Construction method and application of genetically engineered corynebacterium glutamicum for producing mycosporine-glycine

Abstract

The application provides a construction method and application of a genetically engineered Corynebacterium glutamicum for producing mycosporine-glycine, and belongs to the field of microbial genetic engineering and fermentation technology. The application takes Corynebacterium glutamicum ATCC 13032 as a starting strain, and significantly improves the synthesis yield of M-Gly in the microbial cell by knocking out the competitive pathway gene, multiple-copy key enzyme gene and acid production pathway gene on the strain genome. The final yield of the strain in the shake flask fermentation for 72 h is 1.53 g / L, and the final M-Gly yield can reach 10.12 g / L in the scale-up culture in the fed-batch fermentation in a 50 L fermenter.

Description

Technical Field

[0001] This invention belongs to the fields of microbial genetic engineering and synthetic biology, specifically relating to a method for constructing and applying a genetically engineered Corynebacterium glutamicum that produces the spore-like amino acid M-Gly. Background Technology

[0002] Mycosporine-like amino acids (MAAs) are a class of bioactive natural compounds with ultraviolet (UV) absorption capabilities, widely found in marine organisms, algae, and certain bacteria. M-Gly, a key and relatively simple member of this class, shows potential for applications in photoprotection. M-Gly is widely distributed in various aquatic organisms, synthesized in corals, macroalgae, and cyanobacteria, and also accumulates in marine invertebrates through the food chain. These compounds are mainly found in stressful environments such as high solar radiation, high temperature, and dryness, playing an important role in photoprotection in marine, freshwater, and terrestrial ecosystems. M-Gly absorbs UV radiation and dissipates the energy directly as heat, without producing reactive oxygen species (ROS), thus avoiding photo-oxidative damage. Studies have shown that it has significant antioxidant capacity, scavenging free radicals, regulating enzyme activity, and alleviating oxidative stress. It can be widely used in cosmetics, pharmaceuticals, and food industries.

[0003] Mycosporine-Glycine (MG or M-Gly for short) is a key member of the MAA family. As a core precursor in the synthesis of more complex MAA (such as shinorine and porphyra-334), it plays a pivotal role in cyanobacterial stress resistance mechanisms. M-Gly is a low-molecular-weight, water-soluble compound with the molecular formula C6H2O. 10 H 15 NO6. M-Gly possesses a substituted cyclohexenone ring structure, a common feature of all MAAs. Glycine is linked to the C3 position via an amino group, forming an oxygen-based spore-like structure. It exhibits a characteristic absorption peak in the UV-B region (310-360 nm). M-Gly contains only a single amino acid substituent, classifying it as a monosubstituted MAA.

[0004] The biosynthesis of M-Gly begins with primary metabolism and is completed through multiple enzymatic reactions. The synthesis of M-Gly starts with the intermediate sedoheptulose-7-phosphate (S7P) produced by the pentose phosphate pathway. S7P is then catalyzed by DDGS synthase (MysA) to generate demethyl-4-deoxycodone (DDG). O-methyltransferase (MysB) converts DDG to 4-deoxydiazotol (4-DG). The final step is the condensation of 4-DG with glycine catalyzed by ATP-grasp enzyme (MysC) to form Mycosporine-Glycine.

[0005] Corynebacterium glutamicum, a recognized safe (GRAS) industrial strain, is widely used in the production of high-value-added products such as amino acids and terpenoids due to its non-endotoxin production, rapid growth, and suitability for high-density fermentation. The production of amino acids (MAAs) using Corynebacterium glutamicum is currently at a mature industrial level, exhibiting strong metabolic plasticity, convenient gene editing, and food safety characteristics. As a high-yield amino acid bacterium, Corynebacterium glutamicum can simultaneously provide sufficient amino acid precursors such as glycine and serine, achieving efficient production of MAAs. Summary of the Invention

[0006] To address the problems of difficulty, low yield, and environmental unfriendliness in obtaining M-Gly naturally, this invention provides a method for constructing and applying a genetically engineered Corynebacterium glutamicum strain for synthesizing M-Gly. Using genetic engineering, a synthetic pathway for M-Gly was constructed in Corynebacterium glutamicum ATCC 13032. The 3-dehydroquinanate synthase gene AvmysA, the O-methyltransferase gene AvmysB, and the ATP-Grasp ligase gene AvmysC, derived from Anabaena variabilis ATCC 29413, were heterologously expressed in the genome and plasmid pEC-XK99E. By knocking out the competitive pathway encoding the transaldolase gene tal (S7P) of the precursor sedum hepta-7-phosphate, as well as the pyruvate dehydrogenase gene poxB and the phosphoacetyltransferase gene pta (S7P), the yield of M-Gly in Corynebacterium glutamicum cells was effectively increased, solving the problems of low yield, low purity, and environmental pollution associated with traditional extraction methods.

