment confirmed the gene as LOC_Os02g10760. LOC_Os02g10760 encodes a 205-amino acid protein, OsWR1, which belongs to the ERF family of transcription factors. Its N-terminus contains an AP2 domain (7-70 amino acids) with transcriptional regulatory activity. Based on the OsWR1 cDNA sequence, we designed a pair of amplification primers and successfully cloned OsWR1 from total cDNA in leaves of *Zhonghua 11* rice. OsWR1 The full-length CDS is 618 bp. Amino acid sequence alignment analysis of OsWR1 with ERF family SHN transcription factors from other species is as follows: Figure 1 As shown, the primer sequences used to clone the OsWR1 nucleotide sequence are as follows: OsWR1-F (SEQ ID NO.4): 5'-ATGGTACAGCCAAAGAAGAA-3', OsWR1-R (SEQ ID NO. 5): 5'-TCAGATGACAAAGCTACCCT-3'.

[0037] Since OsWR1 interacts with rice blast fungus effector proteins, it is speculated that OsWR1 may play a regulatory role in the rice immune response. OsWR1 Expression patterns during rice blast infection, such as Figure 2 As shown. OsWR1 The open reading frame nucleotide sequence of the gene is shown in SEQ ID NO.1; its encoded amino acid sequence is shown in SEQ ID NO.2. The nucleotide sequence from the 5' end of SEQ ID NO.1, positions 1-618, is the coding sequence, and its encoded amino acid sequence is shown in SEQ ID NO.2.

[0038] SEQ ID NO.1: atggtacagc caaagaagaa gtttcgtgga gtcaggcagc ggcactgggg ctcctgggtc 60 tctgagatca gacaccccct ccttaaaagg agggtgtggc tgggcacctt tgagacggcc 120 gaggaggctg cgcgagccta cgatgaggct gctgtgctga tgagtggccg caacgccaag 180 accaacttcc ccgtgcagag gaactccacc ggtgatctcg ccacggccgc agaccaggac 240 gcccgtagca atggcggtag caggaactcc tccgcgggca acctgtcaca gattctcagt 300 gctaagctcc gcaagtgctg caaggcgcca tctccgtcct taacctgcct ccgcctcgac 360 cccgagaagt cccacattgg cgtgtggcaa aagcgcgcag gggcccgtgc tgactccaac 420 tgggtgatga cggtggagct caacaaagag gtagaaccaa ctgaacctgc agctcagccc 480 acatcaacag caacagcttc gcaagtgaca atggatgatg aggaaaagat tgcgctgcaa 540 atgatcgagg agttgctgag caggagcagt ccagcttcac cctcacatgg agagggagag 600 ggtagctttg tcatctga 618 SEQ ID NO.2: MVQPKKKFRG VRQRHWGSWV SEIRHPLLKR RVWLGTFETA EEAARAYDEA AVLMSGRNAK 60 TNFPVQRNST GDLATAADQD ARSNGGSRNS SAGNLSQILS AKLRKCCKAP SPSLTCLRLD 120 PEKSHIGVWQ KRAGARADSN WVMTVELNKE VEPTEPAAQP TSTATASQVT MDDEEKIALQ 180 MIEELLSRSS PASPSHGEGE GSFVI 205 Example 2. OsWR1 Obtaining of gene knockout plants To verify OsWR1To investigate the effect of genes on rice blast resistance, we edited LOC_Os02g10760 using CRISPR / Cas9 technology. First, we designed the gRNA target sequence, selecting the sequence 5'-AGAAGAAGTTTCGTGGAGTCAGG (SEQ ID NO.3), and synthesized Oligo according to the following sequence: UP: 5'-TGATTGAGAAGAAGTTTCGTGGAGTC; LOW: 5'-AAACGACTCCACGAAACTTCTTCTCA.

