Application of polyethylene glycol in reducing diffusion of cell contents in single-cell suspension and improving single-cell nucleic acid capture efficiency
By using appropriate concentrations and molecular weights of polyethylene glycol in single-cell suspensions, the problem of cell contents diffusion in single-cell sequencing was solved, cell capture efficiency and throughput were improved, and accurate analysis at high cell densities was ensured.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-31
- Publication Date
- 2026-05-08
AI Technical Summary
In single-cell sequencing, as the number of cells increases, the cell contents diffuse more, resulting in blurred cell outlines, making it impossible to accurately analyze the transcriptome of a single cell and reducing capture efficiency.
Cells are resuspended in a solution containing polyethylene glycol. By adding polyethylene glycol of appropriate concentration and molecular weight to the single-cell suspension, a protective film is formed to reduce the diffusion of cell contents and increase the aggregation of cells in a plane.
It effectively reduces the diffusion of single-cell contents, improves cell capture efficiency and throughput, and ensures accurate analysis of the transcriptome of a single cell at high cell density.
Smart Images

Figure BDA0005116344000000161 
Figure BDA0005116344000000171 
Figure BDA0005116344000000181
Abstract
Description
Technical Field
[0001] This invention belongs to the field of gene sequencing, specifically relating to the application of polyethylene glycol in reducing the diffusion of cell contents in single-cell suspensions and improving the efficiency of single-cell nucleic acid capture. Background Technology
[0002] With the rapid development of single-cell sequencing technology, the requirements for cell throughput in single-cell sequencing are becoming increasingly higher, with some large research projects potentially involving millions of cells. The more cells in a single-cell study, the more cell types are captured, and the more precise the differences between the studied cell subpopulations become. High-throughput single-cell sequencing, with its extremely high resolution, can accurately analyze the compositional information of sample cells. Combined with high-throughput sequencing methods, it can reveal the gene structure and gene expression status of individual cells on a large scale, reflecting intercellular heterogeneity. However, as the single-cell throughput requirements increase, different single-cell sequencing technologies encounter certain problems. For example, in planar capture-based single-cell detection, increasing throughput leads to increased single-cell RNA capture diffusion, making it impossible to separate transcriptomes between cells, resulting in high double-cell / multiple-cell rates, and making it impossible to accurately analyze the transcriptome of individual cells.
[0003] Single-cell capture technology requires the resuscitation of solid tissues or frozen cells to prepare a single-cell suspension. Current techniques primarily use PBS containing a certain percentage of bovine serum albumin (BSA) for resuscitation or use culture medium. The resuspended cells are then counted, and a specific volume of the cell suspension is added to a microarray. Using this method, when the cell count on a 1cm x 1cm microarray is 20,000 cells or less, the cell capture efficiency reaches over 70%. However, when the cell count on a 1cm x 1cm microarray increases to 40,000 or even 60,000 cells, RNA diffusion within each captured cell becomes severe, cell outlines become blurred, and it becomes impossible to accurately delineate the transcriptome of a single cell, thus affecting the cell capture efficiency.
[0004] Therefore, there is an urgent need in this field to develop a method to reduce the diffusion of cell contents in single-cell suspensions and / or improve the efficiency of single-cell nucleic acid capture. Summary of the Invention
[0005] In response to the problem in the prior art, namely the reduced cell capture efficiency when the cell input is too large in single-cell (planar) capture, the present invention unexpectedly discovered that by resuspending cells in a solution containing polyethylene glycol (PEG), the diffusion of single-cell contents can be reduced during single-cell sequencing, effectively improving cell capture efficiency and throughput.
[0006] In a first aspect, the present invention provides the use of polyethylene glycol in reducing the diffusion of cell contents in single-cell suspensions.
[0007] In a second aspect, the present invention provides the application of polyethylene glycol in improving single-cell capture efficiency.
[0008] In a third aspect, the present invention provides a kit comprising polyethylene glycol, a buffer system, a spatial chip or microbeads for capturing nucleic acids in cells, and optionally bovine serum albumin.
[0009] In a fourth aspect, the present invention provides a method for capturing nucleic acids in cells, the method comprising:
[0010] (1) Provide a single-cell suspension, said single-cell suspension comprising polyethylene glycol, a buffer system and optionally bovine serum albumin;
[0011] (2) Contact the single-cell suspension prepared in step (1) with a space chip or microbeads used to capture nucleic acids in the cells to capture nucleic acids in the cells.
[0012] This invention involves seeding cells from a single-cell suspension containing polyethylene glycol onto a solid-phase (i.e., chip) surface with probes, thereby capturing nucleic acids (such as transcriptome) within the cells using the probes on the solid-phase surface; or using microfluidic technology to bind cells from the single-cell suspension to microbeads (such as magnetic beads) with probes, thereby capturing nucleic acids (such as transcriptome) within the cells using the probes on the surface of the microbeads. Experimental results show that adding polyethylene glycol can reduce the diffusion of cell contents, making single cells more aggregated during planar capture and improving cell capture efficiency. Furthermore, because the single-cell suspension containing polyethylene glycol causes cells to aggregate more on a given area, more cells can be deployed on the same area, further increasing the throughput of single-cell sequencing. Attached Figure Description
[0013] To more clearly illustrate the technical solutions in the specific embodiments of the present invention, the accompanying drawings in the specific embodiments will be briefly described below.
[0014] Figure 1 The example shown in Example 1 is 4×10 4 Comparison of sequencing results between the control group and the experimental group after cells were placed into a 1cm*1cm chip.
[0015] Figure 2 Example 2 shows 6×10 4 Sequencing results of the control and experimental groups after cells were implanted into a 1cm*1cm chip, and the sequencing results of 7×10 cells in the chip. 4 Sequencing results of the experimental group after cells were placed into a 1cm*1cm chip. Detailed Implementation
[0016] The present invention will be described in detail below. It should be understood that the following description is merely illustrative and is not intended to limit the scope of the invention; the scope of protection of the invention is defined by the appended claims. Furthermore, those skilled in the art will understand that modifications can be made to the technical solutions of the present invention without departing from its spirit and intent. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art.
[0017] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the subject matter pertains. Before a detailed description of the invention, the following definitions are provided to better understand it.