[0007] Preferably, this invention provides a plasmid-type M-Gly production genetically engineered bacterium, using *Corynebacterium glutamicum* ATCC13032 as the starting strain. The 3-dehydroquinanate synthase gene AvmysA, the O-methyltransferase gene AvmysB, and the ATP-Grasp ligase gene AvmysC from *Anabaena variabilis* ATCC 29413 are ligated into a gene cluster using RBS and cloned into plasmid pEC-XK99E for expression. By knocking out the transaldolase gene tal, a strong constitutive promoter P is used. tuf The key enzyme gene cluster was initiated and integrated into the genome. Based on this, the pyruvate dehydrogenase gene *poxB* and the phosphoacetyltransferase gene *pta* were knocked out, while the expression of the phosphoglycerate kinase gene *pgk* and the pyruvate kinase gene *pyk* was enhanced. This improved the ATP regeneration capacity of the strain, ensuring ATP supply during product synthesis, ultimately yielding a genetically engineered bacterium capable of synthesizing M-Gly. After these modifications, the genetically engineered bacterium achieved a maximum M-Gly yield of 1.53 g / L under 72 h shake-flask fermentation conditions. In a fed-batch fermentation in a 50 L fermenter, the final M-Gly yield reached 10.12 g / L, demonstrating significant potential for industrial production.

[0008] The first objective of this invention is to provide plasmids that can efficiently express the genes AvmysA, AvmysB, and AvmysC.

[0009] In one implementation, the pEC-XK99E plasmid is used as the expression vector;

[0010] In one embodiment, genes AvmysA, AvmysB, and AvmysC are linked together into a gene cluster via RBS and constructed onto the pEC-XK99E plasmid to obtain the recombinant plasmid pEC-XK99E-AvmysABC.

[0011] In one embodiment, the 3-dehydroquinanate synthase gene AvmysA is derived from Anabaenavariabilis ATCC 29413, and its encoded amino acid sequence is shown in SEQ ID NO.1, and its nucleotide sequence is shown in SEQ ID NO.6;

[0012] In one embodiment, the O-methyltransferase gene AvmysB is derived from Anabaenavariabilis ATCC 29413, and its encoded amino acid sequence is shown in SEQ ID NO.2, and its nucleotide sequence is shown in SEQ ID NO.7;

[0013] In one embodiment, the ATP-Grasp ligase gene AvmysC is derived from Anabaenavariabilis ATCC 29413, and its encoded amino acid sequence is shown in SEQ ID NO.3, and its nucleotide sequence is shown in SEQ ID NO.8.

[0014] In one embodiment, the nucleotide sequence of the phosphoglycerate kinase gene pgk is shown in SEQ ID NO.11; and the nucleotide sequence of the pyruvate kinase gene pyk is shown in SEQ ID NO.12.

[0015] In one embodiment, the map of the high-copy expression plasmid pEC-XK99E-AvmysABC is as follows: Figure 1 As shown.

[0016] In one embodiment, the RBS used to link the three key enzyme genes on the plasmid is the universal RBS (CK1) of Corynebacterium glutamicum, and the CK1 gene sequence is shown in SEQ ID NO.5.

[0017] The second objective of this invention is to provide a genetically engineered Corynebacterium glutamicum that synthesizes M-Gly. This Corynebacterium glutamicum is obtained by knocking out the 7-phosphate sedoheptulose (S7P) competing pathway gene (aldolase gene tal), and by integrating multiple copies of a gene cluster (3-dehydroquinanate synthase gene AvmysA, O-methyltransferase gene AvmysB, and ATP-Grasp ligase gene AvmysC) derived from *Anabaena variabilis* ATCC 29413 at the Cgl1036, lldA, nagB, and ppc sites, via a strong promoter P. tuf Drive its efficient expression; and enhance the expression of phosphoglycerate kinase gene pgk and pyruvate kinase gene pyk to improve the ATP regeneration capacity of the strain and ensure the supply of ATP during product synthesis; knock out two acid production pathway genes (pyruvate dehydrogenase gene poxB and phosphoacetyltransferase gene pta) to achieve the metabolic synthesis of M-Gly.

[0018] In one embodiment, the NCBI serial number of transaldolase tal is BAB98968.

[0019] In one embodiment, the 3-dehydroquinanate synthase gene AvmysA is derived from *Anabaenavariabilis* ATCC 29413, and its encoded amino acid sequence is shown in SEQ ID NO.1, with NCBI sequence number ABA23463.1; the 3-dehydroquinanate synthase gene AvmysA is generated by a strong promoter constitutive promoter P. tufStart the expression.

[0020] In one embodiment, the O-methyltransferase gene AvmysB is derived from *Anabaenavariabilis* ATCC 29413, and its encoded amino acid sequence is shown in SEQ ID NO.2, with NCBI sequence number ABA23462.1; the O-methyltransferase gene AvmysA is generated by a strong promoter constitutive promoter P. tuf Start the expression.

[0021] In one embodiment, the ATP-Grasp ligase gene AvmysC is derived from *Anabaenavariabilis* ATCC 29413, and its encoded amino acid sequence is shown in SEQ ID NO.3, with NCBI sequence number ABA23461.1; the ATP-Grasp ligase gene AvmysC is generated by a strong constitutive promoter P. tuf Start the expression.

