Protein mutants that can increase the nucleoside yield of bacterial strains and their applications

By introducing specific point mutations into adenine deaminase and pyrimidine nucleotide transporter, the problem of low nucleoside yield in Bacillus strains was solved, resulting in a significant increase in nucleoside yield and a reduction in cost.

CN115678876BActive Publication Date: 2026-03-31MEIHUA (SHANGHAI) BIOLOGICAL TECH CO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202110860057.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-07-28
Publication Date
2026-03-31
Estimated Expiration
2041-07-28

AI Technical Summary

Technical Problem

In existing technologies, Bacillus strains have limited nucleoside production, especially due to low activity of adenine deaminase and pyrimidine nucleotide transporter proteins, which affects the efficiency of nucleoside synthesis.

Method used

By introducing specific point mutations in adenine deaminase and pyrimidine nucleotide transporters, including the P135S/F158fs mutation in the adeC gene and the T175P/Q231* mutation in the nupC gene, the flux and yield of the nucleoside synthesis pathway were increased.

Benefits of technology

It significantly improved the nucleoside yield of the strains, especially the nucleoside accumulation in Bacillus subtilis and Bacillus amyloliquefaciens, reduced production costs, and maintained the growth performance of the cells.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0003185501670000011
    Figure HDA0003185501670000011
  • Figure HDA0003185501670000012
    Figure HDA0003185501670000012
  • Figure HDA0003185501670000013
    Figure HDA0003185501670000013
Patent Text Reader

Abstract

The present application relates to the field of bioengineering, and particularly relates to a protein mutant capable of improving the nucleoside yield of a strain and application thereof. The present application performs point mutation on adenine deaminase and pyrimidine nucleotide transport protein, which can effectively accumulate the inosine, adenosine and other nucleoside related products produced by the strain, does not affect the growth of the bacterial body, has wider practicality, and is conducive to reducing the cost of industrial production of nucleosides.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of bioengineering, specifically to protein mutants that can increase the nucleoside yield of bacterial strains and their applications. Background Technology

[0002] Nucleosides are components of nucleic acids and nucleotides. They belong to a class of glycosides and are formed by the condensation of D-ribose or D-2-deoxyribose with pyrimidine or purine bases. Nucleosides formed from D-ribose are called ribonucleosides and participate in the composition of RNA, while nucleosides formed from D-α-deoxyribose are called deoxyribonucleosides and participate in the composition of DNA.

[0003] Adenosine, or adenosine nucleoside, chemically named 6-amino-9-β-D-furanoribosyl-9-hydropurine, is a product of adenosine nucleotide dephosphorylation and is an important nucleotide derivative. Adenosine is an endogenous nucleoside found throughout human cells. It can directly enter the myocardium, where it is phosphorylated to produce adenosine monophosphate, participating in myocardial energy metabolism. It also participates in dilating coronary arteries and increasing blood flow, and is widely used in the pharmaceutical and other industries.

[0004] The chemical name of guanosine is 9-β-D-furanoriboguanine. It can be used as an intermediate in the production of food or pharmaceutical raw materials such as 5'-guanylate disodium, guanine, ribavirin, acyclovir, and famciclovir.

[0005] Inosine, chemically known as 9-β-D-ribosinopurine, is a cell metabolism modifier that participates in nucleic acid metabolism in the body. It is converted into inosinic acid and adenosine triphosphate in the body, participating in cellular energy metabolism and protein synthesis. It increases the activity of various enzymes, especially coenzyme A and pyruvate oxidase, thereby enabling cells to continue metabolism under hypoxic conditions, activating liver function, promoting the recovery of damaged liver, stimulating the production of antibodies in the body, and promoting the absorption of iron in the intestine.

[0006] In the field of genetically engineered bacteria, using bacteria as host bacteria has significant advantages, such as short fermentation cycles, simple raw material requirements, and mature genetic engineering technology. Currently, microbial fermentation is the main method for producing nucleosides, and the production bacteria used are mainly Bacillus species, including Bacillus amyloliquefaciens, Bacillus subtilis, and Bacillus pumilus. Bacillus species, as starting strains for nucleosides, have the advantage of a relatively active pentose phosphate pathway and low purine nucleoside phosphorylase activity. Many strains in the Bacillus genus, including Bacillus subtilis, exhibit reliable safety. Traditional strain selection has revealed that mutant strains of Bacillus can oversynthesize a series of purine pathway metabolic intermediates or derivative metabolites, such as folic acid, adenosine, inosine, guanosine, and riboflavin, making them important starting strains for breeding high-yield nucleoside metabolites. Summary of the Invention

[0007] This invention obtained a series of high-yielding *Bacillus amyloliquefaciens* strains through laboratory mutagenesis. Comparative genomic analysis, screening, and verification revealed that mutations at positions 135 (proline to serine) and 158 (phenylalanine) of the adenine deaminase (encoded by the *adeC* gene) and 175 (threonine to proline) and 231 (glutamine nonsense) of the pyrimidine nucleotide transporter (encoded by the *nupC* gene) all increased nucleoside production. Furthermore, simultaneous mutations at two sites in one protein, or at all four sites in two proteins, gradually and further increased nucleoside production. Since *Bacillus subtilis* and *Bacillus amyloliquefaciens* are both nucleoside-producing bacteria with high protein sequence homology, introducing the aforementioned mutations from *Bacillus amyloliquefaciens* into *Bacillus subtilis* yielded the same effect.

[0008] Based on the above findings, the present invention provides a protein mutant that can increase the nucleoside yield of bacterial strains and its applications.

[0009] Specifically, the present invention first provides a protein mutant that can increase the nucleoside yield of a bacterial strain, comprising:

[0010] 1) An adenine deaminase mutant that has undergone at least one of the following mutations based on the wild-type adenine deaminase (encoded by the adeC gene): a) a proline-serine mutation at position 135; b) a frameshift mutation of phenylalanine at position 158; and / or,

[0011] 2) A pyrimidine nucleotide transporter mutant that has undergone at least one of the following mutations based on the wild-type pyrimidine nucleotide transporter (encoded by the nupC gene): c) threonine at position 175 is replaced by proline; d) a nonsense mutation of glutamine at position 231.

[0012] Among them, adeC is an adenine deaminase gene, which is a key gene for the degradation of nucleoside pathway. The nucleoside synthesis pathway requires adenine for bacterial growth and metabolism, so weakening or inactivating the adeC gene is beneficial to purine nucleoside synthesis.

[0013] Previous literature has reported that this gene can be knocked out for riboflavin production, and knocking out this gene may affect bacterial growth, but the gene has not been modified through point mutation. This invention, however, utilizes adeC... P135S and adeC F158fs The mutation achieves the goal of weakening the adeC gene.

[0014] nupC encodes a pyrimidine nucleotide transporter, a key regulatory enzyme in the pyrimidine synthesis pathway, which competes with purine synthesis. The activity of this enzyme directly affects the flux entering the purine synthesis pathway. Therefore, reducing its activity is significant for increasing the flux of the purine pathway and the accumulation of nucleoside metabolites or metabolites derived from the purine pathway. This invention utilizes nupC... T175P and nupC Q231* Mutation inactivates pyrimidine nucleotide transporters, thereby increasing nucleoside production.

[0015] Preferably, the wild-type adenine deaminase is derived from Bacillus amyloliquefaciens or Bacillus subtilis; preferably, the sequence of the adenine deaminase mutant is as shown in SEQ ID NO.2 (containing P135S mutation), SEQ ID NO.4 (containing F158fs mutation), SEQ ID NO.10 (containing P135S mutation) or SEQ ID NO.12 (containing F158fs mutation).

