Mutant and mutant plasmid of fundc1 gene, and construction method therefor and use thereof

By constructing mutants and mutant plasmids of the FUNDC1 gene, mitophagy competitively inhibited mitochondrial autophagy, solving the problem of excessive activation of mitochondrial autophagy in myocardial ischemia/reperfusion injury, achieving the effect of inhibiting mitochondrial autophagy without damage to mitochondria.

WO2025112773A1PCT designated stage Publication Date: 2025-06-05NORTH CHINA UNIVERSITY OF SCIENCE AND TECHNOLOGY
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2024/117288
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-07-12
Filing Date
2024-09-06
Publication Date
2025-06-05

AI Technical Summary

Technical Problem

In myocardial ischemia/reperfusion injury, mitochondrial autophagy may be overactivated, leading to cardiomyocyte death, and the prior art has not yet effectively inhibited mitochondrial autophagy.

Method used

By constructing mutants and mutant plasmids of the FUNDC1 gene, site-directed mutation technology is used to generate competitively inhibit the recognition of FUNDC1 and LC3, etc., thereby inhibiting mitochondrial autophagy.

Benefits of technology

Effectively inhibit mitochondrial autophagy, reduce cardiomyocyte death, and no obvious damage to mitochondria, providing a feasible solution for the preparation of drugs to inhibit mitochondrial autophagy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2024117288_05062025_PF_FP_ABST
    Figure CN2024117288_05062025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention belongs to the field of molecular biology, and particularly relates to a mutant and a mutant plasmid of an FUNDC1 gene, and a construction method therefor and the use thereof. The provided mutant plasmid has an increased FUNDC1 protein expression level, and can increase the protein expression level of mitophagy proteins COXⅣ and TOM20. After the transfection of the mutant plasmid, the cell activity and mitochondrial membrane potential are not significantly changed, indicating that the mutant plasmid can inhibit mitophagy and causes no damage to mitochondria, which provides a feasible solution for the preparation of a mitophagy drug, and has great significance for the research on the pathophysiological mechanism of myocardial I / R injuries.
Need to check novelty before this filing date? Find Prior Art

Description

FUNDC1 gene mutant, mutant plasmid, and construction method and application thereof Technical Field

[0001] The present invention belongs to the field of molecular biology, and in particular relates to a mutant of a FUNDC1 gene, a mutant plasmid, and a construction method and application thereof. Background Art

[0002] Myocardial ischemia / reperfusion (I / R) injury is a serious injury that occurs during myocardial ischemia and reperfusion during the treatment of ischemic heart disease. It is caused by factors such as the massive production of reactive oxygen species (ROS), inflammatory cell infiltration, and calcium overload.

[0003] Mitophagy is a highly conserved cellular process in eukaryotic cells that selectively removes dysfunctional or redundant mitochondria through the autophagy mechanism. This process effectively regulates mitochondrial number and maintains the stability of cellular energy metabolism. However, studies have shown that in myocardial ischemia / reperfusion injury, mitophagy may be overactivated, leading to cardiomyocyte death.

[0004] FUNDC1 is a newly discovered mitochondrial outer membrane protein composed of 155 amino acid residues. Its LC3-interacting region (LIR) motif binds to LC3 to initiate mitophagy. FUNDC1 is a key regulator of mitophagy, but studies have not yet explored how to construct mutant FUNDC1 to modulate its function and inhibit mitophagy. Therefore, the present invention provides mutants of the FUNDC1 gene, mutant plasmids, and methods and applications for their construction.

[0005] Summary of the Invention

[0006] In order to develop drugs that can inhibit mitochondrial autophagy, the present invention provides mutants of the FUNDC1 gene, mutant plasmids, and construction methods and applications thereof. The FUNDC1 mutant plasmid provided by the present invention competitively inhibits the recognition of the body's FUNDC1 with LC3, etc. by translating the mutant FUNDC1 protein, thereby inhibiting mitochondrial autophagy without damaging the mitochondria.

[0007] The present invention provides a mutant of the FUNDC1 gene, the nucleotide sequence of the FUNDC1 gene is shown in SEQ ID NO. 1, and the mutant is selected from any one of the following:

[0008] (1) Adenine A at position 53 of the FUNDC1 gene mutated to thymine T.

[0009] (2) Adenine A at positions 32 and 53 of the FUNDC1 gene mutated to thymine T.

[0010] The present invention also provides a FUNDC1 mutant plasmid, which contains the mutant of the FUNDC1 gene according to claim 1.

