Molecular markers and application of the function of the peanut endocarp color regulatory gene AhLAC

Abstract

The present invention provides a molecular marker and application of the function of the peanut endocarp color regulatory gene AhLAC, wherein the molecular marker is A05.114993389, located at 114,993,389bp of peanut chromosome 5, and the molecular marker site is an InDel insertion and deletion marker. Based on the mutation type of the sequence of the peanut endocarp color regulatory gene AhLAC, the present invention develops the KASP molecular marker of A05.114993389 (InDel site), and the typing results of the marker in the natural population material of peanut are completely linked to the endocarp color, proving the accuracy of the marker. The KASP marker can quickly and accurately obtain the endocarp color information of the peanut material, and can be applied to peanut molecular assisted marker breeding.

Description

Technical Field

[0001] The invention relates to the development and application of a functional molecular marker of a peanut endocarp color regulating gene AhLAC, and belongs to the field of molecular biology. Background Art

[0002] Peanut (Arachis hypogaea L.; 2n=4x=40) is an important oil crop with a total global production of 47.65 million tons, second only to soybean, rapeseed and sunflower. The composition of anthocyanins is a factor that determines the color of peanut seed coat. Anthocyanins, as plant secondary metabolites, are widely present in flowering plants. They are a safe antioxidant and have health benefits such as protecting eyesight and inhibiting protein glycation. With the enhancement of people's health awareness, anthocyanins are favored by more and more people. The study of anthocyanin synthesis pathways and the cultivation of crop varieties rich in anthocyanins have become one of the research hotspots.

[0003] Seed coat color is an important descriptive trait for distinguishing different peanut varieties. The description of peanut seed coat color traits is divided into outer seed coat color and inner seed coat color. At present, the outer seed coat color of peanuts is divided into two types: single color and multi-color. The single color type outer seed coat color includes five types: white, brown, pink, red and purple; while the multi-color type seed coat color includes red and white variegated, purple and white variegated, brown with purple stripes, red with white spots, etc. The inner seed coat color is divided into two types, white and yellow. And yellow is divided into light yellow and dark yellow. The seed coat has a greater impact on the sensory evaluation of raw peanuts, and the dark peanut seed coat has a greater impact on the aroma. The bitterness of peanuts is closely related to the depth of the seed coat color. The darker the seed coat color, the stronger the bitterness.

[0004] In plants, browning reactions usually involve oxidation of phenolic compounds to produce quinone compounds, which are unstable molecules that easily form yellow-brown polymers. These reactions can be catalyzed by polyphenol oxidases such as laccases, catechol oxidases, tyrosinases, and peroxidases. Laccases are widely present in eukaryotes (higher plants, fungi, and insects) and prokaryotes. They usually have low specificity for reducing substrates and can oxidize diphenols and monophenols such as ascorbic acid. In transgenic corn, the expression of laccase genes is associated with browning of corn kernels and restricted germination.

[0005] Competitive allele-specific PCR (KASP) can accurately determine the biallelicity of SNPs and InDels at specific loci in a wide range of genomic DNA samples (even some complex genomic DNA samples). Compared with the TaqMan dual-color labeled probe method, MassARRAY molecular weight array technology, and Affymetrix SNP chip, KASP technology has higher flexibility and lower reagent costs, and can obtain at least twice the amount of data at the same cost. Therefore, using the peanut recombinant inbred line population to locate the QTL of the regulatory gene of the peanut endocarp color and develop molecular markers based on the target gene can be applied to peanut breeding. Summary of the invention

[0006] In view of the deficiencies of the prior art, the object of the present invention is to provide the development and application of a functional molecular marker for the peanut endocarp color regulating gene AhLAC.