[0016] Preferably, the wild-type pyrimidine nucleotide transporter is derived from Bacillus amyloliquefaciens or Bacillus subtilis; preferably, the sequence of the pyrimidine nucleotide transporter mutant is shown in SEQ ID NO.6 (containing T175P mutation), SEQ ID NO.8 (containing Q231* mutation), SEQ ID NO.14 (containing T175P mutation), or SEQ ID NO.16 (containing Q231* mutation).

[0017] Those skilled in the art should understand that adding a tagged protein to the N-terminus or C-terminus of the above-mentioned protein mutant sequence or fusing it with other proteins to form a fusion protein, without changing the activity of the above-mentioned mutant protein itself, the tagged protein or fusion protein is also within the scope of protection of this invention.

[0018] Secondly, the present invention also provides nucleic acids encoding the protein mutants described above.

[0019] Based on the protein mutants provided above, those skilled in the art can obtain the sequences of the nucleic acids they encode. Due to codon degeneracy, there is more than one nucleic acid sequence encoding the above amino acid sequences; all nucleic acids capable of encoding the above protein mutants are within the scope of protection of this invention.

[0020] Preferably, the nucleic acid encoding wild-type adenine deaminase is derived from Bacillus amyloliquefaciens or Bacillus subtilis.

[0021] As a preferred embodiment, the nucleotide sequence of the gene encoding the adenine deaminase mutant is as shown in SEQ ID NO.1 (containing the P135S mutation), SEQ ID NO.3 (containing the F158fs mutation), SEQ ID NO.9 (containing the P135S mutation), or SEQ ID NO.11 (containing the F158fs mutation).

[0022] Preferably, the nucleic acid encoding the wild-type pyrimidine nucleotide transporter is derived from Bacillus amyloliquefaciens or Bacillus subtilis.

[0023] As a preferred embodiment, the nucleotide sequence of the gene encoding the pyrimidine nucleotide transporter mutant is as shown in SEQ ID NO.5 (containing T175P mutation), SEQ ID NO.7 (containing Q231* mutation), SEQ ID NO.13 (containing T175P mutation), or SEQ ID NO.15 (containing Q231* mutation).

[0024] Furthermore, the present invention also provides biological materials containing the nucleic acid, wherein the biological material is an expression cassette, a vector, or a host cell.

[0025] The expression cassette is a recombinant nucleic acid molecule obtained by linking elements upstream or downstream of the nucleic acid to drive its transcription and expression.

[0026] The vector may be an expression vector or a cloning vector, including but not limited to plasmid vectors, phage vectors, transposons, etc.

[0027] The host cell includes, but is not limited to, bacterial cells.

[0028] Thirdly, the present invention provides the use of the protein mutant, the nucleic acid, or the biological material in any of the following aspects:

[0029] (1) Construct strains that produce high levels of nucleosides or their derivatives;

[0030] (2) Screening strains that produce high levels of nucleosides or their derivatives.

[0031] Preferably, the strain is selected from one of Bacillus subtilis, Bacillus pumilus, Bacillus amyloliquefaciens, and Corynebacterium ammoniagenicum.

[0032] Preferably, the nucleoside is one or more of adenosine, inosine, guanosine, and flavin; the derivative is one or more of inosinic acid, guanosine, flavin, hypoxanthocyanin, adenine, guanine, xanthocyanin, hypoxanthocyanin, and riboflavin.

[0033] Furthermore, the present invention also provides a nucleoside-producing strain that expresses the protein mutant described herein; and / or that contains the nucleic acid described herein.

[0034] Preferably, the nucleoside-producing strain simultaneously expresses the adenine deaminase mutant and the pyrimidine nucleotide transporter mutant; and / or, it simultaneously contains nucleic acids encoding the adenine deaminase mutant and the pyrimidine nucleotide transporter mutant.

[0035] As a preferred embodiment, the nucleoside-producing strain simultaneously expresses an adenine deaminase mutant with a proline-serine mutation at position 135 (preferred sequence as shown in SEQ ID NO. 2 or SEQ ID NO. 10) and a pyrimidine nucleotide transporter mutant with a glutamine nonsense mutation at position 231 (preferred sequence as shown in SEQ ID NO. 8 or SEQ ID NO. 16); and / or, it simultaneously contains nucleic acids encoding the aforementioned adenine deaminase mutant and pyrimidine nucleotide transporter mutant, i.e., simultaneously contains nucleic acids with the following sequences: a) at least one selected from SEQ ID NO. 1 and SEQ ID NO. 9; and b) at least one selected from SEQ ID NO. 7 and SEQ ID NO. 15.

[0036] Preferably, the nucleoside-producing strain is selected from one of Bacillus subtilis, Bacillus pumilus, Bacillus amyloliquefaciens, and Corynebacterium ammonia-producing.

[0037] More preferably, the nucleoside-producing strain is Bacillus subtilis or Bacillus amyloliquefaciens.

[0038] In some embodiments, the method for constructing the Bacillus subtilis or Bacillus amyloliquefaciens includes:

[0039] Step A: Prepare adeC separately P135S adeC F158fs nupC T175P nupC Q231* Point-mutated gene fragments were ligated with vectors to obtain single-site mutant plasmids.

[0040] Step B: Transform B. amyloliquefaciens 13952 (Δupp) or B. subtilis168 (Δupp) strains individually or sequentially with a single point mutation plasmid to obtain strains expressing the corresponding protein mutant (or containing the mutant encoding the mutant).

[0041] In some implementations, the carrier in step A is pKSU.

[0042] In some embodiments, the two single-site mutation plasmids are pKSU-adeC* and pKSU-nupC*, respectively. The single-site mutation plasmids are transformed into B. amyloliquefaciens 13952 (Δupp) to obtain a single-site mutated Bacillus amyloliquefaciens strain; the single-site mutation plasmids are transformed into B. subtilis168 (Δupp) to obtain a single-site mutated Bacillus subtilis strain.

[0043] In some implementations, step B specifically involves: transforming B. amyloliquefaciens 13952 (Δupp) and B. subtilis168 (Δupp) strains with two single-point mutation plasmids in sequence to obtain Bacillus amyloliquefaciens strains and Bacillus subtilis strains with point mutations at two, three, or four sites.

[0044] Experiments revealed that, compared to the original strain B. amyloliquefaciens13952Δupp, the engineered strain exhibited increased nucleoside accumulation. The introduction of adeC... F158fs Mutant strains and the introduction of nupC Q231* The accumulation of mutant strains is relatively small, so the introduction of adeC F158fs &nupC Q231* The mutated strains accumulated more, and the strains with four point mutations in the two proteins accumulated the most nucleosides, indicating that the mutations at these two sites played a major role in nucleoside accumulation.

[0045] Compared with the original strain B. subtilis168Δupp, the engineered strain showed increased nucleoside accumulation, and the introduction of adeC... P135S Mutant strains and the introduction of nupC Q231* Mutant strains accumulate less, while mutant strains with arbitrary combinations of these four sites (such as those introducing adeC) accumulate less. F158fs &nupC Q231* Mutant strains accumulate more nucleosides, and strains with four point mutations in the two proteins accumulate the most nucleosides, indicating that mutations at these two sites play a major role in nucleoside accumulation.

[0046] Fourthly, the present invention also provides the use of the strain in the production of nucleosides or their derivatives.