[0039] Following the instructions of the CRISPR / Cas vector construction kit (Baige Gene), the synthesized Oligo was dissolved in water to a final concentration of 10 µM. 18 μL of Buffer Aneal, 1 μL of UP Oligo, and 1 μL of LOW Oligo were added. The mixture was heated at 95 °C for 3 minutes, then slowly cooled to 20 °C at approximately 0.2 °C / second. The Oligo dimer was then cloned into the CRISPR / Cas vector pBGK01 (Weimi Biotechnology (Jiangsu) Co., Ltd.), specifically by adding 2 μL of pBGK01, 1 μL of Enzyme Mix, 1 μL of Oligo dimer, and 6 μL of ddH2O. The mixture was incubated at 20 °C for 1 h. 5 μL of the reaction mixture was then added to 20 μL of DH5α competent cells and transformed into DH5α cells using a 42 °C heat shock method. Transformants validated by PCR were again sequenced and verified by Qingke Biotechnology (Beijing) Co., Ltd. The resulting knockout vector was named pBGK01- OsWR1 The transformation of rice variety Zhonghua 11 was carried out using Agrobacterium-mediated transformation. For specific transformation methods, please refer to the article "Yi Zili, Cao Shouyun, Wang Li, Chu Chengcai, Li Xiang, He Sijie, Tang Zuoshun, Zhou Puhua, Tian Wenzhong, Research on increasing the frequency of Agrobacterium-mediated transformation of rice, Acta Genetica Sinica, 2001, 28(4): 352-358". The transformed rice callus tissue was induced to differentiate and root in a culture medium containing different plant hormones, ultimately yielding candidate rice seedlings. We designed a pair of identification primers near the target site to identify the transgenic plants.

[0040] The primer sequences for identification are shown below: CR OsWR1-F (SEQ ID NO.6): 5'-CGGCACTGTAGACGCAAGTA-3', CR OsWR1-R (SEQ ID NO. 7): 5'-GGAAGTTGGTCTTGGCGTTG-3'.

[0041] The specific operation is as follows: Genomic DNA was extracted from candidate rice leaves using the CTAB method: 1) A small amount of rice leaves were chopped and placed in a protein tube containing steel balls. 650 μL of CTAB was added, and the tube was repeatedly shaken three times using a cell disruptor (4 m / s, 20 s / time); 2) The tube was incubated at 65℃ for 15 min, during which time it was manually inverted three times; then centrifuged at 12000 rpm for 15 min at room temperature; 3) The supernatant was transferred to a new tube, and an equal volume of phenolform (1:1) was added. The tube was shaken vigorously for 30 s, and then centrifuged at 12000 rpm for 15 min; 4) 400 μL of the supernatant was transferred to a new tube, and 0.6 times the volume of isopropanol was added. After mixing, the tube was incubated at -20℃ for 30 min; 5) The tube was centrifuged at 1200 rpm for 15 min at 4℃, and the supernatant was discarded; 6) The precipitate was washed with 70% ethanol and anhydrous ethanol, air-dried at room temperature, and then dissolved in 30 μL ddH2O. The target fragment was amplified using the aforementioned identification primers. The specific reaction mixture was: PCR mix: 25 μL, ddH2O: 20 μL, CR OsWR1-F primer: 2 μL, CR OsWR1-R primer: 2 μL, DNA template: 1 μL. Sequencing of the amplified fragment identified two independent gene knockout positive plants, named […]. OsWR1-4 and OsWR1-6 . OsWR1-4 A 7 bp deletion occurred in the exon. OsWR1-6 Insertion of 1 bp at the exon causes a frameshift mutation in the coding region, ultimately leading to premature termination of translation. Figure 3 A).