[0011] Furthermore, the FUNDC1 mutant plasmid is a plasmid obtained by mutating the tyrosine at position 18 of the amino acid sequence of the FUNDC1 gene to phenylalanine or mutating the tyrosine at positions 11 and 18 of the amino acid sequence of the FUNDC1 gene to phenylalanine.

[0012] Furthermore, the FUNDC1 mutant plasmid is obtained by connecting the mutant FUNDC1 gene with a vector.

[0013] Furthermore, the vector is a pcDNA3.1-3xFlag-T2A-EGFP vector.

[0014] The present invention also provides a method for constructing the FUNDC1 mutant plasmid, comprising the following steps:

[0015] The target gene FUNDC1 as shown in SEQ ID NO. 1 was amplified by PCR to obtain a target gene FUNDC1 fragment;

[0016] The adenine A at position 53 in the target gene FUNDC1 fragment is mutated to thymine T, or the adenine A at positions 32 and 53 are mutated to thymine T, to obtain a mutant of the FUNDC1 gene;

[0017] The pcDNA3.1-3xFlag-T2A-EGFP vector was digested with BamHI and XhoI enzymes to obtain a linearized pcDNA3.1-3xFlag-T2A-EGFP vector fragment;

[0018] The linearized pcDNA3.1-3xFlag-T2A-EGFP vector fragment was obtained and the mutant of the FUNDC1 gene to obtain the recombinant product;

[0019] The recombinant product was transfected into H9c2 cells to obtain the FUNDC1 mutant plasmid.

[0020] Furthermore, the reaction procedure of the PCR amplification is: 94°C for 2 min; 98°C for 10 s, 60°C for 30 s, 68°C for 45 s, 30 cycles; 72°C for 3 min.

[0021] Furthermore, the reaction system for obtaining the recombinant product is as follows: ddH2O 5 μL, 5×CE II Buffer 2 μL, linearized pcDNA3.1-3xFlag-T2A-EGFP vector fragment 1 μL, mutant target gene FUNDC1 fragment 1 μL, Exnase TM II 1μL.

[0022] The present invention also provides the use of the FUNDC1 gene mutant or the FUNDC1 mutant plasmid in preparing a drug for inhibiting mitochondrial autophagy.

[0023] Furthermore, the drug is prepared into various dosage forms by mixing the FUNDC1 gene mutant or the FUNDC1 mutant plasmid with any pharmaceutically acceptable excipients; it can be prepared into powders, granules, tablets, capsules, suspensions or emulsions using conventional methods.

[0024] The auxiliary materials include one or more of mannitol, sorbitol, polyethylene glycol, glucose, lactose, galactose, phosphoric acid, lactic acid, tartaric acid, arginine, lysine, glutamic acid, aspartic acid, polyethylene glycol, polyvinyl alcohol, polyvinyl pyrrolidone, and carboxyl / hydroxy cellulose.

[0025] The experimental principle of the present invention is as follows: a FUNDC1 mutant plasmid is constructed by site-directed mutagenesis technology, and then the exogenous FUNDC1 mutant plasmid is transported into the cell by transfection. The mutant FUNDC1 protein is transcribed and translated into a mutant FUNDC1 protein, which competes with the endogenous FUNDC1 protein for binding to the LC3 protein, affecting the recognition of mitochondria and LC3, thereby inhibiting mitophagy.

[0026] Compared with the prior art, the present invention has the following beneficial effects:

[0027] (1) The present invention intervenes from the genetic aspect, constructs a mutant FUNDC1 plasmid through site-directed mutagenesis technology, and then transports the exogenous mutant FUNDC1 plasmid into the cell by transfection. Since the exogenous mutant FUNDC1 plasmid translates a large amount of mutant FUNDC1 protein in the cell and it is more likely to bind to autophagy-related proteins such as LC3, the exogenous mutant FUNDC1 produces competitive inhibition with the endogenous FUNDC1, thereby inhibiting mitochondrial autophagy, and no obvious cytotoxic effect is observed.

[0028] (2) The reagents used in the present invention adopt liposome nanoparticle technology, which helps to improve transfection efficiency and reduce cytotoxicity.