[0022] In one embodiment, the NCBI sequence number of pyruvate dehydrogenase poxB is BAC00004.

[0023] In one embodiment, the NCBI sequence number of the phosphorylacetyltransferase gene pta is BAC00147;

[0024] In one embodiment, the nucleotide sequence of the phosphoglycerate kinase gene pgk is shown in SEQ ID NO.9; and the nucleotide sequence of the pyruvate kinase gene pyk is shown in SEQ ID NO.10.

[0025] In one embodiment, the Corynebacterium glutamicum includes, but is not limited to, Corynebacterium glutamicum ATCC 13032.

[0026] A third objective of this invention is to provide a method for producing the spore-like amino acid M-Gly, wherein the method utilizes the genetically engineered Corynebacterium glutamicum to produce the spore-like amino acid M-Gly through fermentation.

[0027] In one embodiment, Corynebacterium glutamicum is routinely cultured in BHIS medium at 30 °C and 220 rpm for 16–18 h.

[0028] In one embodiment, Corynebacterium glutamicum is fermented in a modified CGXII culture medium at 30 °C, containing 40 g / L glucose, 5 g / L yeast extract, 5 g / L corn steep liquor, 20 g / L ammonium sulfate, 10 g / L urea, 1 g / L potassium dihydrogen phosphate, 1.0 g / L dipotassium hydrogen phosphate, 42 g / L 3-morpholinopropanesulfonic acid, and trace metal elements. The trace metal elements include: 250 mg / L magnesium sulfate heptahydrate, 10 mg / L ferrous sulfate heptahydrate, 10 mg / L manganese sulfate monohydrate, 1 mg / L zinc sulfate heptahydrate, 0.2 g / L anhydrous copper sulfate, 0.02 mg / L nickel chloride hexahydrate, 0.2 mg / L biotin, 10 mg / L calcium chloride, 30 mg / L protocatechuic acid, and 0.1 mg / L vitamin B1.

[0029] Shake flask culture to OD 600 =1.0±0.1, add IPTG to a final concentration of 0.8~1.2 mM, and continue induction culture at 30 °C and 220 rpm for no less than 72 h;

[0030] The fermenter was operated at 30 °C, with a stirring speed of 200-800 r / min, an aeration rate of 2-6 vvm, and a pH of 7.0±0.2, until fermentation reached OD. 600 When the concentration is 15±0.5, add IPTG to a final concentration of 0.8~1.2mM and induce culture at 30 °C for no less than 72 h. If necessary, add antibiotics of appropriate concentration.

[0031] More preferably, the induction culture in the fermenter system shall be no less than 72 h.

[0032] In one embodiment, during the reaction, a mother liquor concentration of 500 g / L glucose is added to maintain its final concentration at 10-15 g / L, while 50% ammonia is added to bring the pH of the entire system to 7.0, thereby maintaining the production of the product M-Gly.

[0033] Preferably, when the glucose concentration in the reaction system is below 10 g / L, glucose is added at once to a final concentration of 10 g / L to ensure sufficient energy, normal cell growth, and thus promote the continuous production of M-Gly energy.

[0034] In one embodiment, glucose is used as the carbon source to efficiently produce the spore-like amino acid M-Gly using an exogenous gene derived from Anabaena variabilis ATCC29413.

[0035] The fourth objective of this invention is to provide the application of the genetically engineered Corynebacterium glutamicum in the preparation of a spore-like amino acid, M-Gly.

[0036] The fifth objective of this invention is to provide the application of the genetically engineered Corynebacterium glutamicum in the fields of food, cosmetics, pharmaceutical development, and biomaterials.

[0037] The beneficial effects of this invention are:

[0038] This invention uses Corynebacterium glutamicum ATCC 13032 as the starting strain. By expressing a foreign gene from Anabaenavariabilis ATCC 29413 and overexpressing it on a plasmid, the Corynebacterium glutamicum constructed can achieve a maximum M-Gly yield of 1.53 g / L under 72 h fermentation conditions in shake flasks. When this Corynebacterium glutamicum is fermented in a fermenter for 72 h, the M-Gly yield can reach 10.12 g / L. The yield is increased by about 6.6 times from shake flask to fermenter scale-up system. Attached Figure Description

[0039] Figure 1 A schematic diagram of plasmid pEC-XK99E-AvmysABC. Detailed Implementation

[0040] 1. The plasmids, restriction enzymes, PCR enzymes, column DNA extraction kits, and DNA gel recovery kits used in the following examples are commercial products. The specific operations should be performed in accordance with the kit instructions.

[0041] 2. Routine procedures such as colony PCR, nucleic acid agarose gel electrophoresis, heat shock transformation, preparation of competent cells, and extraction and preservation of bacterial genomes were performed according to Molecular Cloning: A Laboratory Manual (Fourth Edition).

[0042] 3. The sequencing of plasmids and DNA products was completed by Shanghai Sangon Biotech Co., Ltd.

[0043] 4. Preparation of competent Escherichia coli cells: TAKARA kit.