[0007] In order to achieve the above object, the technical solution adopted by the present invention is:

[0008] A functional molecular marker of the peanut endocarp color regulatory gene AhLAC, wherein the molecular marker is A05.114993389, located at 114,993,389 bp of peanut chromosome 5, and the molecular marker site is an InDel insertion-deletion marker;

[0009] Among them, the sequence of 200bp before and after the wild-type molecular marker site is:

[0010] CCTGGTGACTTTTTTCCTTGCTCAAGAGAAGGTATGCTGTATGCATGAAGATTTCATTTCAAGCATGCTCAAATGTTCTTTGATTTTAGAATCTCTAACTGCATCAATTCTTTTTGTTTTTTCACAGAAACATTCAAGTTTAATGTAGATTTTGGCAAGACTTATCTGCTGAGGATTGTGAATGCTGCAATGAATGTAGT TCTCTTTTTCTCTGTTTACAAACACAGTCTCACTGTTGTTGGTGCTGATGCTGCCTACACCGAGCCATTAACAAGAGACTTCATATGCATAGCTCCAGGACAATCACTTGATGTTTGTTGCATGCAAATCAAGAACCTGATCACTATTACATGGCTGCAAGAGCATATTCAAGTTCCTCTATTCTTCCTTTTGATAACA;

[0011] The mutant type has a 214 bp sequence inserted. The inserted 214 bp sequence is in square brackets. The sequence of 200 bp before and after the molecular marker site is:

[0012] CCTGGTGACTTTTTTCCTTGCTCAAGAGAAGGTATGCTGTATGCATGAAGATTTCATTTCAAGCATGCTCAAATGTTCTTTGATTTTAGAATCTCTAACTGCATCAATTCTTTTTGTTTTTTCACAGAAACATTCAAGTTTAATGTAGATTTTG GCAAGACTTATCTGCTGAGGATTGTGAATGCTGCAATGAATGTAGT[TCTCTTTTGGCAACTACTCCTATGAAGATGCCAAAAACATCTTTTTATGATGATCTTTTGTTTAAAAAGTGTAACTTATTTGTTTAGCAACACTTTAAATAAAGATA ACACTTTTACTTTAAATAAAATCAAACCCTACAATCTATCATCTAATGGTCAAAATGAAATATCTTCATATGATGACAATCATAAAATCTTCATTGGAGTAGCCACC]TCTCTTTTTCTCTGTTTACAAACACAGTCTCACTGTTGTTGGTGCT GATGCTGCCTACACCGAGCCATTAACAAGAGACTTCATATGCATAGCTCCAGGACAATCACTTGATGTTTGTTGCATGCAAATCAAGAACCTGATCACTATTACATGGCTGCAAGAGCATATTCAAGTTCCTCTATTCTTCCTTTTGATAACA.

[0013] The KASP primer combination used to amplify the functional molecular marker comprises:

[0014] qIIC_A05_F1:5'-GCTCAGAGAAAAAAGAGAACTACATTC-3',

[0015] qIIC_A05_F2:5'-ATTGACATTAGATGATAGATTGTAG-3',

[0016] qIIC_A05_com:5'-CAAGAGAAGGTATGCTGTATGCA-3'.

[0017] The method for identifying the color of the peanut endocarp using the functional molecular marker comprises:

[0018] (1) extracting DNA from a peanut sample to be identified, detecting the genotype data of the peanut sample to be identified using the KASP primer combination described in claim 2, and performing genotyping on the InDel site A05.114993389 of the peanut sample to be identified using the SNPLine genotyping platform;

[0019] (2) If the typing result of the A05.114993389 locus is mutant type (MITE:MITE), the seed coat color of the peanut sample to be identified is white; if the typing result of the A05.114993389 locus is wild type (-:-), the seed coat color of the peanut sample to be identified is yellow.

[0020] The PCR technique is used in the identification of step (1), and the PCR amplification procedure is: pre-denaturation at 94°C for 15 minutes; denaturation at 94°C for 20 seconds, extension at 61°C-55°C for 1 minute, 10 cycles; denaturation at 94°C for 20 seconds, extension at 55°C for 1 minute, 26 cycles; and storage at 10°C.

[0021] The application of the functional molecular marker in the identification of peanut endocarp color.

[0022] The application of the functional molecular marker in peanut molecular breeding.