[0029] (3) The Y18 site mutant plasmid and the 11-site and 18-site co-mutant plasmid provided by the present invention have increased FUNDC1 protein expression levels. The Y18 site mutant plasmid and the 11-site and 18-site co-mutant plasmid can significantly increase the expression levels of mitochondrial autophagy proteins COXⅣ and TOM20 proteins, and there is no significant change in cell activity and mitochondrial membrane potential after mutant plasmid transfection, indicating that the mutant plasmid of the present invention can inhibit mitochondrial autophagy without damaging mitochondria, providing a feasible solution for the preparation of mitochondrial autophagy drugs, which is of great significance for studying the pathophysiological mechanism of myocardial I / R injury. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following is a brief introduction to the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative work. Unless otherwise specified, the technical means used in the following embodiments are conventional means well known to those skilled in the art. The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0031] Figure 1 Schematic diagram of agarose gel electrophoresis results of PCR amplification products;

[0032] In the figure, A is a schematic diagram of the agarose gel electrophoresis results of the PCR amplification products of the FUNDC1 gene: from left to right, lane 1 is the PCR amplification product, and lane 2 is the marker;

[0033] B is a schematic diagram of the agarose gel electrophoresis results of the FUNDC1 gene PCR vector enzyme digestion products: from left to right, lanes 1, 2, and 3 are vector enzyme digestion products, and lane 4 is the marker.

[0034] Figure 2 is a map of the pcDNA3.1-3xFlag-T2A-EGFP vector;

[0035] Figure 3 is a map of the FUNDC1 overexpression plasmid;

[0036] Figure 4 is a Y11 site mutant plasmid map;

[0037] Figure 5 is a Y18 site mutant plasmid map;

[0038] Figure 6 is a plasmid map of co-mutation of sites 11 and 18.

[0039] Figure 7 Schematic diagram of GFP green fluorescence observation using a confocal microscope;

[0040] In the figure, A is a schematic diagram of GFP green fluorescence of an empty plasmid;

[0041] B is a schematic diagram of GFP green fluorescence of FUNDC1 overexpression plasmid;

[0042] C is a schematic diagram of GFP green fluorescence of the Y11 site mutant plasmid;

[0043] D is a schematic diagram of GFP green fluorescence of the Y18 site mutant plasmid;

[0044] E is a schematic diagram of GFP green fluorescence of the plasmid with co-mutation of sites 11 and 18.

[0045] Figure 8 Schematic diagram of the expression of FUNDC1 protein detected by Western blotting using empty plasmid (empty plasmid group), Y11 site mutant plasmid (mutated Y11 site group), and Y18 site mutant plasmid (mutated Y18 site group) (Note: n=8, *P<0.05 vs. Control);

[0046] In the figure, A is a schematic diagram of protein expression of the Y11 site mutant plasmid;

[0047] B is a schematic diagram of protein expression of the Y18 site mutant plasmid;

[0048] C is a statistical diagram of protein expression of the Y11 site mutant plasmid;

[0049] D is a statistical graph of protein expression of the Y18 site mutant plasmid.

[0050] Figure 9 Schematic diagram of the effects of Western blotting on the expression of mitophagy proteins by empty plasmid (empty plasmid group), FUNDC1 overexpression plasmid (overexpression group), Y11 site mutant plasmid (mutation Y11 group), Y18 site mutant plasmid (mutation Y18 group), and 11- and 18-site co-mutation plasmid (mutation Y11+Y18 group) (Note: n=6, *P<0.05 vs. Control);

[0051] In the figure, A is a schematic diagram of COXⅣ protein expression;

[0052] B is a schematic diagram of TOM20 protein expression;

[0053] C is the statistical diagram of COXⅣ protein expression;

[0054] D is the statistical graph of TOM20 protein expression.

[0055] Figure 10 Schematic diagram of the effects of empty plasmid (empty plasmid group), FUNDC1 overexpression plasmid (overexpression group), Y11 site mutant plasmid (mutation Y11 group), Y18 site mutant plasmid (mutation Y18 group), and 11- and 18-site co-mutation plasmid (mutation Y11+Y18 group) on mitochondrial membrane potential.

[0056] Figure 11 Schematic diagram of cell viability of the untransfected group, empty plasmid (empty plasmid group), FUNDC1 overexpression plasmid (overexpression group), Y11 site mutant plasmid (mutation Y11 group), Y18 site mutant plasmid (mutation Y18 group) and 11- and 18-site co-mutation plasmid (mutation Y11+Y18 group). DETAILED DESCRIPTION

[0057] The present invention will be described in detail below with reference to the accompanying drawings and specific examples, but they should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources.

[0058] Example 1: Construction of empty plasmid, FUNDC1 overexpression plasmid, Y11 site FUNDC1 mutant plasmid, Y18 site FUNDC1 mutant plasmid Empty plasmid (empty plasmid group), FUNDC1 overexpression plasmid (overexpression group), Y11 site mutant plasmid and 11 site and 18 site co-mutation plasmid.