[0042] Example 3. OsWR1 Obtaining gene overexpression plants First, the introductory vector pENTER was constructed using homologous recombination. TM 1A- OsWR1 pENTER TM The modified 1A vector (Thermo Fisher Scientific) contains a 3×HA tag sequence at its C-terminus. Based on the vector sequence, we designed a pair of amplification primers containing vector homologous arms, and used these primers to amplify cDNA from *Zhonghua 11* rice. OsWR1 Open reading frame sequence of a gene. Introductory vector pENTER TM 1A- OsWR1 The primer sequences are as follows: (underlined parts are vector homologous arms) 1A-OsWR1-F (SEQ ID NO.8): 5'- CCAATTCAGTCGACTGGATCCATGGTACAGCCAAAGAAGAAGT-3' 1A-OsWR1-R (SEQ ID NO.9): 5'- TGCGGCCGCGAATTCGTAAGCTT GATGACAAAGCTACCCTCTC-3' PCR amplification products are obtained through a recovery and purification process. OsWR1 Gene fragment. Using the restriction enzymes Hind III and BamHI (Takara), pENTER was... TM Linearization of the 1A vector was performed using the following enzyme digestion system: Hind III: 1 μL; BamHI: 1 μL; 10× buffer: 5 μL; pENTER TM 1A (100 μg / μL): 10 μL; ddH2O: 33 μL. After reacting at 37℃ for 1 hour, the vector was recovered and purified using a small-volume agarose gel DNA recovery kit (Beijing Zhuangmeng International Biotechnology Co., Ltd., catalog number: ZP202) according to the product instructions. Homologous recombination was then performed using a homologous recombinase (Novozymes, C112). The homologous recombination system was: recombinase: 1 μL; 5× buffer: 2 μL; linearized pENTER. TM 1A vector: 1 μL; OsWR1 gene fragment: 2 μL; ddH2O: 4 μL. After incubation at 37℃ for 0.5 hours, the ligation product was transformed into *E. coli* competent cells DH5α to obtain an *E. coli* strain containing the recombinant plasmid. The plasmid was extracted using a plasmid extraction kit (Beijing Zhuangmeng International Biotechnology Co., Ltd., catalog number: ZP101) according to the manufacturer's instructions. The plasmid was sequenced and then aligned. If the sequencing was correct, the *E. coli* strain containing the recombinant plasmid was obtained. OsWR1 pENTER, the entry vector for genes TM 1A- OsWR1 Then, using Gateway™ LRClonase™ Enzyme Mix (Invitrogen, 11791019), the final expression vector pIPKb002 was constructed via Gateway recombination reaction. pIPKB002 is a vector already available in our laboratory, containing the ubiquitin promoter, hygromycin selection gene, and other necessary components. For specific vector information, please refer to the literature "Himmelbach, A.; Zierold, U.; Hensel, G.; Riechen, J.; Douchkov, D.; Schweizer, P.; Kumlehn, J. A set of modular binary vectors for transformation of cereals".Plant Physiology "2007, 145, 1192–1200." This document is available to the public from China Agricultural University. The Gateway recombination reaction system consists of: the entry vector pENTER... TM 1A- OsWR1 (50 ng / μL): 3 μL; expression vector pIPKB002 (150 ng / μL): 0.5 μL; TE buffer (pH 8.0): 0.5 μL; LR Clonase™ II enzyme mix: 1 μL. After mixing, the mixture was incubated at 25°C for 1 hour. The ligation product was then transformed into *E. coli* competent cells DH5α to obtain an *E. coli* strain containing the recombinant plasmid. The plasmid was extracted using a plasmid extraction kit (Beijing Zhuangmeng International Biotechnology Co., Ltd., catalog number: ZP101-1) according to the manufacturer's instructions; this resulted in pIPKB002-. OsWR1 Carrier of expression.

[0043] Then the above expression vector pIPKB002- OsWR1 Agrobacterium strain EHA105 (Zhuangmeng, ZK294) was introduced into embryogenic callus of the rice variety Zhonghua 11. After screening and differentiation, several candidate lines were obtained from the transformed callus. Genomic DNA of the transgenic rice was extracted using the method described in Example 2, and the hygromycin phosphotransferase gene (HPTII) fragment in the transgenic rice was detected using the following primers.

[0044] HPT-F (SEQ ID NO.10): 5'-GCTGCGCCGATGGTTTCTACAA-3' HPT-R (SEQ ID NO.11): 5'-CACGGCCTCCAGAAGAAGATGTTG-3' Plants with a PCR amplification product of 514 bp were identified as transgenic positive plants. Preliminary PCR identification revealed 15 transgenic overexpression lines.