[0047] Specifically, the present invention further provides a method for producing nucleosides or their derivatives, comprising: culturing the strain to produce, accumulate and collect nucleosides.

[0048] Preferably, the method includes: inoculating the strain into a seed culture medium for propagation, and then transferring the propagated culture into a fermentation culture medium for fermentation.

[0049] When the strain is Bacillus, the preferred seed culture medium formula (g / L) is: glucose 20, yeast powder 5, corn steep liquor powder 5, potassium dihydrogen phosphate 3, magnesium sulfate 0.5, ferrous sulfate 0.02, manganese sulfate 0.01, pH 7.0-7.2.

[0050] The preferred fermentation medium formula (g / L) is as follows: glucose 60, yeast powder 3.5, potassium dihydrogen phosphate 3, ammonium sulfate 25, manganese sulfate 0.01, magnesium sulfate 5, monosodium glutamate 10, corn steep liquor powder 15, calcium carbonate 25, pH 7.0-7.2.

[0051] The preferred fermentation conditions are 35-36°C.

[0052] The optimal fermentation time is 40-50 hours.

[0053] In a preferred embodiment, the fermentation conditions are 35.5°C and 46 hours.

[0054] Based on the above technical solution, the beneficial effects of the present invention are as follows:

[0055] This invention can increase the nucleoside yield of strains through point mutation, effectively accumulate inosine, adenosine and other nucleoside-related products produced by the strains, without affecting cell growth, thus having wider applicability and helping to reduce the cost of industrial production of nucleosides. Attached Figure Description

[0056] Figure 1 This is a comparison of inosine production levels among Bacillus amyloliquefaciens strains in this invention.

[0057] Figure 2 This is a comparison of inosine production levels among Bacillus subtilis strains in this embodiment of the invention.

[0058] Figure 3 The results show the comparison of adenosine synthesis capacity of engineered strains B. subtilis-E10-1, E10-2, E10-3, E10-4 and B. subtilis A5 in the embodiments of the present invention. Detailed Implementation

[0059] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention.

[0060] The original strains *B. amyloliquefaciens* 13952 and *B. subtilis* 168 used in this invention were preserved in the laboratory and are commercially available; *B. subtilis* A5 has been disclosed in CN110257315A. The adenosine and inosine standards used in this invention were purchased from Sigma-Aldrich (http: / / www.sigmaaldrich.com / sigma-aldrich), and the molecular biology reagents used, including DNA polymerase, DNA purification kit, restriction endonucleases, dephosphorylases, and DNA ligases, were purchased from Thermo Fisher Scientific (http: / / www.thermoscientificbio.com / fermentas). Other biochemical reagents were purchased from Sangon Biotech (Shanghai) Co., Ltd. (http: / / www.sangon.com / ).

[0061] The primer sequences involved in each embodiment are shown in Table 1 (SEQ ID NO.17-40 from top to bottom).

[0062] Table 1 Primer sequences

[0063] Primer Sequence 5'→3' adeC-A-1f caaaataaggatcctctagagtcgacgacatttatcgtgtaagcgg adeC-A-1r-1 cgcgggaacacaggaagaaagcatgaaacgaat adeC-A-2f-1 attcgtttcatgctttcttcctgtgttcccgcg adeC-A-1r-2 ttcctgataaaaaggctttaaatctgcggctttaaatctgcggc adeC-A-2f-2 gccgcagatttaaagccgcagatttaaagcctttttatcaggaa adeC-A-2r ccagtgccaagcttgcatgcctgcagataaacagcagatctgcgtc nupC-A-1f caaaataaggatcctctagagtcgacatgaagtatttcatcggaat nupC-A-1r-1 attgacattgagaccggcgacattgcggatgc nupC-A-2f-1 gcatccgcaatgtcgccggtctcaatgtcaat nupC-A-1r-2 acttcgaaaaaggattatttttcttcttcagga nupC-A-2f-2 tcctgaagaagaaaaataatcctttttcgaagt nupC-A-2r ccagtgccaagcttgcatgcctgcagtcagtgaatcaatcccacga adeC-S-1f caaaataaggatcctctagagtcgacttgaataaagaagcgctagt adeC-S-1r-1 gcaggcacactggaagaaagcataaaatggatat adeC-S-2f-1 atatccattttatgctttcttccagtgtgcctgc adeC-S-1r-2 ttcttcataaaaaggcttgagatcggcggcttgagatcggcag adeC-S-2f-2 ctgccgatctcaagccgccgatctcaagcctttttatgaagaa adeC-S-2r ccagtgccaagcttgcatgcctgcagctttgtatctaatccgtagc nupC-S-1f caaaataaggatcctctagagtcgacatgaagtatttgattgggat nupC-S-1r-1 cgacattgatacaggtgacatcgcagatgc nupC-S-2f-1 gcatctgcgatgtcacctgtatcaatgtcg nupC-S-1r-2 cttcgaagaaggattatttttcttcttcctc nupC-S-2f-2 gaggaagaagaaaaataatccttcttcgaag nupC-S-2r ccagtgccaagcttgcatgcctgcagtcagtaaatcaagcccacaa

[0064] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.

[0065] Example 1: Engineered strain B. amyloliquefaciens G4 (adeC P135S ), G5 (adeC F158fs Construction of )

[0066] Using primers adeC-A-1f / 1r-1 and adeC-A-2f-1 / 2r, and adeC-A-1f / 1r-2 and adeC-A-2f-2 / 2r, with the genome of *B. amyloliquefaciens* 13952 as a template, Pfu high-fidelity DNA polymerase was used to amplify the upstream and downstream homologous arms of the adeC locus. The upstream and downstream fragments were then fused using primer adeC-A-1f / 2r to obtain adeC*. 1 Homologous fragments (containing the P135S mutation, complete adeC*) 1 The nucleotide sequence of the gene is shown in SEQ ID No. 1, totaling 1734 bp, and the mutated amino acid sequence is shown in SEQ ID No. 2, totaling 578 amino acids. 2Homologous fragments (containing the F158fs mutation, complete adeC*) 2 The nucleotide sequence of the gene is shown in SEQ ID No. 3, totaling 1748 bp. The amino acid sequence after mutation is shown in SEQ ID No. 4, totaling 582 amino acids. The two fragments were combined with the pKSU (tool vector) plasmid and subjected to SalI / PstI double digestion, ligation, transformation, and other operations to obtain the plasmid pKSU-adeC*. 1 and pKSU-adeC* 2 Electrochemical conversion was performed on *B. amyloliquefaciens* 13952. Transformants were screened on LB agar plates containing 2.5 μg / mL chloramphenicol at 30 °C. The obtained transformants were inoculated into 5 mL LB broth, incubated at 42 °C and 200 rpm for 12 h, and passaged. The transformed transformants were then diluted and plated on LB agar plates containing 5 μg / mL chloramphenicol to obtain primary recombinants. The primary recombinants were inoculated into 5 mL LB broth, incubated at 42 °C and 200 rpm for 12 h, and passaged. The transformed transformants were then diluted and plated on LB agar plates containing 0.8 μM 5-FU to screen for secondary recombinants, thus obtaining the adeC introduced into *B. amyloliquefaciens* 13952 (Δupp). P135S The B. amyloliquefaciens G4 strain was introduced into adeC F158fs B. amyloliquefaciens G5 strain.

