Gene type3AF for regulating and controlling resistance of rice sheath blight disease as well as encoding protein and application of gene type3AF
By regulating the rice sheath blight resistance gene type3AF and using CRISPR/Cas9 technology for gene knockout or overexpression, the environmental pollution and drug resistance problems caused by chemical control have been solved, achieving efficient and green control of rice sheath blight and breeding improvement without significant changes in agronomic traits.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- YANGZHOU UNIV
- Filing Date
- 2026-03-16
- Publication Date
- 2026-05-01
AI Technical Summary
Current technologies for controlling rice sheath blight mainly rely on chemical methods, which are costly, pollute the environment, and easily lead to drug resistance in pathogens, making it difficult to effectively control the occurrence of the disease.
By identifying and regulating the rice sheath blight resistance gene type3AF, and then using CRISPR/Cas9 technology for gene knockout or overexpression, the resistance of rice to sheath blight can be enhanced.
It significantly enhances rice's resistance to sheath blight without affecting major agronomic traits, providing a genetically modified-free breeding improvement pathway to achieve green pest control and yield enhancement.
Smart Images

Figure CN121950846A_ABST
Abstract
Description
A gene type3AF that regulates resistance to rice sheath blight, its encoded protein, and its applications. Technical Field
[0001] This invention belongs to the field of genetic engineering technology, and in particular relates to a gene type3AF that regulates rice resistance to sheath blight, its encoded protein, and its applications. Background Technology
[0002] Rice sheath blight, caused by *Rhizoctonia soalni* Kühn, is an important fungal disease and one of the three major diseases affecting rice. In recent years, with increased nitrogen fertilizer use, the promotion of dwarf and high-density planting varieties, and higher planting density, the frequency and severity of this disease in the field have continued to rise, making it the disease causing the greatest yield loss in rice, with a significantly greater impact than rice blast and rice false smut. Currently, chemical control remains the primary method in production, but it suffers from high costs, environmental pollution, and the potential to induce drug resistance in pathogens, leading to a continuous decline in its effectiveness over the long term. Therefore, utilizing molecular biology techniques to discover endogenous disease-resistant genes in rice and using these genes to cultivate new disease-resistant varieties is the most effective way to achieve green control of rice sheath blight while simultaneously increasing yield and ensuring ecological safety. Summary of the Invention
[0003] Purpose of the invention: In order to solve the above-mentioned technical problems, the present invention aims to provide a type3AF gene that can regulate rice resistance to sheath blight; by regulating the function of the type3AF gene, the resistance of rice to sheath blight can be effectively improved, thereby alleviating the technical problem of the difficulty in controlling sheath blight in rice production practice.
[0004] This invention also provides the encoded protein, vector, and application of the rice sheath blight resistance gene type3AF.
[0005] Technical solution: In order to achieve the above objectives, the present invention provides a gene type3AF for regulating rice resistance to sheath blight, wherein the CDS sequence of the gene type3AF is shown in SEQ ID NO.1.
[0006] The full-length sequence of the gene type3AF, which is related to rice resistance to sheath blight, is shown in SEQ ID NO.2.
[0007] The present invention relates to a protein encoded by the rice sheath blight resistance gene type3AF, the amino acid sequence of which is shown in SEQ ID NO.3.
[0008] The gene knockout vector pCXUN-Cas9-type3AF that regulates the rice sheath blight resistance gene type3AF is described in this invention.
[0009] Furthermore, the gene knockout vector pCXUN-Cas9-type3AF is constructed by designing and synthesizing an sgRNA that recognizes the target site: AGAACACCTCCTCACGGAGC, which is then ligated into the pCXUN-Cas9 vector by enzyme digestion, and finally obtained by transformation with Escherichia coli and Agrobacterium tumefaciens.
[0010] The present invention describes the overexpression vector pCAMBIA1390-type3AF for regulating the rice sheath blight resistance gene type3AF.