[0059] The present invention utilizes restriction endonucleases to obtain a linearized vector; PCR amplification is used to prepare a target gene fragment; the amplification primers used must be designed to include a homologous recombination sequence at their 5' end, and the target gene fragment is amplified using the amplification primers, with the sequences at the 5' and 3' ends of the amplified product being completely identical to the sequences at both ends of the linearized vector; the linearized vector and the target gene amplification product are connected and subjected to a recombination reaction to achieve in vitro circularization of the linearized vector and the target gene fragment to obtain a recombinant product; the recombinant product is directly transformed to obtain a plasmid. The specific experimental method is as follows:

[0060] 1. Obtaining the target gene FUNDC1 fragment

[0061] The target gene FUNDC1 (nucleotide sequence shown in SEQ ID NO.1) was obtained from Jinbaiao Company.

[0062] The target gene FUNDC1 shown in SEQ ID NO. 1 was amplified by PCR;

[0063] PCR amplification reaction system: ddH2O 32μL, 10× PCR Buffer 5μL, dNTP Mix (2.5mM) 5μL, MgSO4 (25mM) 3μL, upstream primer (10μM) 1.5μL, downstream primer (10μM) 1.5μL, template (10ng / μL) 1μL;

[0064] Upstream primer: CTTGGTACCGAGCTCCGGATCCGCCACCATGGCGTCCCGAAACCCCCTC (SEQ ID NO. 2);

[0065] Downstream primer: GAAGGGCCCTCTAGACTCGAGAGATGCCAGGCCTAGCAAAAAGCCTCCC (SEQ ID NO. 3);

[0066] The PCR amplification reaction procedure was as follows: 94°C for 2 min; 98°C for 10 s, 60°C for 30 s, and 68°C for 45 s, 30 cycles; and 72°C for 3 min. PCR products were detected by agarose gel electrophoresis.

[0067] Agarose gel electrophoresis (Figure 1A) showed that the FUNDC1 gene had a clear band at 1000 bp. A DNA purification and recovery kit was used to recover the target band of the PCR amplification product detected by agarose gel electrophoresis to obtain the target gene FUNDC1 fragment, which was stored for future use.

[0068] 2. Enzyme digestion to obtain linearized pcDNA3.1-3xFlag-T2A-EGFP vector fragment

[0069] The pcDNA3.1-3xFlag-T2A-EGFP vector (obtained from Jinbaiao) was digested with BamHI and XhoI to obtain a linearized pcDNA3.1-3xFlag-T2A-EGFP vector fragment;

[0070] Enzyme digestion reaction system: 41 μL ddH2O, 5 μL 10× CutSmart Buffer 2, 1 μL BamHI (10 U / μL), 1 μL EcoRI (10 U / μL). Detect the vector digestion products by agarose gel electrophoresis.

[0071] Agarose gel electrophoresis (Figure 1B) showed that the linearized pcDNA3.1-3xFlag-T2A-EGFP vector fragment had a clear band at 1500 bp. A DNA purification and recovery kit was used to recover the target band of the vector enzyme digestion product detected by agarose gel electrophoresis to obtain the linearized pcDNA3.1-3xFlag-T2A-EGFP vector fragment, which was stored for future use.

[0072] 3. Connect the target gene FUNDC1 fragment with the linearized pcDNA3.1-3xFlag-T2A-EGFP vector fragment to obtain the recombinant product pcDNA3.1-FUNDC1

[0073] Using ClonExpress TM II One Step Cloning Kit was used to ligate the obtained target gene FUNDC1 fragment with the linearized pcDNA3.1-3xFlag-T2A-EGFP vector fragment to obtain the recombinant product pcDNA3.1-FUNDC1, which was stored for future use;

[0074] Recombination reaction system: ddH2O 5μL, 5×CE II Buffer 2μL, linearized pcDNA3.1-3xFlag-T2A-EGFP vector fragment 1μL, target gene FUNDC1 fragment 1μL, ExnaseTM II 1μL.

[0075] IV. Culture of H9c2 cells (H9c2 cell line derived from rat embryonic heart tissue, purchased from ATCC, USA)

[0076] Cell recovery: Remove H9c2 cells from -80°C, thaw quickly in a 37°C water bath, add to a centrifuge tube containing 5 mL of complete DMEM medium, and centrifuge at 800 rpm for 5 min. After centrifugation, discard the medium and add 6 mL of new medium to the centrifuge tube. Use a pipette to blow the H9c2 cells evenly, aspirate them into a culture flask, and place in a 37°C, 5% CO2 incubator overnight.