[0023] Beneficial effects of the present invention:

[0024] The invention uses a recombinant inbred line population with Yuanza 9102 and wt09-0023 as parents to construct a high-density linkage map, and locates a QTL (qIIC_A05) regulating the color of the peanut endocarp. The physical map position corresponding to qIIC_A05 is Chr05:114741295-115061124, the interval size is 319.8 Kb, the LOD value is 186.5-444.4, and the genetic contribution rate is 75.8%-94.6%. The QTL positioning is reported for the first time, filling the blank of the research on the peanut endocarp.

[0025] The present invention obtains the target gene AhLAC that regulates the color of the endocarp based on the qIIC_A05 interval, clones the gene to transform the homologous gene mutant of Arabidopsis, and the seed coat color of the positive plant is darker than the yellow seed coat color of the mutant, proving that the AhLAC gene has laccase activity. The gene that regulates the color of the endocarp of peanut is cloned for the first time, filling the gap in the research of endocarp regulatory genes.

[0026] The present invention develops a KASP molecular marker of A05.114993389 (InDel site) based on the mutation type of the sequence of the peanut endocarp color regulatory gene AhLAC. The typing results of the marker in the natural population material of peanut are completely linked to the endocarp color, proving the accuracy of the marker. The KASP marker can quickly and accurately obtain the endocarp color information of the peanut material, and can be applied to peanut molecular assisted marker breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 Example 1 Frequency distribution diagram of endocarp color of progeny materials of the "Yuanza 9102×wt09-0023" RIL population.

[0028] Figure 2 Sequence alignment of the wild type (AhLAC-WT) and mutant (AhLAC-Mu) AhLAC gene in Example 2.

[0029] Figure 3 Comparison of seed coat color of the 35S::AhLAC gene overexpressed in the Arabidopsis mutant attt10 in Example 2.

[0030] Among them, the seed coat color of the 35S::AhLAC positive strain is dark yellow, the seed coat color of the Arabidopsis mutant attt10 is light yellow, and the seed coat color of the wild-type Arabidopsis is yellow-brown.

[0031] Figure 4 KASP validation of the A05.114993389 InDel site in Example 3 in the far-differentiated 9102 and wt09-0023 RIL populations.

[0032] Among them, the left picture is the KASP primer genotyping result, the color close to the X-axis is red, and the color close to the Y-axis is blue. The points with the genotype of MITE:MITE are red, and the points with the genotype of -:- are blue.

[0033] Figure 5 KASP verification of the A05.114993389 InDel site in Example 3 in 334 natural population materials.

[0034] Among them, the left figure is the KASP primer genotyping result, the points close to the X-axis are red, the points close to the Y-axis are blue, and the points in the middle of the quadrant are green; the points with genotype MITE:MITE are red, the points with genotype -:- are blue, and the points with genotype MITE:- are green. DETAILED DESCRIPTION

[0035] The specific implementation methods of the present invention are further described in detail below in conjunction with the examples. Unless otherwise specified, the instruments and equipment involved in the examples are all conventional instruments and equipment; the reagents involved are all commercially available conventional reagents; and the test methods involved are all conventional methods.

[0036] Example 1 Obtaining the major QTL for endocarp color

[0037] (1) The recombinant inbred line (RIL) population of Yuanza 9102 and wt09-0023 was sequenced using simplified genome sequencing technology, with the sequencing depth of the two parents greater than 20× and the sequencing depth of 521 offspring families at 5×. The genotyping data of the parents and offspring were obtained with reference to the cultivated peanut genome information (Arachis hypogaea.cv.Tifrunner V1.0). A total of more than 90,000 polymorphic SNPs with homozygous genotypes were obtained for the two parents. SNP markers with a missing rate of more than 10% in all offspring were filtered out, and SNP markers with similar genetic linkage positions were filtered out using QTL IciMapping v4.1 software. Finally, the remaining markers were mapped using JoinMap5.0 software to construct a high-quality, high-density genetic map containing 20 linkage groups. The number of markers in the map was 5120, and the average genetic distance was 0.62 cM (as shown in Table 1).