[0011] Furthermore, the overexpression vector pCAMBIA1390-type3AF is constructed by amplifying the CDS sequence of type3AF, ligating it into the pCAMBIA1300 vector, transforming it, extracting the plasmid, and finally obtaining the overexpression vector pCAMBIA1300-type3AF.
[0012] The application of the CDS sequence of the gene type3AF, the full-length sequence of the gene type3AF, the encoded protein, the gene knockout vector, or the overexpression vector described in this invention in regulating resistance to rice sheath blight.
[0013] Furthermore, editing the type3AF gene in rice using CRISPR / Cas9 increased its resistance to sheath blight; overexpression of the rice type3AF gene did not result in a significant difference in its resistance to sheath blight.
[0014] Furthermore, the application of the CDS sequence of the gene type3AF, the full-length sequence of the gene type3AF, the encoded protein, the gene knockout vector, or the overexpression vector of the present invention in the cultivation of rice germplasm resistant to sheath blight.
[0015] This invention relates to the application of the protein encoded by gene type3AF, wherein the application is any one of the following:
[0016] (1) Application in regulating rice sheath blight resistance;
[0017] (2) The amino acid sequence shown in SEQ ID NO.3 is formed by substitution, deletion and / or addition of one or more amino acid residues, and is derived from rice and has the same biological function as the protein shown in SEQ ID NO.3.
[0018] When the expression level and / or activity of the type3AF protein described in this invention are reduced, the resistance of the target plant to sheath blight is significantly enhanced.
[0019] When the expression level and / or activity of the type3AF protein described in this invention are increased, the resistance of the target plant to sheath blight is also significantly enhanced.
[0020] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages:
[0021] This invention identifies a novel gene, type3AF, that regulates rice resistance to rice sheath blight. This type3AF gene negatively regulates rice resistance to rice sheath blight; overexpression of this gene shows no significant difference in resistance to rice sheath blight, while knockout of this gene significantly enhances rice resistance to sheath blight. This invention compares the transgenic lines of this gene with wild-type controls in terms of plant height, panicle number, grains per panicle, seed setting rate, and thousand-grain weight. The results show that the main agronomic traits of the transgenic knockout lines did not change significantly. This demonstrates that transgenic-free materials with enhanced resistance to rice sheath blight can be obtained through gene knockout. This method enables breeding improvement without transgenic components and has significant application value in rice breeding for resistance to rice sheath blight. Attached Figure Description
[0022] Figure 1 shows the induction, tissue-specific expression pattern analysis, and relative overexpression level of the rice type3AF gene. A represents the expression pattern of the type3AF gene in various rice tissues; B represents the expression pattern of the rice type3AF gene in response to Sheath blight infection; and C represents the RNA expression levels of the type3AF gene in two overexpression lines in the leaf sheath tissue.
[0023] Figure 2 is a schematic diagram of two knockout lines of the type3AF gene;
[0024] Figure 3 shows the phenotypic identification of detached stem sheath blight in two knockout and two overexpression lines of the type3AF gene, as well as the wild type. A represents the phenotypic identification of detached stem sheath blight, and B represents the lesion length for detached sheath blight resistance identification. *** indicates a significance level of P < 0.001.
[0025] Figure 4 shows the phenotypic identification of greenhouse stem blight in two knockout and two overexpression lines of the type3AF gene, as well as the wild type. A represents the phenotypic identification of greenhouse stem blight, and B represents the lesion length for greenhouse stem blight resistance identification. *** indicates a significance level of P < 0.001.
[0026] Figure 5 shows phenotypic images of agronomic traits (plant type, panicle type, and grain type) of two knockout lines, two overexpression lines, and the wild type; where A is the plant type image, B is the panicle type image, and C is the grain type image.
[0027] Figure 6 shows the agronomic traits of the two knockout and two overexpression lines of the type3AF gene in terms of plant height (A), effective tiller number (B), grain length (C), grain width (D), flag leaf length (E), and thousand-grain weight (F); * indicates multiple comparison results at the P<0.05 level, and ** indicates significance level P<0.01. Detailed Implementation
[0028] The technical solution of the present invention will be further described below with reference to the accompanying drawings.