[0045] We further investigated the overexpression lines... OsWR1 Transcriptional levels were detected. The T0 generation obtained above was used for transduction. OsWR1 Using rice lines and wild-type Zhonghua 11 as materials, real-time quantitative PCR analysis was performed. ACTIN1The gene (LOC_Os03g50885) was used as an internal control. The specific steps are as follows: 100 mg of leaf tissue from the same part of the overexpressing plant and wild-type Zhonghua 11 rice was quickly placed in a pre-cooled mortar and thoroughly ground with liquid nitrogen. Total RNA was extracted from the ground tissue using the KK Fsat PlantTotal RNA Kit (Zhuangmeng; ZP405K), followed by reverse transcription using the Evo M-MLV RT Kit (Aikerui; AG11603). Finally, quantitative detection was performed using real-time quantitative PCR technology according to the manufacturer's (TaKaRa) instructions. The specific reaction system was: Real-time PCR mix: 10 μL; primer-F: 0.5 μL; primer-R: 0.5 μL; ddH2O: 8 μL; reverse transcription product: 1 μL. Detection was performed using a real-time quantitative PCR instrument (ABI 7500, USA). OsWR1 The relative transcription level of the gene. Specific primer sequences are shown below. Data processing used the Comparative Ct method, where Ct is the number of cycles required for the fluorescence signal in the PCR tube to reach a set threshold, ΔCt = Ct (test gene) – Ct (internal reference gene), expressed in 2^( ... -ΔCt The value measures the level of gene transcription.

[0046] qRT OsWR1-F (SEQ ID NO.12): 5'- CCAAAGAAGAAGTTTCGTGGAG -3' qRT OsWR1-R (SEQ ID NO.13): 5'-CTTTTAAGGAGGGGTGTCTG -3' qRT OsACTIN-F (SEQ ID NO.14): 5'-CTTCATAGGAATGGAAGCTGCGGGTA-3' qRT OsACTIN-R (SEQ ID NO.15): 5'-CGACCACCTTGATCTTCATGCTGCTA-3' The test found that in 15 transgenic overexpression lines OsWR1 The transcriptional levels of the genes were significantly increased. We selected two lines, OE-10 and OE-22, for subsequent experiments. As can be seen from Figure 4A, compared with the wild-type variety Zhonghua 11, OsWR1 Overexpression in rice lines OE-10 and OE-22 OsWR1 The transcriptional level of genes was significantly increased.

[0047] Example 4, Knockout oswr1 strains andOsWR1 Identification of blast resistance phenotypes in overexpressed rice lines To determine the resistance of the above rice lines to rice blast, we first used a leaf-scraping inoculation method. Wild-type Zhonghua 11 and knockout rice lines with good growth were used for inoculation. oswr1 strains and OsWR1 For overexpression strains of rice (four-leaf stage), leaves are used as the host. The middle portion of the second leaf (from top to bottom) is mainly harvested. The leaf is laid flat, upper side up, and the epidermis is gently scratched with a needle tip (generally 3-5 scratches). A concentration of 5-10 × 10⁻⁶ is prepared using 0.025% Tween solution. 4 Prepare a spore suspension of *Magnapordica oryzae* at a concentration of 10 μL / mL and place 10 μL of the suspension on the wound of the leaf. Keep the soil moist and incubate in the dark at 28°C for 36 hours, then switch to light. Repeat the inoculation process with at least 10 leaves each time. Observe the disease development on the leaves and take photos for statistical analysis 3-5 days after inoculation. Knockout cells were found after inoculation. oswr1 The affected leaf area was significantly smaller than that of wild-type rice (Figure 3B), indicating that... OsWR1 Gene knockout mutations can significantly enhance rice's resistance to rice blast.

[0048] The overexpressing plants had larger lesion areas compared to the wild type (Figure 4B). We also used ImageJ software to measure the lesion area; specific methods are described in the software tutorial. Compared to wild-type rice leaves, the knockout mutant… oswr1 The area of ​​lesions on the leaves was significantly reduced (C in Figure 3), while OsWR1 The lesion area on the gene-overexpressing lines was significantly increased (C in Figure 4).

[0049] To further identify the blast resistance phenotype of transgenic rice, we also tested wild-type rice and knockout rice in diseased nurseries in the field. oswr1 strains and OsWR1 Overexpression lines were used to investigate resistance to rice blast. Disease surveys and photographic sampling were conducted during the rice heading stage, and knockout mutants were identified. [[ID=z77]]oswr1 The number and area of ​​lesions on the leaves were significantly smaller than those on wild-type leaves. Figure 3 (D), and OsWR1 The number and area of ​​lesions in the gene-overexpressing lines were significantly larger than those in the wild-type leaves (Figure 4, D). Based on the area and number of lesions, the disease severity of leaves was classified into 1-9 levels. The disease index was calculated using the formula: [Sum of disease severity levels of all tillers / (Sum of tiller numbers × Highest disease severity level)] × 100%. Through investigation and calculation, it was found that knockout rice... oswr1 The disease index of the rice was significantly lower than that of wild-type rice (E in Figure 3), while OsWR1The disease index of the gene overexpression lines was significantly higher than that of wild-type rice (E in Figure 4).