[0067] Example 2: Engineered strain B. amyloliquefaciens G6(nupC) T175P ), G7(nupC Q231* Construction of )

[0068] Using primers nupC-A-1f / 1r-1 and nupC-A-2f-1 / 2r, and nupC-A-1f / 1r-2 and nupC-A-2f-2 / 2r, with the *B. amyloliquefaciens* 13952 genome as a template, Pfu high-fidelity DNA polymerase was used to amplify the upstream and downstream homologous arms of the nupC site. The upstream and downstream fragments were then fused using primer nupC-A-1f / 2r to obtain nupC*. 1 Homologous fragments (containing T175P mutation, complete nupC*) 1 The nucleotide sequence of the gene is shown in SEQ ID No. 5, totaling 1182 bp. The amino acid sequence after mutation is shown in SEQ ID No. 6, totaling 393 amino acids. 2 Homologous fragments (containing Q231* mutation, complete nupC*) 2The nucleotide sequence of the gene is shown in SEQ ID No. 7, totaling 1182 bp. The amino acid sequence after mutation is shown in SEQ ID No. 8, totaling 393 amino acids. The two fragments were combined with the pKSU (tool vector) plasmid and subjected to SalI / PstI double digestion, ligation, transformation, etc., to obtain the plasmid pKSU-nupC*. 1 and pKSU-nupC* 2 Electrochemical conversion was performed on B. amyloliquefaciens 13952, and the screening method was the same as in Example 1, resulting in the introduction of nupC into B. amyloliquefaciens 13952 (Δupp). T175P The B. amyloliquefaciens G6 strain was introduced into nupC Q231* The B. amyloliquefaciens G7 strain.

[0069] Example 3: Construction of engineered strain B. amyloliquefaciens G8 (introducing adeC) F158fs &nupC Q231* mutation)

[0070] Plasmid pKSU-nupC* 2 Transformed into B. amyloliquefaciens G5 strain, resulting in engineered B. amyloliquefaciens G8(adeC) strain. F158fs &nupC Q231* (Mutation), the screening method is the same as in Example 1.

[0071] Example 4: Engineered strain B. subtilis E4 (adeC P135S ), E5(adeC F158fs Construction of )

[0072] Using primers adeC-S-1f / 1r-1 and adeC-S-2f-1 / 2r, and adeC-S-1f-2 / 1r and adeC-S-2f-2 / 2r, with the B. subtilis 168 genome as a template, adeC* was amplified using Pfu high-fidelity DNA polymerase to obtain adeC*. 3 and adeC* 4 Upstream and downstream homologous arms; adeC* was obtained by fusing upstream and downstream fragments with primers adeC-S-1f / 2r. 3 Homologous fragments (containing the P135S mutation, complete adeC*) 3 The nucleotide sequence of the gene is shown in SEQ ID No. 9, totaling 1734 bp, and the mutated amino acid sequence is shown in SEQ ID No. 10, totaling 578 amino acids) and adeC*.4 Homologous fragments (containing the F158fs mutation, complete adeC*) 4 The nucleotide sequence of the gene is shown in SEQ ID No. 11, totaling 1748 bp. The amino acid sequence after mutation is shown in SEQ ID No. 12, totaling 582 amino acids. The two fragments were combined with the pKSU (tool vector) plasmid and subjected to SalI / PstI double digestion, ligation, transformation, etc., to obtain the plasmid pKSU-adeC*. 3 and pKSU-adeC* 4 Electrochemical conversion was performed on *B. subtilis* 168. Transformants were screened on LB agar plates containing 2.5 μg / mL chloramphenicol at 30 °C. The obtained transformants were inoculated into 5 mL LB broth, incubated at 42 °C and 200 rpm for 12 h, and passaged for one generation. The transformed transformants were then diluted and plated onto LB agar plates containing 5 μg / mL chloramphenicol to obtain primary recombinants. The primary recombinants were inoculated into 5 mL LB broth, incubated at 42 °C and 200 rpm for 12 h, and passaged for one generation. The transformed transformants were then diluted and plated onto LB agar plates containing 0.8 μM 5-FU to screen for secondary recombinants, thus obtaining the *AdeC*-introduced *B. subtilis* 168 (Δupp). P135S B. subtilis E4 strain, introduced into adeC F158fs B. subtilis E5 strain.

[0073] Example 5: Engineered strain B. subtilis E6(nupC) T175P ), E7(nupC Q231* Construction of )

[0074] Using primers nupC-A-1f / 1r-1 and nupC-A-2f-1 / 2r, and nupC-A-1f / 1r-2 and nupC-A-2f-2 / 2r, with the B. subtilis 13952 genome as a template, pfu high-fidelity DNA polymerase was used to amplify the upstream and downstream homologous arms of the nupC site. The upstream and downstream fragments were then fused using primer nupC-A-1f / 2r to obtain nupC*. 3 Homologous fragments (containing T175P mutation, complete nupC*) 3 The nucleotide sequence of the gene is shown in SEQ ID No. 13, totaling 1182 bp. The amino acid sequence after mutation is shown in SEQ ID No. 14, totaling 393 amino acids. 4 Homologous fragments (containing Q231* mutation, complete nupC*) 4The nucleotide sequence of the gene is shown in SEQ ID No. 15, totaling 1182 bp. The amino acid sequence after mutation is shown in SEQ ID No. 16, totaling 393 amino acids. The two fragments were combined with the pKSU (tool vector) plasmid and subjected to SalI / PstI double digestion, ligation, transformation, etc., to obtain the plasmid pKSU-nupC*. 3 and pKSU-nupC* 4 The substance was electrochemically converted into B. subtilis 168, and the screening method was the same as in Example 1, resulting in the introduction of nupC into B. subtilis 168(Δupp). T175P B. subtilis E6 strain, introduced with nupC Q231* B. subtilis E7 strain.

[0075] Example 6: Construction of engineered strain B. subtilis E8 (introducing adeC) F158fs &nupC Q231* mutation)

[0076] Plasmid pKSU-nupC* 4 Transformed into B. subtilis E5 strain, resulting in engineered B. subtilis E8(adeC) strain. F158fs &nupC Q231* (Mutation), the screening method is the same as in Example 1.

[0077] Example 7: Comparison of inosine synthesis capacity of engineered strains B. amyloliquefaciens G4, G5, G6, G7, G8, and B. amyloliquefaciens 13952, as well as B. subtilis-E4, E5, E6, E7, E8, and 168.

[0078] 1. Culture medium:

[0079] (1) Seed culture medium formula (g / L): glucose 20, yeast powder 5, corn steep liquor powder 5, potassium dihydrogen phosphate 3, magnesium sulfate 0.5, ferrous sulfate 0.02, manganese sulfate 0.01, pH 7.0~7.2, sterilized at 121℃ for 20min.

[0080] (2) Fermentation medium formula (g / L): glucose 60, yeast powder 3.5, potassium dihydrogen phosphate 3, ammonium sulfate 25, manganese sulfate 0.01, magnesium sulfate 5, monosodium glutamate 10, corn steep liquor powder 15, calcium carbonate 25, pH 7.0~7.2, sterilized at 121℃ for 20min.

[0081] 2. Cultivation Methods

[0082] (1) Streak the strain in three zones on LB plates and incubate overnight at 37°C;

[0083] (2) Pick a single colony and inoculate it into 30 mL of seed culture medium. Incubate at 110 rpm and 36 °C for 7–8 h.