[0029] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.
[0030] Experimental methods not specified in the examples are generally performed under standard conditions or as recommended by the manufacturer.
[0031] The gene sequences and rice genetic transformation materials used in this invention are all from the rice cultivar NIP (Nipponbare), which is susceptible to rice sheath blight and was provided by the Rice Germplasm Resource Bank of Yangzhou University.
[0032] The highly pathogenic *Rhizoctonia solani* strain RH-9 used in this invention is a known strain and was provided by Yangzhou University (see Theoretical and Applied Genetics, 2013, 126:1257-1272).
[0033] Example 1
[0034] Identification and cloning of type3AF gene
[0035] To investigate the resistance mechanism of rice to sheath blight, this invention selected 179 rice varieties from different regions of China, Japan, and South Korea as experimental materials, and conducted whole-genome resequencing and in vitro sheath blight resistance identification. Based on the obtained phenotypic and genotypic data, genome-wide association analysis (GWAS) was performed, locating a significantly associated region on rice chromosome 11 that is associated with sheath blight resistance. Combining transcriptome data from seven rice varieties constructed in the applicant's laboratory before and after sheath blight infection, all annotated genes within this associated region were screened and analyzed, ultimately identifying the gene type3AF, which is significantly associated with sheath blight resistance. This gene exhibits an up-regulation followed by down-regulation expression pattern after sheath blight infection. Based on this, this invention further conducted gene knockout and overexpression functional verification studies on this gene.
[0036] The cloning method for the type3AF gene includes the following steps:
[0037] Using the NIP genome as a reference sequence, PCR amplification primers for the type3AF gene were designed:
[0038] type3AF-F:
[0039] 5'-CCATTTACGAACGATAGCCGGTACCATGGCGGGCAAAGGAGGAG-3',
[0040] type3AF-R:
[0041] 5'-CTACTTCAAGCACAGTCCGAAGGGGATCCGATTACAAAGATCATGAT-3',
[0042] Using cDNA from NIP rice leaf sheath tissue at the late tillering stage as a template, PCR amplification was performed, and the PCR amplification products were recovered, purified, and sequenced.
[0043] The CDS sequence of the rice type3AF gene of this invention is shown in SEQ ID NO.1, the amino acid sequence of the encoded protein is shown in SEQ ID NO.3, and the full length of the gene is shown in SEQ ID NO.2.
[0044] Example 2
[0045] Expression characteristics analysis of type3AF gene
[0046] Root, stem, leaf, leaf sheath, and panicle tissues from susceptible rice variety NIP during the booting stage were selected as materials, and RNA was extracted from each tissue. Invitrogen's Trizol reagent was used to complete RNA extraction according to its instruction manual. Then, Promega's RNase-free DNase I was used to remove genomic DNA contamination according to the kit instructions. Subsequently, the first strand of cDNA was synthesized using TaKaRa's PrimeScript RT reagent Kit with gDNA Eraser, following the instructions: 37℃ for 30 min, 85℃ for 5 sec, and storage at 4℃. Using the cDNA from each tissue as a template, the rice Actin gene was used as an internal reference gene (primer sequences: forward primer F: 5'-TGTATGCCAGTGGTCGTACCA-3, reverse primer R: 5'-CCAGCAAGGTCGAGACG AA-3').
[0047] Real-time quantitative PCR was performed using type3AF gene-specific primers (Qtype3AF-F: 5'-ATGCCCGCAAGAGGAAGAAT-3'; Qtype3AF-R: 5'-GTGAGGAGGTGTTCTATGGCC-3') to detect the expression specificity of the type3AF gene in different rice tissues. The real-time quantitative PCR reaction conditions were: pre-denaturation at 95℃ for 2 min; followed by 40 cycles of amplification with cycling parameters of 95℃ for 15 sec, 60℃ for 10 sec, and 72℃ for 10 sec.