[0044] 5. Reference for the preparation of competent cells of Corynebacterium glutamicum: Jiang, Y., Qian, F., Yang, J. et al. CRISPR-Cpf1 assisted genome editing of Corynebacterium glutamicum. NatCommun. 8, 15179 (2017).

[0045] 6. Fermentation process and detection of mycotoxin-like amino acid M-Gly:

[0046] (1) BHIS liquid culture medium: BHI 37 g / L, D-sorbitol 91 g / L.

[0047] (2) BHIS solid medium: BHI 37 g / L, D-sorbitol 91 g / L, 15 g / L agar powder.

[0048] (3) Fermentation medium: 40 g / L glucose, 5 g / L yeast extract, 5 g / L corn steep liquor, 20 g / L ammonium sulfate, 10 g / L urea, 1 g / L potassium dihydrogen phosphate, 1.0 g / L dipotassium hydrogen phosphate, 42 g / L 3-morpholinopropanesulfonic acid and trace metal elements; the trace metal elements include: 250 mg / L magnesium sulfate heptahydrate, 10 mg / L ferrous sulfate heptahydrate, 10 mg / L manganese sulfate monohydrate, 1 mg / L zinc sulfate heptahydrate, 0.2 g / L anhydrous copper sulfate, 0.02 mg / L nickel chloride hexahydrate, 0.2 mg / L biotin, 10 mg / L calcium chloride, 30 mg / L protocatechuic acid, and 0.1 mg / L vitamin B1. When adding the plasmid for expression, kanamycin at a final concentration of 25 μg / mL and IPTG at a final concentration of 0.9 mM should be added to induce plasmid activity.

[0049] (4) Fermentation process for producing the spore-like amino acid M-Gly: The constructed strain was inoculated into BHI liquid medium, and kanamycin was added to a final concentration of 25 μg / mL. The culture was carried out overnight at 30 °C and 220 rpm for 16-18 h to obtain the seed culture. 2 mL of the seed culture was inoculated into 50 mL of fermentation medium and cultured at 30 °C and 220 rpm until the OD reached the target concentration. 600 =1.0±0.1, add IPTG to a final concentration of 0.9 mM, and continue induction culture at 30 °C and 220 rpm for 72 h. Take 1 mL of fermentation broth, centrifuge at 10,000 rpm for 10 min, collect the supernatant, and use it for HPLC analysis.

[0050] (5) HPLC detection conditions: High performance liquid chromatography (HPLC) system (Agilent); chromatographic column: ZORBAX Eclipse Plus C18; detector: Agilent UV detector; UV absorption wavelength: 310 nm; mobile phase: 0.25% formic acid aqueous solution; flow rate: 0.65 mL / min; column temperature: 35 °C; injection volume: 10 μL.

[0051] Example 1: Construction of pEC-XK99E-AvmysA-AvmysB-AvmysC expression plasmid

[0052] Genes AvmysA, AvmysB, and AvmysC were synthesized by a biotechnology company (Shanghai Diwin Biotechnology Co., Ltd.) according to the amino acid sequence on NCBI and cloned into the multiple cloning site of the vector pEC-XK99E, thereby obtaining the plasmid pEC-XK99E-AvmysA-AvmysB-AvmysC, hereinafter referred to as pEC-XK99E-AvmysABC.

[0053] Example 2: Construction of genetically engineered strains of Corynebacterium glutamicum

[0054] The specific steps for constructing gene-editing plasmids and genetically engineered strains are as follows (the primer sequences involved are shown in Table 1):

[0055] The gene *tal* encoding transaldolase in *Corynebacterium glutamicum* ATCC 13032 was knocked out using the SacB-assisted CRISPR-FnCpf1 gene editing system. For the CRISPR / Cpf1 gene editing system, please refer to Zhang, J., et al. (2020). De Novo Engineering of *Corynebacterium glutamicum* for l-Proline Production. ACS Synthetic Biology. 9(7): 1897–1906.

[0056] The specific steps are as follows:

[0057] (1) Construct plasmids pK18mobsacB-spec-Δtal and pK18mobsacB-spec-ΔCgl1036::P tuf -AvmysABC

[0058] The knocked-out *tal* gene was amplified by PCR using the *Corynebacterium glutamicum* ATCC 13032 genome as a template, with primers tal-UH / DH-F / R (Table 1). The upstream and downstream fragments of the *tal* gene were then amplified using gel extraction and purification. Using primers pK18-F / pK18-R, the vector fragment was amplified using plasmid pK18mobsacB-spec as a template, and the fragment was purified using gel extraction. Homologous recombination was performed at 50 °C for 5 min. The result was chemically transformed into DH5α, and after successful culture, bacterial selection, plasmid extraction, and sequencing verification, the gene-editing plasmid pK18mobsacB-spec-Δtal was obtained for the knockout of the *tal* gene.