[0084] (3) Transfer 10% of the inoculum to 30 ml of fermentation medium, shake at 130 rpm, and incubate at 35.5 ℃ for 46 h;

[0085] Fermentation results of Bacillus amyloliquefaciens strains are shown in Figure 1 The results show that, compared with the original strain B. amyloliquefaciens 13952, the nucleoside accumulation of the engineered strain was increased, and the G4(adeC) strain showed improved levels. P135S ) and G5 (adeC F158fs The engineered bacteria at single sites accumulated inosine at levels of 0.44 g / L and 0.37 g / L, respectively, indicating that adeC P135S and adeC F158fs The introduction of G7(nupC) can reduce adenine deaminase activity and increase glycoside production. T175P ) and G8(nupC Q231* The levels of inosine in single-site engineered bacteria increased by 0.51 g / L and 0.34 g / L, respectively, indicating that nupC T175P and nupC Q231* The introduction of these substances can reduce the activity of pyrimidine nucleotide transporters and increase the production of purine nucleosides, especially inosine. The B. amyloliquefaciens G8 strain, with two point mutations in each of the two proteins, accumulated the most inosine, increasing it by 1.13 g / L, indicating that these mutations play a major role in nucleoside accumulation in Bacillus amyloliquefaciens.

[0086] Fermentation results of Bacillus subtilis strains are shown in Figure 2 The results show that, compared with the original strain B. subtilis168, the nucleoside accumulation of the engineered strain was increased, and the E4(adeC) level was higher. P135S ) and E5 (adeC F158fs The engineered bacteria at single sites accumulated inosine at levels of 33.9 mg / L and 37.7 mg / L, respectively, indicating that adeC P135S and adeC F158fs The introduction of E7 can reduce adenine deaminase activity and increase glycoside production. T175P ) and E8(nupC Q231* The levels of inosine in single-site engineered bacteria increased by 53.4 mg / L and 33.7 mg / L, respectively, indicating that nupC T175P and nupC Q231*The introduction of these substances can reduce the activity of pyrimidine nucleotide transporters and increase the production of purine nucleosides, especially inosine. The B. subtilis E8 strain, which has two point mutations in each of the two proteins, accumulated the most inosine, increasing it by 99.5 mg / L, indicating that these mutations play a major role in the nucleoside accumulation of Bacillus subtilis.

[0087] Example 12: Engineered strains B. subtilis E10-1 and E10-2 (introduced with adeC) P135S &adeC F158fs (mutation), E10-3 and E10-4 construction (introduction of nupC) T175P &nupC Q231* mutation)

[0088] plasmid pKSU-adeC* 1 The strain was transformed into B. subtilis A5 to obtain engineered B. subtilis E10-1. The plasmid pKSU-adeC* was then transferred... 2 Transformed into B. subtilis E10-1 strain, resulting in engineered B. subtilis E10-2(adeC) strain. P135S &adeC F158fs (Mutation), the construction methods for E10-3 and E10-4 are the same as above, and the screening methods are the same as in Example 6.

[0089] Example 13: Comparison of adenosine synthesis capacity among engineered strains B. subtilis-E10-1, E10-2, E10-3, E10-4 and B. subtilis A5

[0090] The culture medium and fermentation method are the same as in Example 5, and the fermentation results are shown in [see Example 5]. Figure 3 The results show that, compared with the original strain B. subtilis A5, the nucleoside accumulation of the engineered strain was increased, and E10-1(adeC) was significantly higher. P135S ) and E10-2 (adeC F158fs The adenosine content of single-point engineered bacteria increased by 1.6 g / L and 1 g / L, respectively, and E10-3(nupC) T175P ) and E10-4(nupC Q231* The single-site engineered bacteria showed an increase of 2.3 g / L and 0.7 g / L in adenosine, indicating that the mutations at these two sites in Bacillus subtilis played a major role in nucleoside accumulation.

[0091] Following the above method, the inventors also conducted multiple experiments on other mutation combinations and finally found that the adenosine production increased by any combination of the four mutant engineered bacteria was greater than that of the single-point mutant engineered bacteria, indicating that both gene loci are important sites for nucleoside-producing bacteria, and the combined effect is better.

[0092] The strain designations used in this invention, such as B. subtilis E4 and B. subtilis E5, are for ease of description and should not be construed as limiting the invention. The uses of the engineered bacteria constructed by the above method, containing the adenine deaminase gene adeC and the pyrimidine nucleotide transporter gene nupC, include, but are not limited to, the production of nucleosides.