[0050] Example 5. Knockout oswr1 and OsWR1 Determination of major agronomic traits of rice by overexpression Observe wild-type ZH11 and knockout rice at the heading stage. [[ID=z84]]oswr1 and OsWR1 Field phenotypes of overexpressing lines. Compared to the wild type, there were no significant changes in agronomic traits between knockout and overexpressing plants. Furthermore, in the absence of rice blast fungus inoculation, there were no significant differences in tiller number and plant height between knockout and overexpressing plants compared to the wild type. Figure 5 It should be noted that there seems to be a misspelling in the tag [[ID=z77]] and [[ID=z84]] in the original text. It is recommended to check and correct them if possible. ).

[0051] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made within the scope of the claims of the present invention should be included in the scope of the present invention.

Claims

1. The rice blast resistance-related proteins are as follows: A1) or A2): A1) The amino acid sequence is that of the protein listed in SEQ ID NO.2; A2) A protein having the same function as the protein shown in Sequence 2, by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO.2 in the sequence listing.

2. The gene encoding the rice blast resistance-related protein as described in claim 1; Preferably, the encoding gene is as follows: 1) or 2) or 3) or 4): 1) The coding sequence is the cDNA or DNA molecule located at positions 1-618 of sequence 1 in the sequence listing; 2) The cDNA or DNA molecule shown in sequence 1 of the sequence listing; 3) Having 75% or more identity with the nucleotide sequence defined in 1) or 2), and encoding a cDNA molecule or DNA molecule that encodes the rice blast resistance-related protein as described in claim 1; 4) Hybridizes under stringent conditions to the nucleotide sequence defined in 1) or 2) and encodes a cDNA molecule or DNA molecule that encodes the rice blast resistance-related protein as described in claim 1.

3. The application of the rice blast resistance-related protein as described in claim 1 in regulating the resistance of rice to rice blast.

4. The use of biomaterials related to the rice blast resistance-associated protein described in claim 1 in regulating the resistance of rice to rice blast; said biomaterial is any one of B1) to B9) below: B1) A nucleic acid molecule encoding the rice blast resistance-related protein as described in claim 1; B2) An expression cassette containing the nucleic acid molecule described in B1); B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3); B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2); B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2); B7) Transgenic plant organs containing the nucleic acid molecules described in B1), or transgenic plant organs containing the expression cassette described in B2); B8) Nucleic acid molecules that inhibit the expression of the gene encoding the rice blast resistance-related protein as described in claim 1; B9) Expression cassettes, recombinant vectors, recombinant microorganisms or transgenic plant cell lines containing the nucleic acid molecules described in B8).

5. The application according to claim 4, characterized in that: B1) The nucleic acid molecule is either 1), 2), 3), or 4) as follows: 1) The coding sequence is the cDNA or DNA molecule located at positions 1-618 of sequence 1 in the sequence listing; 2) The cDNA or DNA molecule shown in sequence 1 of the sequence listing; 3) Having 75% or more identity with the nucleotide sequence defined in 1) or 2), and encoding a cDNA molecule or DNA molecule that encodes the rice blast resistance-related protein as described in claim 1; 4) Hybridizes under stringent conditions to the nucleotide sequence defined in 1) or 2) and encodes a cDNA molecule or DNA molecule that encodes the rice blast resistance-related protein as described in claim 1.

6. The use of the rice blast resistance-related protein or its encoding gene as described in claim 1 as a target for screening pesticides resistant to rice blast.

7. Methods for cultivating disease-resistant transgenic plants, including: Suppressing the expression of the gene encoding the protein related to rice blast resistance as described in claim 1 in the target plant yields a transgenic plant with higher disease resistance than the target plant; preferably, the target plant is rice; and the disease resistance is rice blast resistance.

8. Methods for cultivating disease-resistant transgenic plants, including: The gene encoding the protein related to rice blast resistance as described in claim 1 is transferred into the target plant, and susceptible transgenic plants with lower resistance than the target plant are screened; preferably, the target plant is rice; the disease resistance is rice blast resistance.

Images