[0048] NIPs were cultured under normal field conditions until the late tillering stage and then inoculated with *Rhizoctonia solani*. The highly pathogenic *Rhizoctonia solani* strain RH-9 was used to inoculate rice. The inoculation method was employed (Acta Botanica Sinica, 2020, 55: 577-587). A 1cm long and 2mm wide piece of wood bark covered with *Rhizoctonia solani* hyphae (ideally, completely covered with hyphae) was carefully inoculated into the leaf sheath 1-2cm below the second leaf from the top of the rice plant. Leaf sheath tissue, 1cm above and below the inoculation site, was harvested before inoculation (0h) and at 3h, 6h, 9h, 12h, 24h, 36h, and 48h after inoculation. These tissues were then flash-frozen in liquid nitrogen and stored for later use. The procedures for RNA extraction, cDNA reverse transcription, and quantitative real-time PCR (qRT-PCR) were consistent with the methods described above for detecting gene expression levels in different rice tissues. As shown in Figure 1, type3AF showed the highest expression level in root tissue, followed by high expression levels in leaves and leaf sheaths (Figure 1A). Furthermore, after infection with *Rhizoctonia solani*, the type3AF gene exhibited a pattern of initial upregulation followed by downregulation (Figure 1B). The expression level of the type3AF gene in transgenic overexpression lines was significantly higher at the RNA level than in wild-type plants (Figure 1C). This demonstrates that the type3AF gene is closely related to resistance to rice sheath blight.
[0049] Example 3
[0050] Vector construction and genetic transformation to construct type 3AF transgenic materials
[0051] 1. Steps for constructing a CRISPR / Cas9 knockout vector using the rice type3AF gene:
[0052] (1) For the rice type3AF gene sequence, we screened efficient knockout target sites, designed and synthesized specific sgRNAs with the following nucleotide sequence: 5'-AGAACACCTCCTCACGGAGC-3'.
[0053] (2) The pCXUN-Cas9 vector (refer to Chinese invention patent CN108949805A) was selected, and the specific restriction endonuclease KpnⅠ (Takara) was used to digest the vector to obtain the linearized vector fragment. After verifying the digestion effect by agarose gel electrophoresis, the linearized vector was recovered and purified.
[0054] (3) Prepare the recombinant reaction mixture according to the following system: 4 μL sgRNA, 2 μL linearized vector template after enzyme digestion, 1 μL Exnase II recombinase (Novizan Biotechnology Co., Ltd.), 2 μL 5×CEII Buffer (Novizan Biotechnology Co., Ltd.), and 1 μL sterile deionized water, for a total volume of 10 μL. Place the mixture in a PCR instrument and set the program to react at 37℃ for 30 min. After the reaction, quickly place it on ice to cool and store.
[0055] (4) The constructed recombinant vector plasmid was added to competent E. coli cells and incubated on ice for 30 min; then heat-shocked in a 42℃ water bath for 90 s, and immediately transferred to ice and allowed to stand for 3-5 min; 600 μL of sterile liquid LB medium was added to a centrifuge tube in a clean bench, mixed well, and then incubated at 37℃ and 200 rpm for 1 h. The revived bacterial solution was centrifuged at 5000 rpm for 3 min, 500 μL of supernatant was discarded, the remaining bacterial solution was resuspended, and evenly spread on LB solid medium plates containing kanamycin. The plates were incubated upside down in a 37℃ incubator for about 12 h.
[0056] (5) Randomly select 12 single colonies from the cultured LB plates and inoculate them into 500 μL of liquid LB medium containing kanamycin. Incubate at 37°C and 200 rpm for 6 h. Use 5 μL of the bacterial culture as a template and perform PCR identification using specific primers. The primer sequences are as follows:
[0057] Upstream primer (type 3AF-KO-F): 5'-TGTAAAACGACGGCCAGT-3'
[0058] Downstream primer (type 3AF-KO-R): 5'-AGAACACCTCCTCACGGAGC-3'
[0059] PCR-positive clones were screened and sequenced for verification. Positive clones with completely correct sequences were selected, and recombinant plasmids were extracted using the EZNATMPlasmid Midi Kit (OMEGA) according to the kit instructions. The plasmids were then stored at -20°C for later use.