[0018] In the context of this invention, many embodiments use the expressions "comprising," "including," or "basically / mainly composed of." The expressions "comprising," "including," or "basically / mainly composed of" should be understood as open-ended expressions, indicating that they include not only the elements, components, parts, and method steps specifically listed after the expression, but also other elements, components, parts, and method steps. Additionally, in this document, the expressions "comprising," "including," or "basically / mainly composed of" may also be understood as closed-ended expressions in certain circumstances, indicating that they only include the elements, components, parts, and method steps specifically listed after the expression, and do not include any other elements, components, parts, or method steps. In this case, the expression is equivalent to the expression "composed of."
[0019] As previously stated, one object of the present invention is to solve the problem of diffusion of cell contents (e.g., nucleic acids, proteins) in single-cell suspensions.
[0020] Another objective of this invention is to address the problem of reduced cell capture efficiency when the cell input is too large in single-cell planar capture.
[0021] Therefore, in a first aspect, the present invention provides the use of polyethylene glycol in reducing the diffusion of cell contents in single-cell suspensions.
[0022] In a second aspect, the present invention provides the application of polyethylene glycol in improving single-cell capture efficiency.
[0023] The following description applies to the application of the first and second aspects of this invention.
[0024] Polyethylene glycol is a high molecular weight polymer with the chemical formula HO(CH2CH2O). nH is formed by the stepwise addition polymerization of ethylene oxide with water or ethylene glycol. Polyethylene glycol is a non-toxic, nonionic surfactant with good biocompatibility and mild effects. In practice, the inventors have discovered that appropriate concentrations and molecular weights of polyethylene glycol help capture the intracellular transcriptome because polyethylene glycol can form a protective film on the cell surface, preventing premature cell lysis and diffusion of cell contents (e.g., RNA) before elongation reactions (e.g., reverse transcription), effectively increasing cell throughput and capture efficiency.
[0025] It is important to note that not all molecular weights of polyethylene glycol (PEG) are suitable for this invention. In this document, the molecular weight of PEG refers to the average molecular weight of PEG molecules, typically expressed as relative molecular mass or polypeptide molecular weight units (Da). In one embodiment, the average molecular weight of the PEG is 400-6000, for example, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, or any value between these values. In a preferred embodiment, the average molecular weight of the PEG is 2000. If the average molecular weight of the PEG is below 400, cell contents (including nucleic acids) will diffuse extensively during reverse transcription; if the average molecular weight of the PEG is above 6000, cells may aggregate extensively on the chip, making them undetectable.
[0026] In one embodiment, the application includes mixing polyethylene glycol, cells, and a buffer system to prepare a single-cell suspension.
[0027] The concentration of polyethylene glycol (PEG) in single-cell suspensions also affects the final detection results. It is known that at room temperature, PEG transitions from a liquid to a semi-solid state and finally to a solid state as its molecular weight increases. For example, PEG with an average molecular weight of 200-600 is liquid at room temperature, while PEG with an average molecular weight exceeding 600 gradually becomes semi-solid and then solid. Therefore, the concentration of PEG mentioned in this article can be expressed as a weight / volume ratio (w / v) or a volume / volume ratio (v / v) depending on its state. For example, when referring to liquid PEG such as PEG with an average molecular weight of 400, the concentration unit is v / v; when referring to solid PEG such as PEG with an average molecular weight of 2000, the concentration unit is w / v.
[0028] In one embodiment, the concentration of polyethylene glycol in the single-cell suspension is 0.4%-2%, for example, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 1.2%, 1.4%, 1.6%, 1.8%, 2%, or any value between these values. In a preferred embodiment, the concentration of polyethylene glycol in the single-cell suspension is 2%. If the concentration of polyethylene glycol in the single-cell suspension is below 0.4%, the cell contents (including nucleic acids) will diffuse extensively during subsequent processing, such as reverse transcription. If the concentration of polyethylene glycol in the single-cell suspension is above 2%, the cells may aggregate on the chip, making them undetectable.
[0029] In a particularly preferred embodiment, the polyethylene glycol has an average molecular weight of 2000 and a concentration of 2 w / v in the single-cell suspension.
[0030] In one embodiment, the cells may be free cells or dispersed cells obtained by dissociating fixed tissue cells. The free cells may include sperm cells, egg cells, erythrocytes, B cells, T cells, leukocytes, and peripheral blood mononuclear cells (PBMCs). In a further embodiment, the cells may be derived from mammals such as humans, mice, monkeys, sheep, goats, cattle, pigs, cats, or dogs. The dispersed cells may be derived from organs such as the heart, liver, lungs, and bone marrow, and obtained through treatment with digestive enzymes such as trypsin.
[0031] In one embodiment, the pH of the buffer system is 7.0-7.6. In a preferred embodiment, the pH of the buffer system is 7.2-7.6. In a preferred embodiment, the buffer system can be a phosphate-buffered saline (PBS) buffer system or a citrate (SSC) buffer system. As an example, the phosphate buffer system can be a 1× buffer system containing 1.44 g / L KH₂PO₄, 9 g / L NaCl, 0.795 g / L Na₂HPO₄·7H₂O, and water. As another example, the citrate buffer system can be a 0.1×-1× buffer system. In a 1× buffer system, the citrate buffer system contains 0.015 mol / L sodium citrate, 0.15 mol / L sodium chloride, and water.
[0032] In one embodiment, the application includes mixing polyethylene glycol, bovine serum albumin, cells, and a buffer system to prepare a single-cell suspension.
[0033] For technical details related to polyethylene glycol, cells, and buffer systems, please refer to the description given above, which will not be repeated here.
[0034] Bovine serum albumin (BSA) is a globulin found in bovine serum. It has wide applications in biochemical experiments. (1) BSA is used as a stabilizer in the preservation solutions and reaction solutions of restriction enzymes or modified enzymes. Some enzymes are unstable or have low activity at low concentrations; adding BSA can act as a "protector" or "carrier," and the activity of some enzymes increases significantly after adding BSA. For DNA substrates, BSA can make enzyme digestion more complete and allows for repeated digestion. (2) BSA acts as a buffer for endonucleases. (3) BSA is a stabilizer for enzymes, preventing enzyme degradation and non-specific adsorption. (4) BSA can reduce the denaturation of some enzymes, mitigating denaturation caused by adverse environmental factors such as heating or chemical factors. (5) BSA can prevent enzymes from adsorbing onto the tube wall and being lost. In single-cell suspensions, BSA is used to maintain cell viability, making cells more dispersed and preventing cell aggregation. In one embodiment, the concentration of bovine serum albumin in the single-cell suspension ranges from 0.01 w / v% to 1 w / v, for example, 0.01 w / v%, 0.02 w / v%, 0.03 w / v%, 0.04 w / v%, 0.05 w / v%, 0.06 w / v%, 0.07 w / v%, 0.08 w / v%, 0.09 w / v%, 0.1 w / v%, 0.2 w / v%, 0.3 w / v%, 0.4 w / v%, 0.5 w / v%, 1 w / v%, or any value between these values. In a preferred embodiment, the concentration of bovine serum albumin in the single-cell suspension ranges from 0.04 w / v% to 1 w / v. In a further preferred embodiment, the concentration of bovine serum albumin in the single-cell suspension is 0.04 w / v.