[0093] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention. sequence list <110> Meihua (Shanghai) Biotechnology Co., Ltd. <120> Protein mutants that can increase the nucleoside yield of bacterial strains and their applications <130> KHP211117891.1 <160> 40 <170> SIPOSequenceListing 1.0 <210> 1 <211> 1734 <212> DNA <213> Artificial Sequence <400> 1 ttgaacaaag aaacactggc tgaacggctg aatgcatcag ccggcagaca aaaagccgat 60 accgtcatta aaaacggaaa aatcatggat gtatttaacc aggaatggat ttctgcagat 120 atcgccatta cggacggagt gattgtcgga ttgggcgagt atgaagggaa agaagtcatt 180 gatgcagaag gtcaaatgat cgttccgggc tttattgacg gacatgttca tatcgagtcc 240 tctatggtta ctccgattga atttgcaaaa gccgtcctcc cccacggagt gactactgtc 300 attactgatc ctcacgaaat tgcgaacgtt tccggggcaa aaggcatttc atttatgata 360 gagcaggcga aaaaagcgcc tctgaacatt cgtttcatgc tttcttcctg tgttcccgcg 420 gcaagctttg aacgctcagg agctgtatta aaagccgcag atttaaagcc tttttatcag 480 gaaaaagagg tgctggggct tgcggaagtt atggattatg tgtctgttgc ggaaggcgaa 540 gaggatatgc ttgagaaact gcttgatgcc aagcatcacg gaaagcggat tgacgggcat 600 ttagccggac tgtcttcaga tatcatcaat atatacagga ccgcatcggt gtcaaatgat 660 catgaagtga cgacaaaagc cgaggcgctg gacagaatca gacggggaat gtatgtcatg 720 ctgcgcgaag gatcggtggc taaaaatacg ctcaatgtgc tgccggcggt gaatgaaaaa 780 aatgcacggc gctttttctt ttgtacggat gataaacatg tagacgatct gctttcagaa 840 ggaagtgtga accaccaagt caaaatggcg ataaaggcgg gacttgatcc attccttgcg 900 tatcagctcg ccagcttaaa tgcggccgag tgctacgacc ttgaaacaaa aggggcggtt 960 gcgccgggt ttgacgcaga tctgctgttt atttcagatt tgcgggaggc tgccgtcacg 1020 aagaccatgg tcgccggacg gaccgttgcc gagaacggac gcacggttta tgaacagtct 1080 gccggctctt attctccgga tcaggcgctg ttggatacag tgcggctgaa agcgccgctc 1140 actgaatctg atttcatat gccgattcaa gagggcaggc aaatgaatgt aatcgaaatc 1200 ataccgaatc atttggaaac gaggaaaaaa gaagtgcctg cgccatctgc tgacgcattt 1260 tgttctgata cacaaaatga tttattaaaa atcgccgtcg cagagcggca cagcggagaa 1320 aaaatgatag ggctcggaat tgtacaagga ttcgggttaa aagaaggcgc cattgccaca 1380 accatttctc acgattccca caatatcatc gctgcggta caaacgatgc cgatttggca 1440 agagcaatca acaggctccg tgacaccggg ggagggttaa cagccgtgaa aaacggagaa 1500 ttgcttcact ctgttccgct tccgatcgcc gggctttttgt ctgataagtc cgcggaatgg 1560 gtgaatgaca gtttgggcgt gcttcatgaa aagcttcctc tgctcggatt caccggtgat 1620 ttcaacccgt ttctcacatt atcgttttta gcgcttccg tcattccgga cattaaaatg 1680 acggcagcgg gtctgtttga tgttaaggcc tttcagcata ttccgcttca ataa 1734 <210> 2 <211> 577 <212> PRT <213> Artificial Sequence <400> 2 Met Asn Lys Glu Thr Leu Ala Glu Arg Leu Asn Ala Ser Ala Gly Arg 1 5 10 15 Gln Lys Ala Asp Thr Val Ile Lys Asn Gly Lys Ile Met Asp Val Phe 20 25 30 Asn Gln Glu Trp Ile Ser Ala Asp Ile Ala Ile Thr Asp Gly Val Ile 35 40 45 Val Gly Leu Gly Glu Tyr Glu Gly Lys Glu Val Ile Asp Ala Glu Gly 50 55 60 Gln Met Ile Val Pro Gly Phe Ile Asp Gly His Val His Ile Glu Ser 65 70 75 80 Ser Met Val Thr Pro Ile Glu Phe Ala Lys Ala Val Leu Pro His Gly 85 90 95 Val Thr Thr Val Ile Thr Asp Pro His Glu Ile Ala Asn Val Ser Gly 100 105 110 Ala Lys Gly Ile Ser Phe Met Ile Glu Gln Ala Lys Lys Ala Pro Leu 115 120 125 Asn Ile Arg Phe Met Leu Ser Ser Cys Val Pro Ala Ala Ser Phe Glu 130 135 140 Arg Ser Gly Ala Val Leu Lys Ala Ala Asp Leu Lys Pro Phe Tyr Gln 145 150 155 160 Glu Lys Glu Val Leu Gly Leu Ala Glu Val Met Asp Tyr Val Ser Val 165 170 175 Ala Glu Gly Glu Glu Asp Met Leu Glu Lys Leu Leu Asp Ala Lys His 180 185 190 His Gly Lys Arg Ile Asp Gly His Leu Ala Gly Leu Ser Ser Asp Ile 195 200 205 Ile Asn Ile Tyr Arg Thr Ala Ser Val Ser Asn Asp His Glu Val Thr 210 215 220 Thr Lys Ala Glu Ala Leu Asp Arg Ile Arg Arg Gly Met Tyr Val Met 225 230 235 240 Leu Arg Glu Gly Ser Val Ala Lys Asn Thr Leu Asn Val Leu Pro Ala 245 250 255 Val Asn Glu Lys Asn Ala Arg Arg Phe Phe Phe Cys Thr Asp Asp Lys 260 265 270 His Val Asp Asp Leu Leu Ser Glu Gly Ser Val Asn His Gln Val Lys 275 280 285 Met Ala Ile Lys Ala Gly Leu Asp Pro Phe Leu Ala Tyr Gln Leu Ala 290 295 300 Ser Leu Asn Ala Ala Glu Cys Tyr Asp Leu Glu Thr Lys Gly Ala Val 305 310 315 320 Ala Pro Gly Phe Asp Ala Asp Leu Leu Phe Ile Ser Asp Leu Arg Glu 325 330 335 Ala Ala Val Thr Lys Thr Met Val Ala Gly Arg Thr Val Ala Glu Asn 340 345 350 Gly Arg Thr Val Tyr Glu Gln Ser Ala Gly Ser Tyr Ser Pro Asp Gln 355 360 365 Ala Leu Leu Asp Thr Val Arg Leu Lys Ala Pro Leu Thr Glu Ser Asp 370 375 380 Phe His Met Pro Ile Gln Glu Gly Arg Gln Met Asn Val Ile Glu Ile 385 390 395 400 Ile Pro Asn His Leu Glu Thr Arg Lys Lys Glu Val Pro Ala Pro Ser 405 410 415 Ala Asp Ala Phe Cys Ser Asp Thr Gln Asn Asp Leu Leu Lys Ile Ala 420 425 430 Val Ala Glu Arg His Ser Gly Glu Lys Met Ile Gly Leu Gly Ile Val 435 440 445 Gln Gly Phe Gly Leu Lys Glu Gly Ala Ile Ala Thr Thr Ile Ser His 450 455 460 Asp Ser His Asn Ile Ile Ala Val Gly Thr Asn Asp Ala Asp Leu Ala 465 470 475 480 Arg Ala Ile Asn Arg Leu Arg Asp Thr Gly Gly Gly Leu Thr Ala Val 485 490 495 Lys Asn Gly Glu Leu Leu His Ser Val Pro Leu Pro Ile Ala Gly Leu 500 505 510 Leu Ser Asp Lys Ser Ala Glu Trp Val Asn Asp Ser Leu Gly Val Leu 515 520 525 His Glu Lys Leu Pro Leu Leu Gly Phe Thr Gly Asp Phe Asn Pro Phe 530 535 540 Leu Thr Leu Ser Phe Leu Ala Leu Pro Val Ile Pro Asp Ile Lys Met 545 550 555 560 Thr Ala Ala Gly Leu Phe Asp Val Lys Ala Phe Gln His Ile Pro Leu 565 