[0060] (6) After the knockout vector was constructed, the recombinant plasmid was transformed into EHA105 Agrobacterium competent cells by electroporation. Single colonies were picked and cultured by shaking. After the bacterial culture was confirmed by PCR, the Agrobacterium engineered strain pCXUN-Cas9-type3AF was obtained. Glycerol with a final concentration of 20% was added to the bacterial culture and stored at -80℃ for later use.
[0061] 2. The construction steps of the overexpression vector are as follows:
[0062] (1) Using cDNA from leaf sheath tissue of NIP at the late tillering stage as a template, primers for amplifying the type3AF gene were designed, and the recombinant adapter sequence from the vector was added to the 5' end of the front and back primers, respectively. The primer sequences are as follows:
[0063] type3AF-F:5'-CCATTTACGAACGATAGCCGGTACCATGGCGGGCAAAGGAGGAG-3',
[0064] type3AF-R:5'-CTACTTCAAGCACAGTCCGAAGGGATCCGATTACAAAGATCATGAT-3',
[0065] PCR amplification was performed using high-fidelity DNA polymerase. The reaction program was set as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 1 min, for a total of 35 cycles; and a final extension at 72℃ for 5 min. After the reaction, the amplified products were stored at 4℃.
[0066] (2) The overexpression vector pCAMBIA1390 containing a strong Ubi promoter was selected, digested with restriction endonuclease PstⅠ, and the linearized vector was recovered and purified after verification by agarose gel electrophoresis and stored at -20℃ for later use. The PCR-amplified type3AF gene fragment was ligated with the linearized pCAMBIA1390 vector using the ClonExpress II One Step Cloning Kit (Novizan Biosciences) to construct a recombinant overexpression vector. The ligation product was transformed into competent E. coli cells, and after ice bath, heat shock and recovery, it was plated on LB solid medium containing kanamycin and incubated upside down at 37℃ for 12 h. Single clones were picked for bacterial PCR identification, and positive clones were sent for sequencing verification. The pCAMBIA1390-type3AF overexpression vector was obtained after the sequence was correct.
[0067] (3) After the overexpression vector was constructed, the recombinant overexpression plasmid was transformed into EHA105 Agrobacterium competent cells by electroporation. Single clones were picked and cultured in a shake culture. After the bacterial culture was confirmed by PCR, glycerol with a final concentration of 20% was added to the bacterial culture and stored at -80℃ for later use. The Agrobacterium engineered strain pCAMBIA1390-type3AF was obtained.
[0068] The constructed CRISPR / Cas9 knockout vector plasmid (pCXUN-Cas9-type3AF) and overexpression vector plasmid (pCAMBIA1390-type3AF) were used in rice genetic transformation experiments by Wuhan Boyuan Biotechnology Co., Ltd. Nipponbare (NIP) was selected as the recipient rice variety, and transgenic rice plants were obtained. The primer sequences for detecting the overexpression vector were: type3AF-OE-F: CCAGATTAGGGATGAGAGGAG, type3AF-OE-R: GTCGTGGTCCTTATAGTCACCATC.
[0069] The genetic transformation of the transgenes of this invention was obtained by Wuhan Boyuan Biotechnology Co., Ltd. using conventional transgene technology experiments. A total of two transgene knockout lines were obtained, named type3AF-KO1 and type3AF-KO2, respectively. Sequencing detection showed, as shown in Figure 2, that there were two types of mutations in the transgene knockout lines. Type3AF-KO1 had an insertion of one T base and a deletion of four ACGG bases, while type3AF-KO2 had a deletion of two GG bases. In addition, two independent T0 generation transgene overexpression lines were obtained by qRT-PCR, named type3AF-OE1 and type3AF-OE2, respectively. The primer sequences for qRT-PCR were Qtype3AF-F: ATGCCCGCAAGAGGAAGAAT and Qtype3AF-R: GTGAGGAGGTGTTCTATGGCC.