[0035] In this invention, the cell contents may include proteins or nucleic acids such as genomic DNA or mRNA, but are not limited thereto.
[0036] In a third aspect, the present invention provides a kit for single-cell planar capture or single-cell capture, comprising polyethylene glycol, a buffer system, a spatial chip or microbeads for capturing nucleic acids in cells, and optionally bovine serum albumin.
[0037] The descriptions of polyethylene glycol, buffer systems, and bovine serum albumin in the foregoing also apply to the third aspect of the present invention, and further details can be found in the specific description above, which will not be repeated here.
[0038] It is understood that the three components—polyethylene glycol (PEG), the buffer system, and bovine serum albumin (BSA)—can be packaged separately in the kit. Before use, PEG and BSA can be added to the buffer system to prepare a solution for cell resuspending, or the cells can be resuspended in the buffer system first, and then PEG and BSA can be added to obtain a single-cell suspension. It should also be understood that there are no restrictions on the order in which PEG and BSA are added to the buffer system; PEG can be added first, followed by BSA, or BSA can be added first, followed by PEG, or both can be added simultaneously.
[0039] In one embodiment, the microbeads can be gel microbeads or magnetic beads. In a preferred embodiment, microfluidic technology is used to construct partitions (such as water-in-oil droplets), each partition containing at least one cell and one microbead (attached to a probe). Capture and extension occur within the partitions to obtain nucleic acids barcoded by the cell. In a preferred embodiment, the microbeads are magnetic beads. Compared to ordinary microbeads, magnetic beads can be easily and quickly removed from the system using a magnet, offering significant advantages in sample processing. Microfluidics refers to the technology of manipulating microfluidics in integrated micron-scale channels. Specifically, a single-cell suspension containing PEG and a microbead suspension are pumped into a microfluidic chip; in the microfluidic chip, the two suspensions converge and form a laminar flow; the laminar flow then converges with an oil phase to form monodisperse microdroplets. Each microdroplet encapsulates one cell and one microbead, which can be used for intracellular nucleic acid extension. Subsequently, the nucleic acids barcoded by the cell are detected (e.g., sequenced), thereby classifying nucleic acids from the same cell into the same cell using cell barcoding.
[0040] In one embodiment, a probe is attached to the surface of the space chip or microbeads, and the probe includes a barcode sequence and a capture sequence in sequence from 5' to 3'.
[0041] The barcode sequence mentioned herein may also be referred to as a barcode, spatial barcode, spatial tag, cell barcode, or cell tag. The barcode sequence on the spatial chip can be used to determine the location of cells on the chip or to label nucleic acids (such as cDNA) in cells captured on the chip. The barcode sequence on the microbeads can be used to label nucleic acids in cells within different partitions (such as droplets). Therefore, barcode sequences at different locations on the spatial chip are different from each other, and barcode sequences on the surfaces of different microbeads are also different from each other. In this way, individual cells distributed at different locations on the spatial chip, or individual cells captured by different microbeads, can be labeled, thereby achieving individual cell identification. Thus, even if samples are subsequently mixed for sequencing, it can be determined that nucleic acid fragments carrying the same barcode sequence originate from the same cell. Using this strategy, information on tens of thousands of single cells can be obtained through a single library construction.
[0042] The capture sequence is used to capture nucleic acids, such as genomic DNA or mRNA, in cells. It is understood that the capture of nucleic acids by the capture sequence is based on complementary base pairing between the two. In one specific embodiment, the capture sequence can be a polyT sequence, a target-specific sequence, or a random sequence. It is known that during DNA transcription into mRNA, multiple adenine nucleotides (A) are added to the 3' end of the mRNA to form a polyA tail. Therefore, by setting the 3' end of the capture sequence to a polyT sequence formed by multiple thymine nucleotides (T), the capture sequence can capture mRNA in cells by means of complementary base pairing between nucleotides A and T. Those skilled in the art will understand that fragmentation enzymes (e.g., Tn5 transposase, DNase I, Endonuclease V, Fragmentase, etc.) can also be used to add adapter sequences (such as sequencing adapters) to genomic DNA while fragmenting it. Therefore, in one embodiment, the kit may also contain a fragmentation enzyme, and the capture sequence may be designed as a complementary sequence to the adapter sequence, thereby enabling the capture of genomic DNA.
[0043] In one embodiment, the kit can also be used to identify, quantify, and / or locate intracellular proteins based on the specific binding of proteins to their antibodies. Specifically, the kit further includes an antibody linked to an oligonucleotide, wherein the oligonucleotide comprises, from 5' to 3', a protein barcode sequence (the protein barcode sequence linked to antibodies that specifically bind to different proteins is different) and a complementary sequence to the capture sequence (i.e., the structure of the antibody linked to the oligonucleotide is: antibody-protein barcode sequence-complementary sequence to the capture sequence). The method of using the kit includes: S1: The protein to be detected binds to the antibody linked to the oligonucleotide and is subsequently identified by the protein barcode sequence; optionally, unbound antibodies are removed; S2: A probe-immobilized spatial chip or probe-immobilized microbeads are contacted with the complex of the antibody and protein linked to the oligonucleotide, the probe hybridizes to the complementary sequence of the capture sequence, and extension is performed using the probe and / or the oligonucleotide as primers to obtain a protein barcode sequence labeled by the probe's barcode sequence. Sequencing the extended sequence allows for the localization or quantification of the protein to be detected (e.g., an antigen).
[0044] In one embodiment, the probe further includes a unique molecular tag located in the 5' direction of the capture sequence.