[0059] In the host strain Cgl1036, the gene AvmysABC was integrated, and the plasmid pK18mobsacB-spec-ΔCgl1036::P was constructed first.tuf -AvmysABC. Using the genome of Corynebacterium glutamicum ATCC 13032 as a template, the upstream and downstream fragments of the Cgl1036 gene were amplified by PCR using Cgl1036-UH / DH-F / R primers (Table 1), and the constitutive promoter P was amplified using ptuf-F / R. tuf The gene fragment AvmysABC was amplified using primers AvmysA-F / AvmysC-R with pEC-XK99E-AvmysABC as a template, and then purified using gel extraction. The vector fragment was amplified using primers pK18-F / pK18-R with plasmid pK18mobsacB-spec as a template, and then purified using gel extraction. Homologous recombination was performed at 50 °C for 30 min. The result was chemically transformed into DH5α, and after successful culture, bacterial selection, plasmid extraction, and sequencing verification, the gene-editing plasmid pK18mobsacB-spec-ΔCgl1036::P was obtained. tuf -AvmysABC is used for chromosomal integration of the gene AvmysABC.

[0060] (2) Constructing genetically engineered strains of Corynebacterium glutamicum

[0061] The constructed gene-editing plasmid was transformed into *Corynebacterium glutamicum* via electroporation at a concentration of 800–1000 ng, at 25 μF, 200 Ω, and 2.5 kV. The transformed knockout strain was then plated on spectinomycin-resistant BHIS plates. Single-crossover mutants were selected, and individual colonies of each mutant were cultured in BHIS medium for 16 h. Colony PCR was used to verify the correct gene knockout, and the samples were sent to a sequencing company for further confirmation. The successfully verified strains were inoculated into tubes containing BHIS medium and cultured overnight at 30 °C. The resulting plasmid-free, antibiotic-free engineered *Corynebacterium glutamicum* strains were then streaked onto BHIG agar plates containing 10% sucrose to screen for strains that removed pK18mobsacB-spec-Δtal. These strains were then used for further editing or fermentation verification.

[0062] The transformed strains for chromosome integration were then plated on spectinomycin-resistant BHIS plates. Single-crossover mutants were selected, and individual colonies of each mutant were cultured in BHIS medium for 16 h. Once single colonies appeared, the strains were picked and cultured overnight in test tubes to create competent cells. The constructed pJYS3-N23 plasmid was then transferred into the competent cells via electroporation as described above. The cells were heat-shocked at 46 °C for 6 min, incubated on a shaker at 30 °C for 2 h, and plated on BHIS plates containing kanamycin and sucrose. The cells were then incubated at 30 °C until single colonies appeared. Successfully grown single colonies were identified as double-crossover mutants. Colony PCR was used to verify the correct editing of the strains, and the samples were finally sent to a sequencing company for further confirmation that the target gene had been integrated. The successfully validated strains were inoculated into test tubes containing BHIS medium and cultured overnight at 34 °C to remove plasmids. The plasmids were then streaked onto BHIG agar plates containing kanamycin to screen for plasmid-free strains, ultimately yielding plasmid-free, antibiotic-free Corynebacterium glutamicum strains for use in the next round of editing or for fermentation validation.

[0063] The steps for knocking out genes poxB and pta are the same as those for knocking out gene tal. The steps for integrating the target gene at sites such as lldA, nagB, and ppc can be found in the integration of AvmysABC at site Cgl1036.

[0064] (3) Constructing genetically engineered Corynebacterium glutamicum containing plasmid pEC-XK99E-AvmysABC

[0065] The genetically engineered strain with successfully edited genes was prepared as an electroporation competent state. pEC-XK99E-AvmysABC was transferred into the constructed genetically engineered strain by electroporation, as described in (2). Then, it was spread on a BHIS agar plate containing kanamycin resistance. After colonies grew, genetically engineered Corynebacterium glutamicum containing plasmid pEC-XK99E-AvmysABC was obtained for fermentation verification.