[0070] Example 4
[0071] Identification of sheath blight resistance in transgenic rice plants
[0072] Resistance to sheath blight was identified in wild-type (WT, NIP (Nipponbare)), knockout lines (type3AF-KO1, type3AFKO-2), and overexpression lines (type3AF-OE1, type3AF-OE2) of this gene using both greenhouse inoculation and in vitro inoculation methods.
[0073] The identification of resistance to sheath blight and the inoculation method were carried out according to the method described in previous studies (Acta Botanica Sinica, 2020, 55: 577-587). Rice was inoculated using the highly pathogenic sheath blight fungus strain RH-9. The sheath blight fungus was first cultured on potato dextrose agar at 28°C for 3 days. Then, fungal blocks (about 0.5 cm in diameter) were transferred to potato dextrose broth containing 1.0 cm long and 2 mm wide bark and grown at 28°C for about 3 days until the mycelium completely covered the bark. The bark colonized by the mycelium was used as inoculum.
[0074] The method for identifying resistance to in vitro sheath blight is as follows:
[0075] For inoculation with detached stem materials, detached stems were sampled from rice plants at the early panicle stage. Stems from each plant, as well as wild-type plants, were cut off, leaving only the flag leaf and the second leaf from the top. These were then placed in water overnight to allow the rice to acclimatize to the climatology chamber environment and prevent water loss. The next day, inoculation was performed using the same embedding method. A piece of wood bark, 1.0 cm long and 2 mm wide, coated with *Rhizoctonia solani* mycelium (enough to be fully covered with mycelium), was carefully placed 1 cm below the leaf sheath of the second leaf from the top. After inoculation, the stems were inserted into test tubes containing floral foam and then transferred to a nutrient solution. The plants were then placed in an environment with 14 hours of light (30℃), 10 hours of darkness (26℃), and 90% humidity. Eight to ten detached stems were collected from each line, and the length of lesions was assessed seven days after inoculation.
[0076] The method for identifying resistance to greenhouse sheath blight is as follows:
[0077] When the rice plants reach the 8-10 tillering stage, transplant them into long pots, 5 plants per pot. Newly dug seedlings need to be placed in a cool, shaded area (low light) for 3-4 days to aid recovery and survival. After 3-4 days, prune the seedlings, removing small tillers, withered leaves, and rotten leaf sheaths at the base, retaining 8-10 main stems. After pruning, move the seedlings from the shaded area to the outdoors for 5-7 days to grow normally. Three days before inoculation, move the seedlings that are growing normally outdoors to the greenhouse and fertilize appropriately. Set the greenhouse temperature and light conditions to 14 hours of light (30℃) and 10 hours of darkness (24℃), and use a misting system for indoor humidification. Inoculation was carried out when the rice plants reached the late booting stage. The inoculation method was manual embedding. A piece of bark, 1 cm long and 2 mm wide, covered with mycelium of *Rhizoctonia solani* (enough to be fully coated with mycelium), was carefully placed on the leaf sheath 1 cm below the second leaf from the bottom. Five seedlings were inoculated per pot, and five stems of relatively consistent growth stages were inoculated on each seedling. The length of lesions was investigated 14 days after inoculation.
[0078] When in vitro inoculation was used, as shown in Figures 3 (A and B), the average lesion length of the two transgenic overexpression lines type3AF-OE1 and type3AF-OE2 (10.69 cm and 10.06 cm, respectively) was not different from that of the wild-type plant (10.36 cm), while the average lesion length of the two transgenic knockout lines type3AF-KO1 and type3AF-KO2 (7.6 cm and 7.19 cm, respectively) was significantly lower than that of the wild-type plant (10.36 cm).