[0045] A unique molecular identifier (UMI) is a tag consisting of a set of randomly arranged base sequences that can specifically label nucleic acid molecules in a cell. In one specific embodiment, the unique molecular identifier can specifically label mRNA molecules transcribed from a cell. Generally, probes with the same barcode sequence have different unique molecular identifiers. Reads with the same barcode, unique molecular identifier, and target sequence originate from the same original molecule, while reads with different barcodes and / or different unique molecular identifiers and / or different target sequences (derived from the cell's nucleic acid sequence or its complementary sequence) originate from different original molecules. This design of unique molecular identifiers helps subsequent data analysts track these repetitions and remove them in downstream analysis. In a preferred embodiment, the unique molecular identifier is located between the barcode sequence and the capture sequence.
[0046] During single-cell sequencing, reads with the same barcode originate from the same cell, and reads amplified from the same nucleic acid molecule (e.g., DNA or mRNA) are linked to the same UMI.
[0047] In one embodiment, the kit further comprises a chip modification solution containing polylysine (PLL) and extracellular matrix proteins (such as fibronectin and laminin). In a preferred embodiment, the chip modification solution contains 0.01% PLL and 0.005 mg / mL fibronectin.
[0048] In a fourth aspect, the present invention provides a method for capturing nucleic acids in cells, the method comprising:
[0049] (1) Provide a single-cell suspension, said single-cell suspension comprising polyethylene glycol, a buffer system and optionally bovine serum albumin;
[0050] (2) Contact the single-cell suspension prepared in step (1) with a space chip or microbeads used to capture nucleic acids in the cells to capture nucleic acids in the cells.
[0051] The provision of the single-cell suspension in step (1) can be achieved in several ways. For example, the cells can be first suspended in a buffer system, and then a specified concentration of polyethylene glycol and optional bovine serum albumin can be added to it to obtain a single-cell suspension. There is no restriction on the order in which polyethylene glycol and bovine serum albumin are added to the buffer system; these two components can be added to the buffer system in any order. As another example, the cells can be first resuspended in a buffer system with an optional concentration of bovine serum albumin, and then a specified concentration of polyethylene glycol can be added to it to obtain a single-cell suspension. As yet another example, the cells can be first resuspended in a buffer system with an optional concentration of polyethylene glycol, and then an optional concentration of bovine serum albumin can be added to it.
[0052] In one embodiment, the average molecular weight of the polyethylene glycol is 400-6000, for example, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, or any value between these values. In a preferred embodiment, the average molecular weight of the polyethylene glycol is 2000. If the average molecular weight of the polyethylene glycol is below 400, the cell contents (including nucleic acids) will diffuse extensively during reverse transcription, while if the average molecular weight of the polyethylene glycol is above 6000, the cells may aggregate on the chip, making them undetectable.
[0053] In one embodiment, the concentration of polyethylene glycol in the single-cell suspension is 0.4%-2%, for example, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 1.2%, 1.4%, 1.6%, 1.8%, 2%, or any value between these values. In a preferred embodiment, the concentration of polyethylene glycol in the single-cell suspension is 2%. If the concentration of polyethylene glycol in the single-cell suspension is below 0.4%, the cell contents (including nucleic acids) will diffuse extensively during subsequent processing, such as reverse transcription. If the concentration of polyethylene glycol in the single-cell suspension is above 2%, the cells may aggregate on the chip, making them undetectable.
[0054] In one embodiment, the cells may be free cells or dispersed cells obtained by dissociating fixed tissue cells. The free cells may include sperm cells, egg cells, erythrocytes, B cells, T cells, leukocytes, and peripheral blood mononuclear cells (PBMCs). In a further embodiment, the cells may be derived from mammals such as humans, mice, monkeys, sheep, goats, cattle, pigs, cats, or dogs. The dispersed cells may be derived from organs such as the heart, liver, lungs, and bone marrow, and obtained through treatment with digestive enzymes such as trypsin.
[0055] In one embodiment, the pH of the buffer system is 7.0-7.6. In a preferred embodiment, the pH of the buffer system is 7.2-7.6. In a preferred embodiment, the buffer system can be a phosphate-buffered saline (PBS) buffer system or a citrate (SSC) buffer system. As an example, the phosphate buffer system can be a 1× buffer system containing 1.44 g / L KH₂PO₄, 9 g / L NaCl, 0.795 g / L Na₂HPO₄·7H₂O, and water. As another example, the citrate buffer system can be a 0.1×-1× buffer system. In a 1× buffer system, the citrate buffer system contains 0.015 mol / L sodium citrate, 0.15 mol / L sodium chloride, and water.
[0056] In step (2), the single-cell suspension can be brought into contact with a space chip or microbeads used to capture nucleic acids in the cells to capture nucleic acids in the cells.
[0057] The descriptions of space chips and microbeads above also apply to this aspect of the present invention, and further details can be found in the specific descriptions above, which will not be repeated here.
[0058] In one embodiment, the density of the cells on the space chip is at least 2 × 10⁻⁶. 4 cells / cm 2For example, at least 4×10 4 cells / cm 2 At least 6×10 4 cells / cm 2 Or at least 7×10 4 cells / cm 2 In a preferred embodiment, the density of the cells on the space chip is 2 × 10⁻⁶. 4 -6×10 4 cells / cm 2 .
[0059] When using a space chip, after the cells come into contact with the space chip, the cells on the chip can be fixed, for example, by using methanol, preferably at low temperature.
[0060] Furthermore, after cell fixation, the cells can be permeabilized, for example, by treating them with hydrochloric acid and a certain concentration of pepsin, such as 10%, for several seconds, such as 30 seconds. Through permeabilization, the capture sequence on the probe immobilized on the space chip or microbeads can bind to intracellular nucleic acids, such as genomic DNA or mRNA, via base complementary pairing, thereby achieving the capture of the latter.
[0061] As mentioned above, if existing technologies are used, then when the number of cells deployed on the chip exceeds 2 × 10⁻⁶... 4 cells / cm 2 At that time, cell capture efficiency decreased significantly. However, by using polyethylene glycol, even with a significant increase in single-cell density on the chip (e.g., to at least 7 × 10⁻⁶), cell capture efficiency was significantly reduced. 4 cells / cm 2 In the case of [missing information], it can also effectively inhibit the diffusion of single-cell contents (such as proteins, nucleic acids such as genomic DNA or transcriptome), clearly distinguish the contents of each cell (such as proteins, nucleic acids such as genomic DNA or transcriptome), reduce the double cell rate / multiple cell rate (caused by diffusion), accurately analyze the proteins or nucleic acids such as genomic DNA or transcriptome of a single cell, and improve single-cell capture efficiency.