[0066] Table 1 Primers used for plasmid and genome construction

[0067] tal-UH-F GACATGATTACGAATTCGGTATCCGTGAGCACGCTATG tal-UH-R CGTGCTGATTGTGCAAGATCATCAATGTGAGAC tal-DH-F GATCTTGCACAATCAGCACGCTGCATCAGTAACG tal-DH-R GCCAGTGCCAAGCTTGCACGAAAGAAATTGGTTCTTCCAT poxB-UH-F GACATGATTACGAATTCCGTTAATGAGGAAAACCGAACCC poxB-UH-R TATCAATCATCACTGAACTCCTCAACGTTATGGCTATTGTGT poxB-DH-F TGAGGAGTTCAGTGATGATTGATACACCTGCTGTTCTCATTG ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ CTTCGGATCTAAACGATCTGGGTGGTTCCTTTCGGAGGG lldA-DH-F GTAGAGCTGGGCGGTGATTAAAGTTTCTCTCCTTAGCTATT lldA-DH-R CCAGTGCCAAGCTTGTCCTAGGTGGGATGCGAGGNAGB-UH-FNAGB-UH-F I'm B-UH-F GCTATGACATGATTACGAATTCCACGGTGGAAACGGTGGCGCGTTTCC I'm B-UH-R CTTCGGATCTAAACGATCTGGTCGGACTCCTTTTATTATCAGGAAAG nagB-DH-F GGTAGAGCTGGGCGGTGATTAAAACAAAAAGGAAAGTAGTGTGT nagB-DH-R CCAGTGCCAAGCTTGCACCCCATCCTTCCCGTGCAACTGTT ppc-UH-F CTATGACATGATTACGAATTCCGGGAAACTTTTTTAAGAAAGG ppc-UH-R GATCTAAACGATCTTAACTACTTTAAACACTCTTTCAC ppc-DH-F TAGAGCTGGGCGGTGATTAATCCAGCCGGCTGGGTAGTACTCG ppc-DH-R CCAGTGCCAAGCTTGAAGTATTCAAGGGGATTTCCGATAATTCCC of N23-F CGCCATGAGCATCGACGACGTTCATTTAAATAAAACGAAAGGCTCAGTCGAAAGAC of N23-R GAACGTCGTCGATGCTCATGGCGATCTACAACAGTAGAAATTCGGATCCATTAT Cgl1036-N23-F ATACTGCGTCAGCCTGGCGCTTGATTTAAATAAAACGAAAGGCTCAGTCGAAAGAC Cgl1036-N23-R CTCCCTCGAAGAACTCGAGCCACATTTAAATAAAACGAAAGGCTCAGTCGAAAGAC lldA-N23-F CTCCCTCGAAGAACTCGAGCCACATTTAAATAAAACGAAAGGCTCAGTCGAAAGAC lldA-N23-R GTGGCTCGAGTTCTTCGAGGGAGATCTACAACAGTAGAAATTCGGATCCATTAT pck-UH-F GCTATGACATGATTACGAATTCGGGCCAGGTGGAGGTAAGACCG pck-UH-R CCTTCGGATCTAAACGATCTTCGCGATCCAGTTCAGCAGTTCC pck-DH-F GAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCGAAGACCTCGACCTCGACGG pck-DH-R GGCCAGTGCCAAGCTTGTTTACTGTCTGATTTAAAATACGAACAAACCC pgk-F GAAGTCCAGGAGGACATACAATGGCTGTTAAGACCCTCAAGGAC pgk-R TAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTTGTTACTGAGCGAGAATTGCAACGCC pck-n23-1-F GAGCCAGGCCAGGAAGACGTTGCATTTAAATAAAACGAAAGGCTCAGTCGAAAGAC pck-n23-1-R GCAACGTCTTCCTGGCCTGGCTCATCTACAACAGTAGAAATTCGGATCCATTAT alaT-UH-F CTATGACATGATTACGAATTCAAGATTCCTGAGCCGCCGTCGTC alaT-UH-R CTTCGGATCTAAACGATCTAGATGCGGCGAGTTGTTCGCC alaT-DH-F TCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATTGG TTCAGGGGCACTGGCTTCAAC alaT-DH-R CCAGTGCCAAGCTTACTTTGATTTTCATCAGCAAATAACG pyk-F GAAGTCCAGGAGGACATACAATGGGCGTGGATAGACGAACTAAG pyk-R TAAAACGAAAGGCCCAGTCTTTCGACTGAGCCTTTCGTTTTATTTGTTAGAGCTTTGCAATCCTTGTGTCGTCAC alaT-N23-1-F GTCCAGTCAATACCATCCAGCCAATTTAAATAAAACGAAAGGCTCAGTCGAAAGAC alaT-N23-1-R TGGCTGGATGGTATTGACTGGACATCTACAACAGTAGAAATTCGGATCCATTAT pK18-F AAGCTTGGCACTGGCCGTCGTT pK18-R GAATTCGTAATCATGTCATAGCTGTTTCCTGTG

[0068] Example 3: Production of spore-like amino acid M-Gly by shake-flask fermentation

[0069] Based on Example 2, the genetically engineered strain was subjected to shake-flask fermentation at 30 °C and 220 rpm throughout the process, and cultured until OD. 600=1.0±0.1, add IPTG to a final concentration of 0.9 mM. Samples were taken after 72 h of shake-flask fermentation. A blank control group was also set up in this invention, i.e., plasmid expression without the introduction of exogenous genes. 1 mL of fermentation broth was taken, centrifuged at 10,000 rpm for 10 min, and the supernatant was collected for HPLC analysis. In the genetically engineered strains without knockout of the two acid-producing genes, the M-Gly yield accumulated to 1.22 g / L after 72 h; the genetically engineered strains with knockout of the two acid-producing pathway genes poxB and pta, simultaneously expressed on the plasmid, achieved the best results, with strain Cg-09 accumulating 1.38 g / L of M-Gly after 72 h; strain Cg-12 also accumulated 1.38 g / L of M-Gly after 72 h.

[0070] The experimental results show that knocking out competing pathway genes promotes the accumulation of M-Gly, reduces the decomposition of precursor substances, and directs more carbon metabolism toward product accumulation; integrating multiple copies of the target gene into the genome can further promote product accumulation; knocking out acid-producing pathway genes can create a more suitable environment for the strain's growth during fermentation, which is more conducive to the strain's growth and product accumulation.