570 575 Gln <210> 3 <211> 1748 <212> Ms <213> Artificial Sequence <400> 3 ttgaacaaag aaacactggc tgaacggctg aatgcatcag ccggcagaca aaaagccgat 60 accgtcatta aaaacggaaa aatcatggat gtatttaacc aggaatggat ttctgcagat 120 atcgccatta cggacggagt gattgtcgga ttgggcgagt atgaagggaa agaagtcatt 180 gatgcagaag gtcaaatgat cgttccgggc tttattgacg gacatgttca tatcgagtcc 240 tctatggtta ctccgattga atttgcaaaa gccgtcctcc cccacggagt gactactgtc 300 attactgatc ctcacgaaat tgcgaacgtt tccggggcaa aaggcatttc atttatgata 360 gagcaggcga aaaaagcgcc tctgaacatt cgtttcatgc ttccttcctg tgttcccgcg 420 gcaagctttg aacgctcagg agctgtatta aaagccgcag atttaaagcc gcagatttaa 480 agccttttta tcaggaaaaa gaggtgctgg ggcttgcgga agttatggat tatgtgtctg 540 ttgcggaagg cgaagaggat atgcttgaga aactgcttga tgccaagcat cacggaaagc 600 ggattgacgg gcatttagcc ggactgtctt cagatatcat caatatatac aggaccgcat 660 cggtgtcaaa tgatcatgaa gtgacgacaa aagccgaggc gctggacaga atcagacggg 720 gaatgtatgt catgctgcgc gaggatcgg tggctaaaaa tacgctcaat gtgctgccgg cggtgaatga aaaaaatgca cggcgctttt tcttttgtac ggatgataaa catgtagcg atctgctttc agaaggaagt gtgaaccacc aagtcaaaat ggcgataaag gcgggacttg atccattcct tgcgtatcag ctcgccagct taaatgcggc cgagtgctac gaccttgaaa caaaaggggc ggttgcgccg ggttttgacg cagatctgct gtttatttca gatttgcggg aggctgccgt cacgaagacc atggtcgccg gacggaccgt tgccgagaac ggacgcacgg 1080 tttatgaaca gtctgccggc tcttattctc cggatcaggc gctgttggat acagtgcggc tgaaagcgcc gctcactgaa tctgattttc atatgccgat tcaagagggc aggcaaatga atgtaatcga aatcataccg aatcatttgg aaacgagga aaaagaagtg cctgcgccat ctgctgacgc attttgttct gatacacaaa atgatttatt aaaaatcgcc gtcgcagagc ggcacagcgg agaaaaaatg atagggctcg gaattgtaca aggattcggg ttaaaagaag gcgccattgc cacaaccatt tctcacgatt cccacaatat catcgctgtc ggtacaaacg atgccgattt ggcaagagca atcaacaggc tccgtgacac cgggggaggg ttaacagccg 1500 tgaaaaacgg agaattgctt cactctgttc cgcttccgat cgccgggctt ttgtctgata 1560 agtccgcgga atgggtgaat gacagtttgg gcgtgcttca tgaaaagctt cctctgctcg 1620 gattcaccgg tgatttcaac ccgtttctca cattatcgtt tttagcgctt cccgtcattc 1680 cggacattaa aatgacggca gcgggtctgt ttgatgttaa ggcctttcag catattccgc 1740 ttcaataa 1748 <210> 4 <211> 159 <212> PRT <213> Artificial Sequence <400> 4 Met Asn Lys Glu Thr Leu Ala Glu Arg Leu Asn Ala Ser Ala Gly Arg 1 5 10 15 Gln Lys Ala Asp Thr Val Ile Lys Asn Gly Lys Ile Met Asp Val Phe 20 25 30 Asn Gln Glu Trp Ile Ser Ala Asp Ile Ala Ile Thr Asp Gly Val Ile 35 40 45 Val Gly Leu Gly Glu Tyr Glu Gly Lys Glu Val Ile Asp Ala Glu Gly 50 55 60 Gln Met Ile Val Pro Gly Phe Ile Asp Gly His Val His Ile Glu Ser 65 70 75 80 Ser Met Val Thr Pro Ile Glu Phe Ala Lys Ala Val Leu Pro His Gly 85 90 95 Val Thr Thr Val Ile Thr Asp Pro His Glu Ile Ala Asn Val Ser Gly 100 105 110 Ala Lys Gly Ile Ser Phe Met Ile Glu Gln Ala Lys Lys Ala Pro Leu 115 120 125 Asn Ile Arg Phe Met Leu Pro Ser Cys Val Pro Ala Ala Ser Phe Glu 130 135 140 Arg Ser Gly Ala Val Leu Lys Ala Ala Asp Leu Lys Pro Gln Ile 145 150 155 <210> 5 <211> 1182 <212> DNA <213> Artificial Sequence <400> 5 atgaagtatt tcatcggaat tatcggaatc attgtgtttt taggtcttgc ctggctcgcc 60 agcaacggca aaaaaagaat cagaatccgg ccgatcgccg tcatgctcgt tttgcagctg 120 attctcggtt acattctcct caataccggg atcgggaatt ttcttgtcgg cggatttgcc 180 aaaggattta actacttgct ggaatatgca tcagaaggga ttaactttgt attcggcgga 240 cttgtgaatg cgaaacagac gacattcttc atgagcgtgc tcctgccgat cgtctttata 300 tccgctttaa tcggaatatt gcagcattgg aaggttctcc ctttcatcac gaagtatatc 360 ggtcttgcat taagcaaggt gaacggaatg gggaaaatcg aatcttacaa cgctgtcgca 420 tccgcgattt tgggtcagtc ggaagttttt atcagcttga aaaaacagct cggctatctt 480 actgaacagc gcttatacac gctttgcgca tccgcaatgt cgccggtctc aatgtcaatc 540 gtcggttctt acatgatgat gctgaagcct gaatacgtcg tgacggcgct tgtgctgaac 600 ttattcggcg gatttatcat tgcttctatc atcaacccgt acaccgtcag caaagatgag 660 gatttgatcg ttgttcctga agaagaaaaa caatcctttt tcgaagtgct cggtgagtat 720 ataatggatg gattcagagt cgccgttgtc gtagcggcga tgctgatcgg atttgtcgca 780 ctcattgccc tggtcaatgg cgtttttaac gcggtcttcg gcattacatt ccaggcgctg 840 ctcggctatg tatttgcgcc attcgcgttt ttaaccggta ttccgtggaa tgaagcggtg 900 agtgccggaa gcattatggc gacgaaaatg gtatcgaatg aatttgtggc gatgcagacg 960 ctctcatccg gcgatttcca tttcagtgcg catactcagg cagtggtatc tgtattcctt 1020 gtctcatttg cgaatttctc ttctatcgga atcattacgg gtgcggtgaa agggctgcat 1080 gaaaaacaag gaaacgtcgt cgcgcggttc gggctgaagc tgctgtacgg ggcaacgctc 1140 gtcagcttcc tgacagcggc gatcgtggga ttgattcact ga 1182 <210> 6 <211> 393 <212> PRT <213> Artificial Sequence <400> 6 Met Lys Tyr Phe Ile Gly Ile Ile Gly Ile Ile Val Phe Leu Gly Leu 1 5 10 15 Ala Trp Leu Ala Ser Asn Gly Lys Lys Arg Ile Arg Ile Arg Pro Ile 20 25 30 Ala Val Met Leu Val Leu Gln Leu Ile Leu Gly Tyr Ile Leu Leu Asn 35 40 45 Thr Gly Ile Gly Asn Phe Leu Val Gly Gly Phe Ala Lys Gly Phe Asn 50 55 60 Tyr Leu Leu Glu Tyr Ala Ser Glu Gly Ile Asn Phe Val Phe Gly Gly 65 70 75 80 Leu Val Asn Ala Lys Gln Thr Thr Phe Phe Met Ser Val Leu Leu Pro 85 90 95 Ile Val Phe Ile Ser Ala Leu Ile Gly Ile Leu Gln His Trp Lys Val 100 105 110 Leu Pro Phe Ile Thr Lys Tyr Ile Gly Leu Ala Leu Ser Lys Val Asn 115 120 125 Gly Met Gly Lys Ile Glu Ser Tyr Asn Ala Val Ala Ser Ala Ile Leu 130 135 140 Gly Gln Ser Glu Val Phe Ile Ser Leu Lys Lys Gln Leu Gly Tyr Leu 145 150 155 160 Thr Glu Gln Arg Leu Tyr Thr Leu Cys Ala Ser Ala Met