[0062] In a fifth aspect, the present invention provides a method for constructing a single-cell sequencing library, the method comprising the following steps:
[0063] (1) Provide a single-cell suspension, said single-cell suspension comprising polyethylene glycol, a buffer system and optionally bovine serum albumin;
[0064] (2) The single-cell suspension prepared in step (1) is brought into contact with a space chip or microbeads for capturing nucleic acids in the cells to capture nucleic acids in the cells; the space chip or microbeads are attached with probes, the probes including a barcode sequence and a capture sequence in sequence from 5' to 3'.
[0065] (3)(i) using the probe as a primer and the nucleic acid contained in the cell as a template for extension, and / or, (ii) using the nucleic acid contained in the cell as a primer and the probe as a template for extension, to obtain barcode-labeled nucleic acid molecules, thereby constructing a single-cell sequencing library.
[0066] In a preferred embodiment, the probe further includes a unique molecular tag located in the 5' direction of the capture sequence. In another preferred embodiment, the unique molecular tag is located between the barcode sequence and the capture sequence.
[0067] Steps (1) and (2) of this aspect of the invention are exactly the same as steps (1) and (2) of the method for capturing nucleic acids in cells in the fourth aspect of the invention. Therefore, the description of steps (1) and (2) of the method for capturing nucleic acids in cells in the fourth aspect of the invention above also applies to steps (1) and (2) of this aspect of the method. Further details can be found in the specific description above, and will not be repeated here.
[0068] In one embodiment, the nucleic acid can be mRNA. Therefore, in step (3), the probe can be extended using mRNA contained in cells on the surface of the space chip or microbeads as a template to obtain a barcode-labeled nucleic acid molecule, i.e., a barcode-labeled cDNA molecule. In one embodiment, the nucleic acid can be cDNA (subject to intracellular reverse transcription). Therefore, in step (3), the cDNA contained in cells on the surface of the space chip or microbeads can be extended using a template or primer to obtain a barcode-labeled nucleic acid molecule. In a specific embodiment, this step can be performed using reverse transcriptase and a TSO (template-converting oligonucleotide) sequence. As an example, the TSO adapter has the sequence shown in SEQ ID NO:1. During reverse transcription, the reverse transcriptase uses mRNA in the cell as a template and a DNA fragment containing a capture sequence such as polyT as a primer to synthesize cDNA, and adds a CCC overhang to the 3' end of the cDNA strand. The complementary pairing of the GGG at the end of the TSO adapter sequence with the CCC overhang of the cDNA strand causes the TSO sequence to hybridize and anneal with the cDNA strand. Subsequently, the reverse transcriptase uses the TSO as a template to continue extending the cDNA strand, so that the 3' end of the cDNA carries a known primer adapter.
[0069] In an optional implementation, the barcode-tagged nucleic acid molecules obtained in step (3) can be amplified. The amount of barcode-tagged nucleic acid molecules obtained in step (3) may be too low to be used for constructing a sequencing library. Therefore, in one implementation, the barcode-tagged nucleic acid molecules can be amplified to obtain a sufficient amount of nucleic acid molecules for library construction. There are no particular limitations on the amplification method for the barcode-tagged nucleic acid molecules; for example, commonly used PCR methods can be used.
[0070] In another optional embodiment, the barcode-labeled nucleic acid molecules can be enriched to achieve the number of molecules required for sequencing, wherein the barcode-labeled nucleic acid molecules can include the barcode-labeled nucleic acid molecules obtained directly in step (3), or the amplification products obtained by amplifying the barcode-labeled nucleic acid molecules obtained in step (3).
[0071] In an optional implementation, the barcode-tagged nucleic acid molecules can be fragmented. The barcode-tagged nucleic acid molecules may include the barcode-tagged nucleic acid molecules obtained directly in step (3), the amplification products obtained by amplifying the barcode-tagged nucleic acid molecules obtained in step (3), or the enriched products obtained by enriching the barcode-tagged nucleic acid molecules obtained directly in step (3) or the amplification products obtained by amplifying the barcode-tagged nucleic acid molecules obtained in step (3).
[0072] Nucleic acid molecules can be fragmented using conventional methods in the field, including but not limited to: using fragmentation enzymes (such as Tn5 transposase, DNase I, Endonuclease V, Fragmentase, etc.), sonication, etc.
[0073] In an optional implementation, the barcode-tagged nucleic acid molecules obtained in step (3), the amplification products and / or enrichment products of the above-mentioned barcode-tagged nucleic acid molecules, or the fragmented nucleic acid molecules can be (i) circularized to prepare DNA nanoballs (DNB) for the BGI sequencing platform, (ii) given sequencing adapters (such as P5 / P7 adapters) to prepare DNA clusters for the Illumina sequencing platform, (iii) given single-molecule sequencing adapters for single-molecule sequencing platforms, such as Oxford Nanotech's nanopore sequencing, or (iv) any other means of determining the sequence, such as ligation sequencing, hybridization sequencing, etc.
[0074] In a sixth aspect, the present invention provides a method for single-cell sequencing, the method comprising the following steps:
[0075] a) Perform the method of the fifth aspect of the present invention to construct a single-cell sequencing library;
[0076] b) Sequencing the single-cell sequencing library.
[0077] The description of the fifth aspect of the invention above applies to step a) of the method of this aspect, and further details thereof can be found in the specific description above, which will not be repeated here.
[0078] In one embodiment, the single-cell sequencing library can be subjected to high-throughput sequencing to obtain single-cell sequencing data. The high-throughput sequencing includes synthetic sequencing, such as BGI's DNA Nanoball (DNB) sequencing, Illumina's bridge amplification sequencing, and single-molecule sequencing, such as Oxford Nano's nanopore sequencing. Those skilled in the art will understand that variations in the specific steps of the library construction method of the fifth aspect of this invention can be made when using different high-throughput sequencing methods, and such variations do not depart from the scope of this disclosure.
[0079] In a seventh aspect, the present invention provides the application of polyethylene glycol in the preparation of single-cell suspensions.
[0080] The description of the first and second aspects of the present invention above applies to this aspect.
[0081] By using polyethylene glycol in the preparation of single-cell suspensions, cell and cell contents diffusion can be reduced, allowing individual cells to aggregate more effectively in planar capture, thus improving cell capture efficiency. Because the cells are more aggregated in a planar area, more cells can be deployed in the same area, further increasing single-cell throughput.
[0082] Example
[0083] The present invention and its technical effects will be clearly and completely described below with reference to embodiments and accompanying drawings, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.