[0038] Table 1 Linkage group information of high-density linkage map of RIL population

[0039]

[0040] (2) The inventor investigated the endocarp color of the offspring of the RIL population of Yuanza 9102 and wt09-0023 in 2017, 2019 and 2020. The RIL population (521 families and two parents) was planted at the experimental base of Liaoning Sand Management and Utilization Institute, Fuxin City, Liaoning Province in 2017, with 2 replications. In 2019 and 2020, it was planted at the Henan Modern Agriculture Research and Development Base of Henan Academy of Agricultural Sciences, Xinxiang City, Henan Province, with 2 replications. In 2021, a natural population consisting of 334 peanut germplasms was planted at the Henan Modern Agriculture Research and Development Base, with 2 replications. When investigating the endocarp color of peanuts, 20 kernels were selected from each family or material, and the seed coat was required to be free of disease infection and the grains were plump. Cut the seed coat to investigate and record the endocarp color, with yellow marked as 2 and white marked as 1 (such as Figure 1 shown).

[0041] (3) Using IciMapping software, QTL positioning was performed on the above genetic map and phenotypic data, and it was found that qIIC_A05 was located in all three environments. qIIC_A05 is located on chromosome 5, and the corresponding physical map position is Chr05:114741295-115061124, the interval size is 319.8Kb, the LOD value is 186.5-444.4, and the genetic contribution rate (PVE) is 75.8%-94.6%. (As shown in Table 2).

[0042] Table 2 QTL mapping results for endocarp color in RIL populations of Yuanza 9102 and wt09-0023

[0043]

[0044] (4) Genes and functions annotated within the QTL interval

[0045] Using the peanut cultivar genome information (Arachis hypogaea.cv.Tifrunner V1.0) as a reference, the annotated genes in the qIIC_A05 interval (chromosome 5, 114741295bp to 115061124bp) were obtained. According to the genes related to seed coat color regulation published in Arabidopsis, 5 genes were found in the 32 genes in this interval that may be related to the regulation of endocarp color, including 1 laccase gene (arahy.0C6ZNN) and 4 oxidoreductase family proteins (arahy.7FUC5Y, arahy.I6RXR7, arahy.QAUQ3D, and arahy.85VNG6). The endocarp colors of the peanut cultivars Tifrunner and Shitouqi, whose genomes have been published, are different: Tifrunner is yellow, while Shitouqi is white. The genome sequences of the above five genes were intercepted from the Tifrunner and Shitouqi genomes for comparison, and it was found that the laccase gene in the Tifrunner genome had an InDel marker compared with the laccase gene in the Shitouqi genome, that is, 214bp were missing at 114993389bp on chromosome 5 of the Tifrunner genome compared with the Shitouqi genome. No differences were found in the other four oxidoreductase family proteins, and the laccase gene was determined to be the target gene for regulating the inner seed coat color, and further verification was carried out. (As shown in Table 3).

[0046] Table 3

[0047]

[0048] Example 2 Cloning and Functional Verification of Target Genes for Regulating Endotephala Color

[0049] The total RNA of the seed coat of yellow and white inner seed coat materials was extracted using a plant RNA extraction kit and transcribed into first-strand cDNA. Primers were designed to clone the wild-type (AhLAC-WT) and mutant (AhLAC-Mu) sequences of the AhLAC gene (see Figure 2 ).

[0050] The upstream sequence of the primer used was 5'-TGTTAGACAGCCAGAAATTTC-3' (SEQ ID NO. 3),

[0051] The downstream sequence is 5'-CCCTATTTTTGCATAAAAGAAAGTA-3' (SEQ ID NO. 4).

[0052] The mutation occurred at 711bp of the AhLAC gene CDs, inserting a 214bp MITE (the sameminiature inverted-repeat transposable element) sequence, leading to premature termination of protein translation.