[0071] Meanwhile, no product peak was detected in the blank control sample by HPLC. Therefore, under the same fermentation conditions, without the introduction of exogenous genes, *Corynebacterium glutamicum* does not produce spore-like amino acids. Detailed information on the shake-flask fermentation of the genetically engineered strain is shown in Table 2.

[0072] Table 2. Detailed information on shake-flask fermentation of genetically engineered strains

[0073] Cg-01 C. glutamicum ATCC 13032 carrying plasmid pEC-XK99E 0 Cg-02 C. glutamicum ATCC 13032 carrying plasmid pEC-XK99E-AvmysABC 0.08 Cg-03 C. glutamicum ATCC 13032 Δtal carrying plasmid pEC-XK99E-AvmysABC 0.22 Cg-04 <![CDATA[C. glutamicum ATCC 13032 Δtal ΔCgl1036::P tuf -AvmysABC carries the plasmid pEC-XK99E-AvmysABC]]> 0.35 Cg-05 <![CDATA[C. glutamicum ATCC 13032 Δtal ΔCgl1036::P tuf -AvmysABC ΔlldA::P tuf -AvmysABC carries the plasmid pEC-XK99E-AvmysABC]]> 0.64 Cg-06 <![CDATA[C. glutamicum ATCC 13032 Δtal ΔCgl1036::P tuf -AvmysABC ΔlldA::P tuf -AvmysABC ΔnagB::P tuf -AvmysABC carries the plasmid pEC-XK99E-AvmysABC]]> 0.96 Cg-07 <![CDATA[C. glutamicum ATCC 13032 Δtal ΔCgl1036::P tuf -AvmysABC ΔlldA::P tuf -AvmysABC ΔnagB:: P tuf -AvmysABC Δppc:: P tuf - AvmysABC carrying plasmid pEC-XK99E-AvmysABC]]> 1.22 Cg-08 <![CDATA[C. glutamicum ATCC 13032 Δtal ΔCgl1036:: P tuf -AvmysABC ΔlldA:: P tuf -AvmysABCΔnagB:: P tuf -AvmysABC Δppc:: P tuf - AvmysABC ΔpoxB carrying plasmid pEC-XK99E-AvmysABC]]> 1.3 Cg-09 <![CDATA[C. glutamicum ATCC 13032 Δtal ΔCgl1036:: P tuf -AvmysABC ΔlldA:: P tuf -AvmysABCΔnagB:: P tuf -AvmysABC Δppc:: P tuf -AvmysABC ΔpoxB Δpta carrying plasmid pEC-XK99E-AvmysABC]]> 1.38 Cg-10 <![CDATA[C. glutamicum ATCC 13032 Δtal ΔCgl1036:: P tuf -AvmysABC ΔlldA:: P tuf -AvmysABCΔnagB:: P tuf -AvmysABC Δppc:: P tuf -AvmysABC ΔpoxB Δpta Δpck::P tuf -pgk carries plasmid pEC-XK99E-AvmysABC]]> 1.44 Cg-11 <![CDATA[C. glutamicum ATCC 13032 Δtal ΔCgl1036:: P tuf -AvmysABC ΔlldA:: P tuf -AvmysABCΔnagB:: P tuf -AvmysABC Δppc:: P tuf -AvmysABC ΔpoxB Δpta ΔalaT::P tuf -pyk carries plasmid pEC-XK99E-AvmysABC]]> 1.47 Cg-12 <![CDATA[C. glutamicum ATCC 13032 Δtal ΔCgl1036:: P tuf -AvmysABC ΔlldA:: P tuf -AvmysABCΔnagB:: P tuf -AvmysABC Δppc:: P tuf -AvmysABC ΔpoxB Δpta Δpck::P tuf -pgk ΔalaT::P tuf -pyk carries plasmid pEC-XK99E-AvmysABC]]> 1.53

[0074] Example 4: Synthesis of M-Gly by fed-batch culture in a fermenter

[0075] Fed-batch fermentation experiments were conducted on genetically engineered strains of M-Gly in a 50 L fermenter.

[0076] The genetically engineered Corynebacterium glutamicum that performed well in Example 2 was inoculated into liquid BHIS medium containing kanamycin and cultured overnight at 30 °C and 220 rpm for 16–18 h to obtain a primary seed culture. This primary seed culture was then inoculated into a new fermentation system for further expansion culture at 30 °C and 220 rpm. 600 =1.0±0.1, to obtain secondary seed culture, which was then inoculated into a 50 L fermenter to achieve a final culture volume of 20 L for fermentation. Fermentation was carried out at 30 °C, with a stirring speed of 220 r / min, an aeration rate of 1~2 vvm, and a pH of 7.0±0.2, until OD reached. 600When the concentration of the sample reached 15 ± 0.5, IPTG was added to a final concentration of 0.9 mM, and the mixture was induced and cultured at 30 °C for 72 h (or 60 h). Dissolved oxygen was controlled by adjusting the stirring speed (220 rpm) and aeration rate (2–6 vvm). During the reaction, a mother liquor concentration of 500 g / L glucose was added to maintain a final concentration of 10–15 g / L, and 50% ammonia was added to maintain the pH of the entire system at 7.0, thereby ensuring the production of the product M-Gly.