[0084] Example 1
[0085] The sequence information involved in this embodiment is shown in Table 1:
[0086] Table 1: Sequence Information
[0087] SEQ ID NO describe Sequence information 1 TSO AAGCAGTGGTATCAACGCAGAGTACATrGrG+G 2 cDNA amplification primer 1 CTGCTGACGTACTGAGAGGCATG 3 cDNA amplification primer 2 AAGCAGTGGTATCAACGCAGAGTAC 4 Library construction primer 1 p-CTGCTGACGTACTGAGAGGC*A*T 5 Library construction primer 2 GAGACGTTCTCGACTCAGAAGATG 6 Primers for preparing DNB for sequencing GGCCTCCGACTTGAGACGTTCTCG
[0088] Note: "r" indicates that the nucleotide at its 3' adjacent position is a ribonucleotide; "+" indicates that the nucleotide at its 3' adjacent position is modified with LNA (locked nucleotide); "*" indicates thiophosphate modification; "p" indicates phosphorylation modification.
[0089] The specific experimental steps in this embodiment are as follows:
[0090] I. Chip Modification
[0091] 1. Add the modification solution (containing 0.01% poly-L-lysine (PLL) and 0.005 mg / mL fibronectin, prepared with water) to the surface of the space chip (BGI, Stereo-seq chip T (1cm*1cm), catalog number: 100CT112, loaded with capture probes with spatial coordinate information) in a 24-well plate and incubate on a shaker for 60 min.
[0092] 2. Use a pipette tip to remove the modification solution from the well plate, and wash the well plate twice with 1 mL of 1x PBS.
[0093] II. Single-cell fixation
[0094] 1. This embodiment sets up one control group and six experimental groups. The control group uses a solution containing 0.04 w / v% bovine serum albumin and a 1×PBS buffer system (containing 1.44 g / L KH2PO4, 9 g / L NaCl, and 0.795 g / L Na2HPO4·7H2O). The experimental groups use a solution containing PEG, 0.04 w / v% bovine serum albumin, and a 1×PBS buffer system. The molecular weight and concentration of PEG are PEG2000 (0.4 w / v%, 1 w / v%, and 2 w / v%), PEG400 (2 w / v%), PEG800 (2 w / v%), and PEG1500 (2 w / v%), respectively. Approximately 4 × 10⁴ g of the solution was prepared using conventional methods with the above seven solutions. 4 One PBMC cell was prepared into a cell suspension.
[0095] 2. Drop the prepared cell suspension onto a chip treated with the modified solution (the chip probes are connected to specific DNA fragments, which include Barcode, UMI and polyT from the 5' end to the 3' end in sequence), incubate at room temperature for 10 min, and then fix the chip in pre-cooled methanol at -20℃ for 30 min.
[0096] 3. Permeabilize the cells by treating them with hydrochloric acid and 10% pepsin for 30 seconds.
[0097] III. cDNA Synthesis
[0098] 1. cDNA synthesis
[0099] Prepare a 200 μL reverse transcriptase reaction system as shown in Table 2. Add the reaction solution to the chip, ensuring complete coverage, and incubate at 42℃ for 90-180 min. Reverse transcriptase uses mRNA as a template and a capture probe containing polyT as a primer to synthesize cDNA, adding a CCC overhang to the 3' end of the cDNA strand. After hybridization and annealing of the TSO sequence with the cDNA strand (through complementary pairing of the GGG at the end of the TSO sequence with the CCC overhang of the cDNA strand), reverse transcriptase continues to extend the cDNA strand using TSO as a template, attaching a known primer adapter to the 3' end of the cDNA.
[0100] Table 2: Reverse Transcription Reaction System
[0101] Serial Number reagents Volume (μL) 1 RT Reagent mix 124 2 100mM DTT 10 3 TSO 20 4 RI (RNase Inhibitor) 10 5 Enhancer (50w / v % PEG6000) 26 6 RTase (200 U / μL) 10 Total 200
[0102] 2. cDNA release
[0103] Prepare the cDNA release system as shown in Table 3.
[0104] Table 3: cDNA Release Mix
[0105]
[0106]
[0107] Add 400 μL / well of the prepared cDNA Release Mix (Table 3) to the reaction wells of the above-mentioned chip, seal the reaction wells containing the chip with sealing film, cover with the plate cap and seal the outer ring to prevent volatilization, and react in an incubator at 55°C for 3-17 hours.
[0108] 3. cDNA amplification
[0109] Prepare a 200 μL reaction system as shown in Table 4 for 3' end transcriptome sequencing library construction, and divide it into 2 PCR tubes.
[0110] Table 4: cDNA amplification system
[0111] Element Volume (μL) Final concentration cDNA recovery products 84 - cDNA amplification primer 1 8 0.8μM cDNA amplification primer 2 8 0.8μM 2x HiFi ready mix 100 1X
[0112] The above reaction system was placed in a PCR instrument, and the following reaction program was set: 95℃ for 3 min, 15 cycles (98℃ for 20 s, 58℃ for 20 s, 72℃ for 3 min), 72℃ for 5 min, 4℃ to infinity. After the reaction, the magnetic beads (purchased from Novizan) were used for purification and recovery. The dsDNA concentration was quantified using a Qubit instrument, and the length distribution of the cDNA amplification products was detected using a 2100 bioanalyzer (purchased from Agilent). The fragment lengths met the sequencing requirements.
[0113] IV. DNA Circulation and Sequencing
[0114] Take 80 ng of the above PCR product and prepare DNA nanospheres (DNB). Prepare 40 μL of the DNB preparation system for sequencing as shown in Table 5.
[0115] Table 5: DNB preparation system for sequencing
[0116] Element Volume (μL) Final concentration The PCR product from step three above X(80ng) - 10X phi29 buffer (from Thermo Fisher, part number: B62) 4 1X 10 μM primers (SEQ ID NO: 6, which are also circular primers) were prepared for DNB sequencing. 4 1μM water 32-X -
[0117] The above reaction system was placed in a PCR instrument for reaction. The cyclization reaction conditions were as follows: 95℃ for 3 min, 40℃ for 3 min. After the reaction, the mixture was placed on ice and 40 μL of mixed enzyme (2 μL phi29 enzyme, 1 μL ATP, 0.1 μL T4Ligase, and DNB buffer to make up the balance) required for DNB preparation was added to the DNBSEQ sequencing kit. After mixing, the above reaction system was placed in a PCR instrument and reacted at 30℃ for 20 min to form DNB.