[0077] Cell counting: Remove cells from the incubator, disinfect the outer surface with 75% alcohol, place in a clean bench, discard the old culture medium, rinse with PBS three times, absorb the residual liquid, add an appropriate amount of 0.25% trypsin, shake the culture flask to make it cover the bottom of the flask, and when large pieces of cells are visibly falling off, add an appropriate amount of complete DMEM medium to terminate the digestion, pipette the bottom of the flask to make all the cells fall off into the culture medium, and obtain a cell suspension; transfer the cell suspension to a centrifuge tube, seal it with sealing film, centrifuge at 800 rpm for 5 minutes, discard the supernatant, add complete culture medium and pipette to mix, resuspend the cells to a single cell suspension without obvious cell clumps, take 10 μL and count, the number of cells / mL = 104 × Average of the counting squares.

[0078] Cell passaging: Observe the density and adhesion of H9c2 cells. Cells can be passaged when they are growing well. Remove the culture flask from the incubator, pour out the original culture medium in the flask, gently rinse it three times with PBS, aspirate it, and then add 200μL of trypsin to allow it to fully contact the cells at the bottom of the flask and let it sit for 2 minutes. When a large amount of white flakes fall off the bottom of the flask, add new culture medium to terminate digestion and blow evenly. Take 5mL of cell suspension, transfer it into a sterile cell culture flask, mark it, and place it in a 37°C incubator.

[0079] Cell culture: Remove the culture flask from the incubator, pour out the original culture medium in the flask, rinse it gently three times with PBS, aspirate it, and then add 200μL of trypsin to fully contact the cells at the bottom of the flask and let it sit for 2 minutes. When a large number of white flakes fall off the bottom of the flask, add new culture medium to terminate the digestion and blow off the cells at the bottom of the flask. Pipette the cell suspension into a centrifuge tube and centrifuge at 800rpm for 5 minutes. After centrifugation, pour out the supernatant medium, add 5mL of new culture medium, blow the cells evenly, and use a 200μL pipette to aspirate the cell suspension. Add the cell suspension to a counting plate for cell counting. Count three times and take the average value. Dilute the cell suspension proportionally to ensure 50,000 cells per ml. Mix the diluted cell suspension and add it to the culture dish. Add the remaining cell suspension to the culture flask. Place the culture flask and culture dish in an incubator at 37°C and 5% CO2.

[0080] Cell freezing: Remove the culture flask from the incubator, pour out the original culture medium in the flask, rinse it gently three times with PBS, add trypsin for digestion, add an appropriate amount of new culture medium, and gently blow with a plastic pipette to evenly distribute the cells. Then, transfer them to a centrifuge tube, set the speed to 1000 rpm, centrifuge for 5 minutes, remove the supernatant, the white precipitate is the cells, add 1 mL of freezing solution to the centrifuge tube, blow gently to prevent damage to the cells, then divide it into cryopreservation tubes, seal it with sealing film, cool it according to the gradient, place it at 4°C for 30 minutes, then place it in a -20°C refrigerator for 2 hours, and finally place it in a -80°C refrigerator for long-term storage.

[0081] H9c2 cells were observed under a microscope and the density was about 80%, which indicated that they could be used for transfection.

[0082] IV. Transfection of Empty Plasmid

[0083] System A: MEM reduced serum medium 125 μL, Lipofectamine TM 3000 7.5 μL;

[0084] System B: 125 μL of MEM reduced serum medium, 5 μL of P3000, 2500 ng of linearized pcDNA3.1-3xFlag-T2A-EGFP vector fragment;

[0085] After mixing the two systems, incubate at room temperature for 15 minutes. After the incubation period, mix system B into system A and incubate at room temperature for another 15 minutes to obtain a mixed solution. Finally, add the mixed solution evenly to H9c2 cells for transfection and culture in an incubator. After 6 hours of transfection, replace the serum-free medium in the culture dish with complete medium and culture in a cell culture incubator to obtain a bacterial solution containing no plasmid for use.

[0086] The obtained empty vector plasmid has a map shown in FIG2 .

[0087] 5. Transfection of FUNDC1 Overexpression Plasmid

[0088] System A: MEM serum-free medium 125 μL, Lipofectamine TM 3000 7.5 μL;

[0089] System B: MEM serum-free medium 125 μL, P3000 5 μL, recombinant product pcDNA3.1-FUNDC1 2500 ng;

[0090] After mixing the two systems, incubate at room temperature for 15 minutes. After the incubation period, mix system B into system A and incubate at room temperature for another 15 minutes. Finally, add the liquid evenly to the culture dish and place it in the incubator for incubation. Six hours after transfection, replace the serum-free medium in the dish with complete medium and place it in a cell culture incubator to obtain the FUNDC1 overexpression plasmid solution for future use.