[0053] The wild-type sequence was overexpressed in Arabidopsis mutants and 35S::AhLAC-positive transgenic plants were found (see Figure 3 The seed coat color of 35S::AhLAC) mutants is different from that of Figure 3 The yellow seed coat of the mutant atlac(attt10) is dark yellow, the seed coat of the 35S::AhLAC positive transgenic plant is dark yellow, and the seed coat of the wild-type Arabidopsis [see Figure 3 The seed coat color of WT (Col-0) was yellow-brown, which proved that the AhLAC gene had laccase activity. The seed coat color of 35S::AhLAC plants did not return to the wild-type seed coat color, which may be related to the promoter of the overexpression vector.

[0054] The promoter of the overexpression vector used in this study is the 35S promoter of cauliflower mosaic virus (CaMV). As a constitutive promoter, the CaMV35S promoter can drive gene expression in all tissues, is persistent, and does not show spatiotemporal specificity. Therefore, the expression level of 35S::AhLAC in the seed coat may be lower than that under the regulation of the AtLAC (AtTT10) promoter itself, resulting in the seed coat color of 35S::AhLAC-positive plants not returning to the wild-type level.

[0055] Example 3 Validation of functional molecular markers of endocarp color in natural populations

[0056] (1) A set of KASP primers was developed based on the wild-type and mutant sequences of the AhLAC gene.

[0057] The DNA of the peanut samples of the RIL population to be identified was extracted, and the genotype data of the peanut samples of the RIL population to be identified was detected using KASP primers.

[0058] The primer sequences are:

[0059] qIIC_A05_F1:5'-GCTCAGAGAAAAAAGAGAACTACATTC-3' (SEQ ID NO.5),

[0060] qIIC_A05_F2:5'-ATTGACATTAGATGATAGATTGTAG-3' (SEQ ID NO.6),

[0061] qIIC_A05_com:5'-CAAGAGAAGGTATGCTGTATGCA-3' (SEQ ID NO. 7).

[0062] KASP primer mixture system: total volume 100 μL, of which 12 μL is qIIC_A05_F1 primer (its concentration is 100 μM), 12 μL is qIIC_A05_F2 primer (its concentration is 100 μM), 30 μL is qIIC_A05_com primer (its concentration is 100 μM), and 46 μL is double distilled water.

[0063] The LGC SNPline genotyping platform and its supporting reagents and consumables used in the present invention were purchased from LGC, UK.

[0064] The PCR reaction system is 1 μL: 1 μL template DNA (with a concentration of 20-50 ng / μL), after drying, add 1 μL 1×KASP Master Mix and KASP primer mixture, the volume of KASP primer in the mixture is about 1.4%. This step is performed by Meridian 2 The microdispenser is complete.

[0065] PCR amplification was completed in a water bath thermal cycler, and the PCR amplification program was as follows: 94°C pre-denaturation for 15 min; 94°C denaturation for 20 s, 61°C-55°C extension for 1 min, 10 cycles, with the temperature decreasing by 0.6°C each cycle; 94°C denaturation for 20 s, 55°C extension for 1 min, 26 cycles; and storage at 10°C. The fluorescence data of the KASP reaction product was read using the microplate reader PHERAstar, and the fluorescence results were automatically converted into graphics.

[0066] The InDel locus A05.114993389 of the peanut samples from the RIL population to be identified was genotyped using the SNPLine genotyping platform.

[0067] The authenticity of the A05.114993389InDel locus in the far-differentiated 9102 and wt09-0023 RIL populations was verified using the SNPLine genotyping platform (LGC) (see Figure 4 Left). If the typing result of the A05.114993389 locus is mutant (MITE:MITE), the endocarp color of the progeny material of the RIL population is white; if the typing result of the A05.114993389 locus is wild type (-:-), the endocarp color of the progeny material of the RIL population is yellow. The genotyping results of the 490 families in the RIL population are completely consistent with their endocarp color (see Figure 4 Right); The genotyping results of 31 families were heterozygous, and the inner seed coat color of their offspring showed yellow and white separation.

[0068] (2) The functional molecular markers of the AhLAC gene were used to detect natural population materials, and the genotyping results were completely linked to the inner seed coat color.