[0118] Following the instructions in the PE50 kit accompanying the MGISEQ 2000, DNB was loaded onto the MGISEQ 2000 sequencing chip, and sequencing was performed according to the relevant instructions. Customized sequencing was selected, with the first-strand sequencing divided into two segments: first, 25 bp was sequenced, followed by 60 cycles of dark reaction, and then 10 bp UMI sequence was sequenced. The second-strand sequencing was set to 50 bp.
[0119] V. Data Analysis
[0120] Log in to https: / / uat.stomics.tech / sap / login and follow the on-site instructions for data analysis. The first 25 bp of the read1 sequence obtained from PE50 sequencing (from single-strand sequencing) is compared with the 25 bp position information from the microarray preparation process. Reads that can be aligned to their positions on the microarray are retained and mapped to their corresponding positions. Read2 (from two-strand sequencing) corresponding to the reads at their microarray positions is identified and compared with the human genome. Duplicate reads are removed based on UMI information to obtain the captured genes in each cell and the number of reads for each gene. The detection results are as follows: Figure 1 As shown.
[0121] Experimental results are as follows Figure 1As shown in Figures A and B, in the control group cell suspension without PEG, the RNA of the cells captured by the chip was severely diffused, and the cell outlines were very blurry, making it impossible to distinguish the RNA of individual cells. Therefore, it was impossible to accurately determine the gene count and capture efficiency of individual cells. In the experimental groups where different molecular weights and concentrations of PEG were added to the cell suspension, the results showed that the single cell outlines were clear, and the cell capture efficiency reached over 50%. Furthermore, based on the results of this series of experimental groups, it can be concluded that 2 w / v% PEG2000 is the most effective.
[0122] Example 2
[0123] The sequence information involved in this embodiment is shown in Table 6:
[0124] Table 6: Sequence Information
[0125]
[0126]
[0127] Note: "r" indicates that the nucleotide at its 3' adjacent position is a ribonucleotide; "+" indicates that the nucleotide at its 3' adjacent position is modified with LNA (locked nucleotide); "*" indicates thiophosphate modification; "p" indicates phosphorylation modification.
[0128] The specific experimental steps in this embodiment are as follows:
[0129] I. Chip Modification
[0130] 1. Add the modification solution (containing 0.01% PLL and 0.005 mg / mL fibronectin, prepared with water) to the surface of the space chip (BGI, Stereo-seq chip T (1cm*1cm), catalog number: 100CT112, loaded with capture probes with spatial coordinate information) in a 24-well plate and incubate on a shaker for 60 min.
[0131] 2. Use a pipette tip to remove the modification solution from the well plate, and wash the well plate twice with 1 mL of 1x PBS.
[0132] II. Single-cell fixation
[0133] 1. This embodiment sets up one control group and three experimental groups. The solution used in the control group contains 0.04 w / v% bovine serum albumin and a 1×PBS buffer system (containing 1.44 g / L KH2PO4, 9 g / L NaCl, and 0.795 g / L Na2HPO4·7H2O). The solutions used in the experimental groups contain 0.4 w / v% PEG2000, 0.04 w / v% bovine serum albumin, and a 1×PBS buffer system (Experimental Group 1), 2 w / v% PEG6000, 0.04 w / v% bovine serum albumin, and a 1×PBS buffer system (Experimental Group 2), and 2 w / v% PEG8000, 0.04 w / v% bovine serum albumin, and a 1×PBS buffer system (Experimental Group 3), respectively. Following conventional methods, approximately 6 × 10⁶ [units of measurement missing] of the solution used in the control group were prepared. 4 PBMC cells were prepared into a cell suspension, and approximately 6 × 10⁶ cells were added using the solutions from experimental groups 1 and 2 described above. 4 PBMC cells were prepared into a cell suspension, and approximately 7 × 10⁶ cells were used in experimental group 3 to form a suspension. 4 One PBMC cell was prepared into a cell suspension.
[0134] 2. Drop the prepared cell suspension onto a chip treated with the modified solution (the chip probes are connected to specific DNA fragments, which include Barcode, UMI and polyT from the 5' end to the 3' end in sequence), incubate at room temperature for 10 min, and then fix the chip in pre-cooled methanol at -20℃ for 30 min.
[0135] 3. Permeabilize the cells by treating them with hydrochloric acid and 10% pepsin for 30 seconds.
[0136] III. cDNA Synthesis
[0137] 1. cDNA synthesis
[0138] Prepare a 200 μL reverse transcriptase reaction system as shown in Table 7. Add the reaction solution to the chip, ensuring complete coverage, and incubate at 42°C for 90-180 min. Reverse transcriptase uses mRNA as a template and a capture probe containing polyT as a primer to synthesize cDNA, adding a CCC overhang to the 3' end of the cDNA strand. After hybridization and annealing of the TSO sequence with the cDNA strand (through complementary pairing of the GGG at the end of the TSO sequence with the CCC overhang of the cDNA strand), reverse transcriptase continues to extend the cDNA strand using TSO as a template, attaching a known primer adapter to the 3' end of the cDNA.
[0139] Table 7: Reverse Transcription Reaction System
[0140] Serial Number reagents Volume (μL) 1 RT Reagent mix 124 2 100mM DTT 10 3 TSO 20 4 RI (RNase Inhibitor) 10 5 Enhancer (50w / v % PEG6000) 26 6 RTase (200 U / μL) 10 total 200
[0141] 2. cDNA release
[0142] Prepare the cDNA release system as shown in Table 8.
[0143] Table 8: cDNA Release Mix
[0144] Reagent Name 1x(μL) PK Enzyme (Protein K) 20 cDNA Release Buffer(PK buffer) 380 Total 400
[0145] Add 400 μL / well of the prepared cDNA Release Mix (Table 8) to the reaction wells of the above-mentioned chip, seal the reaction wells containing the chip with sealing film, cover with the plate cap and seal the outer ring to prevent volatilization, and react in an incubator at 55°C for 3-17 hours.
[0146] 3. cDNA amplification
[0147] Prepare a 200 μL reaction system as shown in Table 9 for 3' end transcriptome sequencing library construction, and divide it into 2 PCR tubes.