[0091] The obtained FUNDC1 overexpression plasmid has a map shown in FIG3 .

[0092] VI. Transfection of Y11-site FUNDC1 mutant plasmid or Y18-site FUNDC1 mutant plasmid

[0093] The FUNDC1 protein was predicted using online databases (STRING, https: / / string-db.org / ; INBIO, https: / / inbio-discover.com / ). The prediction results showed that there are two potential tyrosine phosphorylation sites on the FUNDC1 protein (site Y11 and site Y18). Therefore, site-directed mutagenesis was used to mutate the adenine A at site 32 or site 53 on the target gene FUNDC1 fragment to a thymine T (i.e., tyrosine was mutated to phenylalanine at site Y11 or site Y18 on the FUNDC1 protein). The target gene FUNDC1 fragment with the Y11 mutation, namely mutant 1 (nucleotide sequence shown in SEQ ID NO. 4), and the target gene FUNDC1 fragment with the Y18 mutation, namely mutant 2 (nucleotide sequence shown in SEQ ID NO. 5), were obtained.

[0094] The Y11-site mutated target gene FUNDC1 fragment or the Y18-site mutated target gene FUNDC1 fragment was ligated with the linearized pcDNA3.1-3xFlag-T2A-EGFP vector fragment to obtain the recombinant product pcDNA3.1-Y11-FUNDC1 or the recombinant product pcDNA3.1-Y18-FUNDC1, respectively. The specific method is the same as the method for obtaining the recombinant product pcDNA3.1-FUNDC1;

[0095] System A: MEM serum-free medium 125 μL, Lipofectamine TM 3000 7.5 μL;

[0096] System B: MEM serum-free medium 125 μL, P3000 5 μL, recombinant product pcDNA3.1-Y11-FUNDC1 or recombinant product pcDNA3.1-Y18-FUNDC1;

[0097] Mix the two systems thoroughly and incubate at room temperature for 15 minutes. After incubation, mix system B into system A and incubate at room temperature for another 15 minutes. Finally, add the liquid evenly to H9c2 cells for transfection and incubate in an incubator. Six hours after transfection, replace the serum-free medium in the culture dish with complete medium and incubate in a cell culture incubator to obtain the Y11-site mutant plasmid or Y18-site mutant plasmid solution for use.

[0098] The map of the obtained Y11 site mutant plasmid is shown in FIG4 , and the map of the Y18 site mutant plasmid is shown in FIG5 .

[0099] VII. Transfection of Y11 and Y18 co-mutated plasmids

[0100] Using site-directed mutagenesis, the adenine A at positions 32 and 53 on the target gene FUNDC1 fragment was mutated to thymine T (i.e., positions Y11 and Y18 on the FUNDC1 protein were mutated from tyrosine to phenylalanine), obtaining a target gene FUNDC1 fragment with both Y11 and Y18 sites mutated, namely mutant 3 (nucleotide sequence shown in SEQ ID NO. 6);

[0101] The FUNDC1 fragment of the target gene co-mutated at the Y11 and Y18 sites was ligated with the linearized pcDNA3.1-3xFlag-T2A-EGFP vector fragment to obtain the recombinant product pcDNA3.1-Y11-Y18-FUNDC1. The specific method was the same as that for obtaining the recombinant product pcDNA3.1-FUNDC1.

[0102] System A: MEM serum-free medium 125 μL, Lipofectamine TM 3000 7.5 μL;

[0103] System B: MEM serum-free medium 125 μL, P3000 5 μL, recombinant product pcDNA3.1-Y11-Y18-FUNDC1;

[0104] After mixing the two systems, incubate at room temperature for 15 minutes. After the incubation period, mix system B into system A and incubate at room temperature for another 15 minutes. Finally, add the liquid evenly to H9c2 cells for transfection and culture in an incubator. Six hours after transfection, replace the serum-free medium in the culture dish with complete medium and culture in a cell culture incubator to obtain a bacterial solution containing the co-mutated plasmids at sites 11 and 18, ready for use.

[0105] The maps of the obtained 11-site and 18-site co-mutation plasmids are shown in Figure 6 .

[0106] In addition, 24 hours after transfection, green fluorescent protein (GFP) was observed for the empty plasmid, the FUNDC1 overexpression plasmid, the Y11 site FUNDC1 mutant plasmid, the Y18 site FUNDC1 mutant plasmid, and the 11 and 18 sites co-mutated plasmid. As shown in Figure 7, the expression level of GFP fluorescent protein in the cells increased, indicating that the plasmids were successfully transfected.