[0069] This research group selected 334 cultivated germplasms from different sources to form natural populations (including farm varieties, foreign introductions and domestically bred varieties) to investigate the endocarp color and detect the functional molecular markers of the AhLAC gene. Among the 334 natural population materials, there were 147 continuous flowering subspecies materials and 187 alternate flowering subspecies materials. Among the continuous flowering subspecies materials, there were 78 var. vulgaris, 26 var. fastigiata, and 43 irregular fas-type materials; among the alternate flowering subspecies materials, there were 79 var. hypogaea, 12 var. hirsuta, and 96 irregular hyp-type materials.

[0070] DNA of peanut samples from the natural population to be identified was extracted, the genotype data of the peanut samples from the natural population to be identified was detected using KASP primers, and the InDel site A05.114993389 of the peanut samples from the natural population to be identified was genotyped using the SNPLine genotyping platform.

[0071] The genotype data of 334 natural population materials were obtained by using KASP primers at the A05.114993389InDel site (see Figure 5Left), and linkage analysis was performed with its endocarp phenotype. The results showed that if the typing result of the A05.114993389 locus was mutant (MITE:MITE), the endocarp color of the natural population material was white; if the typing result of the A05.114993389 locus was wild type (-:-), the endocarp color of the natural population material was yellow. The genotyping results of the natural population material were basically consistent with its endocarp color (see Figure 5 right).

[0072] The genotyping results of the A05.114993389InDel locus of two natural population materials did not match the color of the inner seed coat. The genotype was wild type (-:-), but the inner seed coat was white. The outer seed coat of these two materials was also white. The possible reason was that the upstream gene mutation of the anthocyanin synthesis pathway resulted in no accumulation of proanthocyanidins in the inner and outer seed coats, so the laccase gene function was normal, but due to the lack of substrate, the inner seed coat color was still white.

[0073] Based on the verification results of the above-mentioned Yuanza 9102 and wt09-0023RIL populations and natural population materials, the InDel marker A05.114993389 is completely linked to the endocarp color. When its genotype is wild type (-:-), the endocarp color of the peanut material is yellow; when its genotype is mutant (MITE:MITE), the endocarp color of the peanut material is white, which proves the accuracy of the marker.

[0074] Among them, the InDel marker A05.114993389 is located at 114993389bp on chromosome 5 of peanut.

[0075] The sequence of 200 bp before and after the wild-type molecular marker A05.114993389 site is:

[0076] CCTGGTGACTTTTTTCCTTGCTCAAGAGAAGGTATGCTGTATGCATGAAGATTTCATTTCAAGCATGCTCAAATGTTCTTTGATTTTAGAATCTCTAACTGCATCAATTCTTTTTGTTTTTTCACAGAAACATTCAAGTTTAATGTAGATTTTGGCAAGACTTATCTGCTGAGGATTGTGAATGCTGCAATGAATGTAGTTC TCTTTTTCTCTGTTTACAAACACAGTCTCACTGTTGTTGGTGCTGATGCTGCCTACACCGAGCCATTAACAAGAGACTTCATATGCATAGCTCCAGGACAATCACTTGATGTTTGTTGCATGCAAATCAAGAACCTGATCACTATTACATGGCTGCAAGAGCATATTCAAGTTCCTCTATTCTTCCTTTTGATAACA(SEQ ID NO.1);

[0077] The mutant type is an inserted 214bp sequence. The sequence of 200bp before and after the molecular marker A05.114993389 site is (the inserted 214bp sequence is in square brackets):