[0079] When artificial inoculation was performed in a greenhouse, as shown in Figures 4 (A and B), the average lesion length of the two transgenic overexpression lines, type3AF-OE1 and type3AF-OE2 (19.28 cm and 19.08 cm, respectively), was not different from that of the wild-type plant (20.47 cm). However, the average lesion length of the two transgenic knockout lines, type3AF-KO1 and type3AF-KO2 (14.22 cm and 15.01 cm, respectively), was significantly lower than that of the wild-type plant (20.47 cm). These results indicate that the gene type3AF negatively regulates rice sheath blight resistance, and knocking out or silencing this gene can significantly improve rice sheath blight resistance.
[0080] Example 5
[0081] Agronomic traits of transgenic rice plants
[0082] In field trials, the main agronomic traits of each transgenic line of the type3AF gene were investigated at the rice maturity stage. Plant height, number of effective tillers, grain length, grain width, flag leaf length, and thousand-grain weight were measured on a single-plant basis in each plot. The results, shown in Figures 5 (AC) and 6 (AF), indicate that the type3AF gene knockout line (type3AF-KO) showed no significant differences in the above agronomic traits compared to the wild type, while the plant height and flag leaf length of the type3AF gene overexpression line (type3AF-OE) differed significantly from the wild type. These results demonstrate that knockout of the type3AF gene does not affect the main agronomic traits of rice, confirming the important practical application value of this gene in rice breeding for resistance to sheath blight.
Claims
1. A gene type3AF that regulates resistance to rice sheath blight, characterized in that, The CDS sequence of the gene type3AF is shown in SEQ ID NO.
1.
2. A full-length sequence of the gene type3AF as described in claim 1, characterized in that, The full-length sequence of the gene type3AF is shown in SEQ ID NO.
2.
3. A protein encoded by the gene type3AF, which regulates rice sheath blight resistance as described in claim 1, characterized in that, The amino acid sequence of the protein is shown in SEQ ID NO.
3.
4. A gene knockout vector pCXUN-Cas9-type3AF based on the rice sheath blight resistance gene type3AF as described in claim 1.
5. The gene knockout vector pCXUN-Cas9-type3AF according to claim 4, characterized in that, The gene knockout vector construction method involves designing and synthesizing an sgRNA that recognizes the target site: AGAACACCTCCTCACGGAGC, which is then ligated into the pCXUN-Cas9 vector via enzyme digestion. After transformation with E. coli and Agrobacterium, the gene knockout vector pCXUN-Cas9-type3AF is finally obtained.
6. An overexpression vector pCAMBIA1390-type3AF containing the rice sheath blight resistance gene type3AF as described in claim 1.
7. The overexpression vector pCAMBIA 1390-type3AF according to claim 6, characterized in that, The overexpression vector pCAMBIA1390-type3AF is constructed by amplifying the CDS sequence of type3AF, ligating it into the pCAMBIA1300 vector, transforming it, extracting the plasmid, and finally obtaining the overexpression vector pCAMBIA1300-type3AF.
8. The application of a CDS sequence of gene type3AF as described in claim 1, or the full-length sequence of gene type3AF as described in claim 2, or the encoded protein as described in claim 3, or the gene knockout vector as described in claim 4, or the overexpression vector as described in claim 6, in regulating resistance to rice sheath blight.
9. The application according to claim 8, characterized in that, The type3AF gene in rice was edited using CRISPR / Cas9 technology, thereby enhancing the rice's resistance to sheath blight.
10. The application of a CDS sequence of gene type3AF as described in claim 1, or the full-length sequence of gene type3AF as described in claim 2, or the encoded protein as described in claim 3, or the gene knockout vector as described in claim 4, or the overexpression vector as described in claim 6, in the cultivation of rice germplasm resistant to sheath blight.
Citation Information
Patent Citations
Plant genome multi-site editing vector pCXUN-CAS9-RGR
CN108949805A