[0107] SEQ ID NO.1:

[0108] SEQ ID NO.4:

[0109] SEQ ID NO.5:

[0110] SEQ ID NO.6:

[0111] Example 2: Expression analysis of FUNDC1 mutant plasmids.

[0112] Western-blotting was used to detect the expression of FUNDC1 protein by successfully transfected empty plasmid (empty plasmid group), Y11 site mutant plasmid (mutant Y11 group) and Y18 site mutant plasmid (mutant Y18 group).

[0113] The results are shown in Figure 8. Compared with the empty plasmid, the expression level of FUNDC1 protein in the Y11 site mutant plasmid and the Y18 site mutant plasmid were significantly increased, indicating that the FUNDC1 protein of the constructed Y11 site mutant plasmid and the Y18 site mutant plasmid was overexpressed.

[0114] Example 3: Effects of FUNDC1 mutant plasmid on mitophagy.

[0115] 1. Expression of Mitochondrial Autophagy Proteins

[0116] Western-blotting was used to detect the expression of mitochondrial autophagy proteins (TOM20 protein, COXⅣ protein) by successfully transfected empty plasmid (empty plasmid group), FUNDC1 overexpression plasmid (overexpression group), Y11 site mutant plasmid (mutation Y11 group), Y18 site mutant plasmid (mutation Y18 group) and 11- and 18-site co-mutation plasmid (mutation Y11+Y18 group).

[0117] The results are shown in Figure 9. Compared with the empty plasmid, the expression levels of COXⅣ and TOM20 proteins in the Y18 mutation group and the Y11+Y18 mutation group increased most significantly, indicating that when the Y18 site of FUNDC1 mutated, mitochondrial autophagy was inhibited; while the expression levels of COXⅣ and TOM20 proteins in the Y11 mutation group did not change significantly, indicating that the Y11 site mutation of FUNDC1 has little effect on mitochondria.

[0118] 2. Mitochondrial membrane potential:

[0119] The mitochondrial membrane potential of the successfully transfected empty plasmid (empty plasmid group), FUNDC1 overexpression plasmid (overexpression group), Y11 site mutant plasmid (mutation Y11 group), Y18 site mutant plasmid (mutation Y18 group) and 11-site and 18-site co-mutation plasmid (mutation Y11+Y18 group) were detected by TMRE method and observed under a laser confocal microscope.

[0120] The results are shown in Figure 10. Compared with the empty plasmid, the mitochondrial membrane potential did not change significantly after transfection of the Y11 site mutant plasmid, the Y18 site mutant plasmid, and the Y11 and Y18 site co-mutant plasmid, indicating that the mutant plasmids of the present invention did not damage the mitochondria.

[0121] 3. Cell Viability

[0122] H9c2 cells (untransfected group) and the successfully transfected bacterial solutions of empty plasmid (empty plasmid group), FUNDC1 overexpression plasmid (overexpression group), Y11 site mutant plasmid (mutation Y11 group), Y18 site mutant plasmid (mutation Y18 group), and 11- and 18-site co-mutation plasmid (mutation Y11+Y18 group) were taken out respectively. The required cell number and culture medium volume were calculated. Then, the cell counting steps in the above H9c2 cell culture were followed to obtain the single cell suspension of each group. The single cell suspension of each group was diluted to 5×10 4 Cells / mL, use a pipette to transfer each group of cell suspensions to a 96-well culture plate, 100 μL of cell suspension containing 5000 cells per well, 6 replicates per group, after inoculation of cells, add PBS to the outer ring of the 96-well plate to prevent evaporation of the culture medium, shake the culture plate in an eight-shaped pattern to evenly spread the cells on the bottom of the well. Label the cell type, operator, and date, place in a 37°C incubator with 5% CO2 for 24 hours, perform cell treatment according to the experimental design, add 100 μL of 10% CCK-8 working solution to each well in a clean bench (protected from light), incubate for 1 hour, and measure the absorbance value at a wavelength of 450 nm using a microplate reader;

[0123] Cell viability (%) = (treated well - blank well) / (control well - blank well) × 100%.

[0124] The results are shown in Figure 11. Compared with the untransfected group, there was no significant change in cell viability after transfection of the empty plasmid group, the Y11 site mutant plasmid, the Y18 site mutant plasmid, and the Y11 and Y18 site co-mutant plasmid, indicating that the mutant plasmid of the present invention has no obvious cytotoxicity.