[0078] CCTGGTGACTTTTTTCCTTGCTCAAGAGAAGGTATGCTGTATGCATGAAGATTTCATTTCAAGCATGCTCAAATGTTCTTTGATTTTAGAATCTCTAACTGCATCAATTCTTTTTGTTTTTTCACAGAAACATTCAAGTTTAATGTAGATTTTGG CAAGACTTATCTGCTGAGGATTGTGAATGCTGCAATGAATGTAGT[TCTCTTTTGGCAACTACTCCTATGAAGATGCCAAAAACATCTTTTTATGATGATTCTTTGTTTAAAAAGTGTAACTTATTTGTTTAGCAACACTTTAAATAAAGATAAC ACTTTTACTTTAAATAAAATCAAACCCTACAATCTATCATCTAATGGTCAAAATGAAATATCTTCATATGATGACAATCATAAAATCTTCATTGGAGTAGCCACC]TCTCTTTTTCTCTGTTTACAAACACAGTCTCACTGTTGTTGGTGCTGAT GCTGCCTACACCGAGCCATTAACAAGAGACTTCATATGCATAGCTCCAGGACAATCACTTGATGTTTGTTGCATGCAAATCAAGAACCTGATCACTATTACATGGCTGCAAGAGCATATTCAAGTTCCTCTATTCTTCCTTTTGATAACA(SEQ ID NO.2). Sequence Listing <110> Henan Academy of Agricultural Sciences <120> Molecular markers and application of the function of the peanut endocarp color regulatory gene AhLAC <130> Molecular Biology <160> 7 <170> SIPOSequenceListing 1.0 <210> 1 <211> 400 <212> DNA <213> Artificial Sequence() <400> 1 cctggtgact tttttccttg ctcaagagaa ggtatgctgt atgcatgaag atttcatttc 60 aagcatgctc aaatgttctt tgattttaga atctctaact gcatcaattc tttttgtttt 120 ttcacagaaa cattcaagtt taatgtagat tttggcaaga cttatctgct gaggattgtg 180 aatgctgcaa tgaatgtagt tctctttttc tctgtttaca aacacagtct cactgttgtt 240 ggtgctgatg ctgcctacac cgagccatta acaagagact tcatatgcat agctccagga 300 caatcacttg atgttttgtt gcatgcaaat caagaacctg atcactatta catggctgca 360 agagcatatt caagttcctc tattcttcct tttgataaca 400 <210> 2 <211> 614 <212> DNA <213> Artificial Sequence () <400> 2 cctggtgact tttttccttg ctcaagagaa ggtatgctgt atgcatgaag atttcatttc 60 aagcatgctc aaatgttctt tgattttaga atctctaact gcatcaattc tttttgtttt 120 ttcacagaaa cattcaagtt taatgtagat tttggcaaga cttatctgct gaggattgtg 180 aatgctgcaa tgaatgtagt tctctttttg gcaactactc ctatgaagat gccaaaaaca 240 tctttttatg atgatctttg tttaaaaagt gtaacttatt tgtttagcaa cactttaaat 300 aaagataaca cttttacttt aaataaaatc aaaccctaca atctatcatc taatggtcaa 360 aatgaaatat cttcatatga tgacaatcat aaaatcttca ttggagtagc cacctctctt 420 tttctctgtt tacaaacaca gtctcactgt tgttggtgct gatgctgcct acaccgagcc 480 attaacaaga gacttcatat gcatagctcc aggacaatca cttgatgttt tgttgcatgc 540 aaatcaagaa cctgatcact attacatggc tgcaagagca tattcaagtt cctctattct 600 tccttttgat aaca 614 <210> 3 <211> 21 <212> DNA <213> Artificial sequence () <400> 3 tgttagacag ccagaaattt c 21 <210> 4 <211> 25 <212> DNA <213> Artificial sequence () <400> 4 ccctattttt gcataaaaga aagta 25 <210> 5 <211> 26 <212> DNA <213> Artificial sequence () <400> 5 gctcagagaa aaagagaact acattc 26 <210> 6 <211> 26 <212> DNA <213> Artificial sequence () <400> 6 attgaccatt agatgataga ttgtag 26 <210> 7 <211> twenty three <212> DNA <213> Artificial Sequence() <400> 7 caagagaagg tatgctgtat gca 23