[0077] After 72 hours of fermentation, strain Cg-09 achieved an M-Gly yield of 8.68 g / L and an OD of [missing value]. 600 The highest yield reached 82; after 72 h of fermentation, the yield of strain Cg-12 reached 10.12 g / L, and the highest OD600 reached 138.

[0078] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. A genetically engineered Corynebacterium glutamicum that produces the mycosporine-glycine-like amino acid, characterized in that, Starting with Corynebacterium glutamicum ATCC 13032, the 3-dehydroquinaate synthase gene AvmysA, the O-methyltransferase gene AvmysB, and the ATP-grasp ligase gene AvmysC derived from Anabaena var. var. ATCC29413 were heterologously expressed on plasmids. The genes AvmysA, AvmysB, and AvmysC were integrated into the genome. The aldolase gene tal, which competes with the acid production pathway, was knocked out. The pyruvate dehydrogenase gene poxB and the phosphoacetyltransferase gene pta, which compete with the acid production pathway, were also knocked out.

2. A genetically engineered Corynebacterium glutamicum that produces the mycosporine-glycine-like amino acid, characterized in that, The following methods were used to modify Corynebacterium glutamicum ATCC 13032, the starting strain. 1) Knock out the aldolase gene tal on the genome of Corynebacterium glutamicum; 2) knock-out of short-chain dehydrogenase gene Cgl 1036 and replace with a strong constitutive promoter P tuf gene cluster AvmysABC; 3) knock-out of the L-lactate dehydrogenase gene lldA and replace it with a strong constitutive promoter P tuf gene cluster AvmysABC; 4) Knock out the glucosamine-6-phosphate deaminase gene nagB and replace it with one generated by a strong constitutive promoter P. tuf The gene cluster that initiates expression is AvmysABC; 5) Knock out the phosphoenolpyruvate carboxylase gene ppc and replace it with one generated by a strong constitutive promoter P. tuf The gene cluster that initiates expression is AvmysABC; The gene cluster AvmysABC consists of the 3-dehydroquinacid synthase gene AvmysA, the O-methyltransferase gene AvmysB, and the ATP-grasp ligase gene AvmysC, all derived from the algae Anabaena ATCC 29413.

3. The genetically engineered Corynebacterium glutamicum for producing the mycosporine-glycine-like amino acid according to claim 2, characterized in that, The modification method also includes: Knock out the pyruvate dehydrogenase gene poxB; Knock out the phosphorylated acetyltransferase gene pta.

4. The genetically engineered Corynebacterium glutamicum for producing the mycosporine-glycine-like amino acid according to claim 3, characterized in that, The modification method also includes: Knock out the phosphoenolpyruvate carboxykinase gene pck and replace it with one generated by a strong constitutive promoter P tuf The expression of the phosphoglycerate kinase gene pgk is initiated.

5. The genetically engineered Corynebacterium glutamicum for producing the mycosporine-glycine-like amino acid according to claim 4, characterized in that, The modification method also includes: Knock out the aminotransferase-I gene alaT and replace it with a gene from the strongly constitutive promoter P. tuf The pyruvate kinase gene pyk is initiated for expression.

6. The genetically engineered Corynebacterium glutamicum that produces the mycosporine-glycine-like amino acid according to any one of claims 2-5, characterized in that, The modification method also includes: The plasmid pEC-XK99E-AvmysABC was introduced; the plasmid pEC-XK99E-AvmysABC was constructed by linking genes AvmysA, AvmysB and AvmysC into a gene cluster via RBS and then onto the pEC-XK99E plasmid to obtain the recombinant plasmid pEC-XK99E-AvmysABC.

7. The genetically engineered Corynebacterium glutamicum that produces the mycosporine-glycine-like amino acid according to any one of claims 2-6, characterized in that: 1) The amino acid sequence encoded by the 3-dehydroquinanate synthase gene AvmysA is shown in SEQ ID NO.1; 2) The amino acid sequence encoded by the O-methyltransferase gene AvmysB is shown in SEQ ID NO.2; 3) The amino acid sequence encoded by the ATP-grasp ligase gene AvmysC is shown in SEQ ID NO.3; 4) The strongly constitutive promoter P tuf The nucleotide sequence is shown in SEQ ID NO.4; 5) The nucleotide sequence of the RBS (CK1) is shown in SEQ ID NO.

5.

8. A method for constructing a genetically engineered Corynebacterium glutamicum for producing the mycosporine-Glycine-like amino acid, characterized in that, The construction method includes the modification method as described in any one of claims 2-7.

9. The use of the genetically engineered Corynebacterium glutamicum that produces the mycosporine-Glycine amino acid as described in any one of claims 1-7, or the genetically engineered Corynebacterium glutamicum that produces the mycosporine-Glycine constructed by the method described in claim 8, in the fermentation production of the mycosporine-Glycine amino acid.

Images