[0125] In summary, the present invention constructs mutant FUNDC1 plasmids (Y11 site mutant plasmid, Y18 site mutant plasmid and 11 site and 18 site co-mutation plasmid) through site-directed mutagenesis technology, wherein the Y18 site mutant plasmid and the Y11 site and Y18 site co-mutation plasmid can significantly increase the expression levels of mitochondrial autophagy protein COXⅣ and TOM20 protein, indicating that when the Y18 site of FUNDC1 is mutated, mitochondrial autophagy is significantly inhibited. The exogenous FUNDC1 mutant gene is transported into the cell by transfection, and the FUNDC1 mutant protein generated by its translation in the cell can bind to the autophagy-related protein LC3, but its affinity for mitochondria is low, so it competitively inhibits the binding of mitochondria to LC3, thereby inhibiting mitochondrial autophagy, and this method of inhibiting mitochondrial autophagy has no obvious cytotoxicity.

[0126] Although the preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0127] Obviously, those skilled in the art may make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if such changes and modifications fall within the scope of the claims and their equivalents, the present invention is intended to include such changes and modifications.

Claims

1. A mutant of the FUNDC1 gene, characterized in that: The nucleotide sequence of the FUNDC1 gene is shown in SEQ ID NO.1, and the mutant is selected from any one of the following: (1) Adenine A at position 53 of the FUNDC1 gene mutated to thymine T. (2) The adenine A at positions 32 and 53 of the FUNDC1 gene mutated to thymine T.

2. FUNDC1 mutant plasmid, characterized in that The FUNDC1 mutant plasmid contains the mutant of the FUNDC1 gene according to claim 1.

3. The FUNDC1 mutant plasmid according to claim 2, characterized in that The FUNDC1 mutant plasmid is obtained by connecting the mutant of the FUNDC1 gene with a vector.

4. The FUNDC1 mutant plasmid according to claim 3, characterized in that The vector is pcDNA3.1-3xFlag-T2A-EGFP vector.

5. The method for constructing the FUNDC1 mutant plasmid according to claim 5, characterized in that: The steps include: Amplify the target gene FUNDC1 as shown in SEQ ID NO.1 by PCR to obtain a fragment of the target gene FUNDC1; The adenine A at position 53 in the target gene FUNDC1 fragment is mutated into thymine T or the adenine A at positions 32 and 53 are mutated into thymine T to obtain a mutant of the FUNDC1 gene; The pcDNA3.1-3xFlag-T2A-EGFP vector was digested with BamHI and XhoI enzymes to obtain a linearized vector fragment; The linearized vector fragment obtained was connected with the mutant of FUNDC1 gene to obtain a recombinant product; The recombinant product was transfected into H9c2 cells to obtain the FUNDC1 mutant plasmid.

6. The method for constructing a FUNDC1 mutant plasmid according to claim 5, characterized in that: The reaction program of the PCR amplification is: 94°C for 2 min; 98°C for 10 s, 60°C for 30 s, 68°C for 45 s, 30 cycles; 72°C for 3 min.

7. The method for constructing a FUNDC1 mutant plasmid according to claim 5, characterized in that: The reaction system for obtaining the recombinant product is: ddH2O 5μL, 5×CE II Buffer 2μL, linearized pcDNA3.1-3xFlag-T2A-EGFP vector fragment 1μL, FUNDC1 gene mutant 1μL, Exnase TM II 1 μL.

8. Use of the FUNDC1 gene mutant according to claim 1 or the FUNDC1 mutant plasmid according to claim 2 in the preparation of a drug for inhibiting mitochondrial autophagy.

9. Use of the mutant of the FUNDC1 gene or the FUNDC1 mutant plasmid according to claim 8 in preparing a drug for inhibiting mitochondrial autophagy, characterized in that: The drug is prepared into various dosage forms by mixing the mutant of the FUNDC1 gene or the FUNDC1 mutant plasmid with any pharmaceutically acceptable excipient.

10. Use of the FUNDC1 gene mutant or the FUNDC1 mutant plasmid according to claim 9 in preparing a drug for inhibiting mitochondrial autophagy, characterized in that: The auxiliary materials include one or more of mannitol, sorbitol, polyethylene glycol, glucose, lactose, galactose, phosphoric acid, lactic acid, tartaric acid, arginine, lysine, glutamic acid, aspartic acid, polyethylene glycol, polyvinyl alcohol, polyvinyl pyrrolidone, and carboxyl / hydroxy cellulose.

Citation Information

Patent Citations

  • Application of FUNDC1 in treating acute respiratory distress syndrome and belongs to technical field of biology

    CN111135289A

  • Application of FUNDC1 in medicine for preventing and treating vascular senescence

    CN114159562A

  • Branched peptides for enzymatic assembly and mitochondria drug delivery

    US20220112240A1