Claims

1. A functional molecular marker of the peanut endocarp color regulatory gene AhLAC, characterized in that: The molecular marker is A05.114993389, located at 114,993,389 bp of peanut chromosome 5, and the molecular marker site is an InDel insertion and deletion marker; Among them, the sequence of 200bp before and after the wild-type molecular marker site is: CCTGGTGACTTTTTTCCTTGCTCAAGAGAAGGTATGCTGTATGCATGAAGATTTCATTTCAAGCATGCTCAAATGTTCTTTGATTTTAGAATCTCTAACTGCATCAATTCTTTTTGTTTTTTCACAGAAACATTCAAGTTTAATGTAGATTTTGGCAAGACTTATCTGCTGAGGATTGTGAATGCTGCAATGAATGTAGT TCTCTTTTTCTCTGTTTACAAACACAGTCTCACTGTTGTTGGTGCTGATGCTGCCTACACCGAGCCATTAACAAGAGACTTCATATGCATAGCTCCAGGACAATCACTTGATGTTTGTTGCATGCAAATCAAGAACCTGATCACTATTACATGGCTGCAAGAGCATATTCAAGTTCCTCTATTCTTCCTTTTGATAACA; The mutant type has a 214 bp sequence inserted. The inserted 214 bp sequence is in square brackets. The sequence of 200 bp before and after the molecular marker site is: CCTGGTGACTTTTTTCCTTGCTCAAGAGAAGGTATGCTGTATGCATGAAGATTTCATTTCAAGCATGCTCAAATGTTCTTTGATTTTAGAATCTCTAACTGCATCAATTCTTTTTGTTTTTTCACAGAAACATTCAAGTTTAATGTAGATTTTG GCAAGACTTATCTGCTGAGGATTGTGAATGCTGCAATGAATGTAGT[TCTCTTTTGGCAACTACTCCTATGAAGATGCCAAAAACATCTTTTTATGATGATCTTTTGTTTAAAAAGTGTAACTTATTTGTTTAGCAACACTTTAAATAAAGATA ACACTTTTACTTTAAATAAAATCAAACCCTACAATCTATCATCTAATGGTCAAAATGAAATATCTTCATATGATGACAATCATAAAATCTTCATTGGAGTAGCCACC]TCTCTTTTTCTCTGTTTACAAACACAGTCTCACTGTTGTTGGTGCT GATGCTGCCTACACCGAGCCATTAACAAGAGACTTCATATGCATAGCTCCAGGACAATCACTTGATGTTTGTTGCATGCAAATCAAGAACCTGATCACTATTACATGGCTGCAAGAGCATATTCAAGTTCCTCTATTCTTCCTTTTGATAACA.

2. The KASP primer combination for amplifying the functional molecular marker according to claim 1, characterized in that: The KASP primer combination includes: qIIC_A05_F1:5'-GCTCAGAGAAAAAAGAGAACTACATTC-3', qIIC_A05_F2:5'-ATTGACATTAGATGATAGATTGTAG-3', qIIC_A05_com:5'-CAAGAGAAGGTATGCTGTATGCA-3'.

3. The method for identifying the color of peanut endocarp using the functional molecular marker according to claim 1, characterized in that: include: (1) extracting DNA from a peanut sample to be identified, detecting the genotype data of the peanut sample to be identified using the KASP primer combination described in claim 2, and performing genotyping on the InDel site A05.114993389 of the peanut sample to be identified using the SNPLine genotyping platform; (2) If the typing result of the A05.114993389 locus is mutant type (MITE:MITE), the seed coat color of the peanut sample to be identified is white; if the typing result of the A05.114993389 locus is wild type (-:-), the seed coat color of the peanut sample to be identified is yellow.

4. The method according to claim 3, characterized in that The PCR technique is used in the identification of step (1), and the PCR amplification procedure is: pre-denaturation at 94°C for 15 minutes; denaturation at 94°C for 20 seconds, extension at 61°C-55°C for 1 minute, 10 cycles; denaturation at 94°C for 20 seconds, extension at 55°C for 1 minute, 26 cycles; and storage at 10°C.

5. Use of the functional molecular marker as claimed in claim 1 in identifying the color of peanut endocarp.

6. Use of the functional molecular marker as claimed in claim 1 in peanut molecular breeding.

Images