[0148] Table 9: cDNA amplification system
[0149] Element Volume (μL) Final concentration cDNA recovery products 84 - cDNA amplification primer 1 8 0.8μM cDNA amplification primer 2 8 0.8μM 2x HiFi ready mix 100 1X
[0150] The above reaction system was placed in a PCR instrument, and the following reaction program was set: 95℃ for 3 min, 15 cycles (98℃ for 20 s, 58℃ for 20 s, 72℃ for 3 min), 72℃ for 5 min, 4℃ to infinity. After the reaction, the magnetic beads (purchased from Novizan) were used for purification and recovery. The dsDNA concentration was quantified using a Qubit instrument, and the length distribution of the cDNA amplification products was detected using a 2100 bioanalyzer (purchased from Agilent). The fragment lengths met the sequencing requirements.
[0151] IV. DNA Circulation and Sequencing
[0152] Take 80 ng of the above PCR product and prepare DNB. Prepare 40 μL of the DNB preparation system for sequencing as shown in Table 10.
[0153] Table 10: DNB preparation system for sequencing
[0154] Element Volume (μL) Final concentration The PCR product from step three above X(80ng) - 10X phi29 buffer (from Thermo Fisher, part number: B62) 4 1X 10 μM primers (SEQ ID NO: 6, which are also circular primers) were prepared for DNB sequencing. 4 1μM water 32-X -
[0155] The above reaction system was placed in a PCR instrument for reaction. The cyclization reaction conditions were as follows: 95℃ for 3 min, 40℃ for 3 min. After the reaction, the mixture was placed on ice and 40 μL of mixed enzyme (2 μL phi29 enzyme, 1 μL ATP, 0.1 μL T4Ligase, and DNB buffer to make up the balance) required for DNB preparation was added to the DNBSEQ sequencing kit. After mixing, the above reaction system was placed in a PCR instrument and reacted at 30℃ for 20 min to form DNB.
[0156] Following the instructions in the PE50 kit accompanying the MGISEQ 2000, DNB was loaded onto the MGISEQ 2000 sequencing chip, and sequencing was performed according to the relevant instructions. Customized sequencing was selected, with the first-strand sequencing divided into two segments: first, 25 bp was sequenced, followed by 60 cycles of dark reaction, and then 10 bp UMI sequence was sequenced. The second-strand sequencing was set to 50 bp.
[0157] V. Data Analysis
[0158] Log in to https: / / uat.stomics.tech / sap / login and follow the on-site instructions for data analysis. The first 25 bp of the read1 sequence obtained from PE50 sequencing (from single-strand sequencing) is compared with the 25 bp position information from the microarray preparation process. Reads that can be aligned to their positions on the microarray are retained and mapped to their corresponding positions. Read2 (from two-strand sequencing) corresponding to the reads at their microarray positions is identified and compared with the human genome. Duplicate reads are removed based on UMI information to obtain the captured genes in each cell and the number of reads for each gene. The detection results are as follows: Figure 2 As shown. Figure 2 As shown, the cell outlines of the control group were less clear, and the number of genes obtained from sequencing and the capture efficiency were lower than those of experimental groups 1 and 2. The cells in experimental group 3 were clustered and could not be detected. This indicates that resuspending cells in a solution containing PEG with an average molecular weight of less than 8000 is beneficial to improving the capture efficiency in single-cell sequencing.
[0159] The application of polyethylene glycol provided by this invention in reducing the diffusion of cell contents in single-cell suspensions and improving the single-cell nucleic acid capture efficiency has been described in detail above. Specific embodiments have been used to illustrate the principles and implementation methods of this invention. The descriptions of the embodiments above are only for the purpose of helping to understand the method and core ideas of this invention. At the same time, for those skilled in the art, there will be changes in the specific implementation methods and application scope based on the ideas of this invention. Therefore, the content of this specification should not be construed as a limitation of this invention.
Claims
1. Application of polyethylene glycol in reducing the diffusion of cell contents in single-cell suspensions.
2. Application of polyethylene glycol in improving single-cell capture efficiency.
3. The application according to claim 1 or 2, characterized in that, The average molecular weight of the polyethylene glycol is 400-6000, preferably 2000.
4. The application according to any one of claims 1-3, characterized in that, The application includes mixing polyethylene glycol, cells, and a buffer system to prepare a single-cell suspension.
5. The application according to claim 4, characterized in that, The concentration of polyethylene glycol in the single-cell suspension is 0.4%-2%, preferably 2%.
6. The application according to claim 4 or 5, characterized in that, The pH of the buffer system is 7.0-7.6, preferably 7.2-7.6; preferably, the buffer system is a phosphate buffer system or a citrate buffer system.
7. The application according to any one of claims 4-6, characterized in that, The single-cell suspension further includes bovine serum albumin; preferably, the concentration of bovine serum albumin in the single-cell suspension is 0.01 w / v%-1 w / v, more preferably 0.04 w / v%-1 w / v, and most preferably 0.04 w / v.
8. A reagent kit, characterized in that, The kit contains polyethylene glycol, a buffer system, a spatial chip or microbeads for capturing nucleic acids in cells, and optionally bovine serum albumin.
9. The reagent kit according to claim 8, characterized in that, Probes are attached to the space chip or the surface of the microbeads. Each probe includes a barcode sequence and a capture sequence sequentially from 5' to 3'. The barcode sequences on probes attached to different positions on the space chip are different from each other, and the barcode sequences on probes attached to different microbeads are also different from each other. Preferably, the probes also include a unique molecular tag. The unique molecular tag is located in the 5' direction of the capture sequence, preferably between the barcode sequence and the capture sequence.
10. A method for capturing nucleic acids in cells, characterized in that, The method includes: (1) Provide a single-cell suspension, said single-cell suspension comprising polyethylene glycol, a buffer system and optionally bovine serum albumin; (2) Contact the single-cell suspension prepared in step (1) with a space chip or microbeads used to capture nucleic acids in the cells to capture nucleic acids in the cells.
11. The method according to claim 10, characterized in that, The space chip or microbeads have probes attached to their surfaces. Each probe includes a barcode sequence and a capture sequence in sequence from 5' to 3'. The barcode sequences on probes attached to different positions on the space chip are different from each other, and the barcode sequences on probes attached to different microbeads are also different from each other. Preferably, the probes also include a unique molecular tag located in the 5' direction of the capture sequence, preferably between the barcode sequence and the capture sequence.
12. The method according to claim 10 or 11, characterized in that, The density of the cells on the space chip is at least 2 × 10⁻⁶. 4 cells / cm 2 For example, at least 4×10 4 cells / cm 2 At least 6×10 4 cells / cm 2 Or at least 7×10 4 cells / cm 2 Preferably, the density of the cells on the space chip is 2 × 10⁻⁶. 4 -6×10 4 cells / cm 2 .