Ser Pro Val 165 170 175 Ser Met Ser Ile Val Gly Ser Tyr Met Met Met Leu Lys Pro Glu Tyr 180 185 190 Val Val Thr Ala Leu Val Leu Asn Leu Phe Gly Gly Phe Ile Ile Ala 195 200 205 Ser Ile Ile Asn Pro Tyr Thr Val Ser Lys Asp Glu Asp Leu Ile Val 210 215 220 Val Pro Glu Glu Glu Lys Gln Ser Phe Phe Glu Val Leu Gly Glu Tyr 225 230 235 240 Ile Met Asp Gly Phe Arg Val Ala Val Val Val Ala Ala Met Leu Ile 245 250 255 Gly Phe Val Ala Leu Ile Ala Leu Val Asn Gly Val Phe Asn Ala Val 260 265 270 Phe Gly Ile Thr Phe Gln Ala Leu Leu Gly Tyr Val Phe Ala Pro Phe 275 280 285 Ala Phe Leu Thr Gly Ile Pro Trp Asn Glu Ala Val Ser Ala Gly Ser 290 295 300 Ile Met Ala Thr Lys Met Val Ser Asn Glu Phe Val Ala Met Gln Thr 305 310 315 320 Leu Ser Ser Gly Asp Phe His Phe Ser Ala His Thr Gln Ala Val Val 325 330 335 Ser Val Phe Leu Val Ser Phe Ala Asn Phe Ser Ser Ile Gly Ile Ile 340 345 350 Thr Gly Ala Val Lys Gly Leu His Glu Lys Gln Gly Asn Val Val Ala 355 360 365 Arg Phe Gly Leu Lys Leu Leu Tyr Gly Ala Thr Leu Val Ser Phe Leu 370 375 380 Thr Ala Ala Ile Val Gly Leu Ile His 385 390 <210> 7 <211> 1182 <212> DNA <213> Artificial Sequence <400> 7 atgaagtatt tcatcggaat tatcggaatc attgtgtttt taggtcttgc ctggctcgcc 60 agcaacggca aaaaaagaat cagaatccgg ccgatcgccg tcatgctcgt tttgcagctg 120 attctcggtt acattctcct caataccggg atcgggaatt ttcttgtcgg cggatttgcc 180 aaaggattta actacttgct ggaatatgca tcagaaggga ttaactttgt attcggcgga 240 cttgtgaatg cgaaacagac gacattcttc atgagcgtgc tcctgccgat cgtctttata 300 tccgctttaa tcggaatatt gcagcattgg aaggttctcc ctttcatcac gaagtatatc 360 ggtcttgcat taagcaaggt gaacggaatg gggaaaatcg aatcttacaa cgctgtcgca 420 tccgcgattt tgggtcagtc ggaagttttt atcagcttga aaaaacagct cggctatctt 480 actgaacagc gcttatacac gctttgcgca tccgcaatgt cgacggtctc aatgtcaatc 540 gtcggttctt acatgatgat gctgaagcct gaatacgtcg tgacggcgct tgtgctgaac 600 ttattcggcg gatttatcat tgcttctatc atcaacccgt acaccgtcag caaagatgag 660 gatttgatcg ttgttcctga agaagaaaaa taatcctttt tcgaagtgct cggtgagtat 720 ataatggatg gattcagagt cgccgttgtc gtagcggcga tgctgatcgg atttgtcgca 780 ctcattgccc tggtcaatgg cgtttttaac gcggtcttcg gcattacatt ccaggcgctg 840 ctcggctatg tatttgcgcc attcgcgttt ttaaccggta ttccgtggaa tgaagcggtg 900 agtgccggaa gcattatggc gacgaaaatg gtatcgaatg aatttgtggc gatgcagacg 960 ctctcatccg gcgatttcca tttcagtgcg catactcagg cagtggtatc tgtattcctt 1020 gtctcatttg cgaatttctc ttctatcgga atcattacgg gtgcggtgaa agggctgcat 1080 gaaaaacaag gaaacgtcgt cgcgcggttc gggctgaagc tgctgtacgg ggcaacgctc 1140 gtcagcttcc tgacagcggc gatcgtggga ttgattcact ga 1182 <210> 8 <211> 230 <212> PRT <213> Artificial Sequence <400> 8 Met Lys Tyr Phe Ile Gly Ile Ile Gly Ile Ile Val Phe Leu Gly Leu 1 5 10 15 Ala Trp Leu Ala Ser Asn Gly Lys Lys Arg Ile Arg Ile Arg Pro Ile 20 25 30 Ala Val Met Leu Val Leu Gln Leu Ile Leu Gly Tyr Ile Leu Leu Asn 35 40 45 Thr Gly Ile Gly Asn Phe Leu Val Gly Gly Phe Ala Lys Gly Phe Asn 50 55 60 Tyr Leu Leu Glu Tyr Ala Ser Glu Gly Ile Asn Phe Val Phe Gly Gly 65 70 75 80 Leu Val Asn Ala Lys Gln Thr Thr Phe Phe Met Ser Val Leu Leu Pro 85 90 95 Ile Val Phe Ile Ser Ala Leu Ile Gly Ile Leu Gln His Trp Lys Val 100 105 110 Leu Pro Phe Ile Thr Lys Tyr Ile Gly Leu Ala Leu Ser Lys Val Asn 115 120 125 Gly Met Gly Lys Ile Glu Ser Tyr Asn Ala Val Ala Ser Ala Ile Leu 130 135 140 Gly Gln Ser Glu Val Phe Ile Ser Leu Lys Lys Gln Leu Gly Tyr Leu 145 150 155 160 Thr Glu Gln Arg Leu Tyr Thr Leu Cys Ala Ser Ala Met Ser Thr Val 165 170 175 Ser Met Ser Ile Val Gly Ser Tyr Met Met Met Leu Lys Pro Glu Tyr 180 185 190 Val Val Thr Ala Leu Val Leu Asn Leu Phe Gly Gly Phe Ile Ile Ala 195 200 205 Ser Ile Ile Asn Pro Tyr Thr Val Ser Lys Asp Glu Asp Leu Ile Val 210 215 220 Val Pro Glu Glu Glu Lys 225 230 <210> 9 <211> 1734 <212> DNA <213> Artificial Sequence <400> 9 ttgaataaag aagcgctagt caataggctg aatgcttcag ccaaaagaca aaaagctgat 60 atcgtcatta aaaacggaaa aatcatggac gtatataatc aagaatggat atatgaagat 120 attgcgatta cagatggagt tattgtaggc ctcggtgagt atgaaggcga aaatatcatt 180 gatgcagagg gacaaatgat tgttccgggt tttattgatg gacatgtaca tattgagtcg 240 tcaatggtta caccgattga gttcgctaaa gcagtgttgc ctcatggcgt gacgacggtt 300 gttacagatc cgcatgagat cgcgaatgtg tctggtgaaa aagggattga gtttatgctt 360 gaacaagctc ggcatacacc gctgaatatc catttatgc tttcttccag tgtgcctgcc 420 gcaagttttg agcgattagg cgcaattctc aaagctgccg atctcaagcc tttttatgaa 480 gaagaagaag tattagggct ggctgaagtt atggattatg tgtcggttca gcaggctgaa 540 aaagacatgg ttcagaaact gcttgatgcc cgtgtggcag gaaaaaggat agacggtcat 600 ttagctggtt tatcaacaga cctcattaac atttacagaa ccgcatttgt cttaaacgac 660 catgaagtaa catcgaagga agaagccctt gatcgtatca gaaggggcat gtatgtcatg 720 atgcgtgaag gatcagtcgc caaaaacacg ctcaatgtgc tgccggcggt gaatgaaaag 780 aacgcacgcc ggttcttttt ctgtacggat gataagcatg tggatgattt attgtcagag 840 ggaagtgtaa accatcaggt gaaaatggcg attcaagccg gacttaatcc gtttttagcc 900 tatcagctag gaagcctcaa tgcagccgaa tgctacggat tagatacaaa gggagcgatt 960 gccccggtt ttgacgctga tttgcttttt gtatctgatc tggaaaatgt cactgtcaca 1020 atgacgatgg taaaagggca gactgttgct gaagacagca aagcggtcta tcaggatcat 1080 gcttcaactg cagcaccaga tcaggcactg cttgattctg ttaagcttgc tgctcctctt 1140 aacaaacagg atttcaat gccaatcgat tcagagcagc agatcaatgt cattcaatc 1200 ataccaaatc agcttgaaac acgattagta caagttccgg ctcctgttgc ccgcgaattt 1260 gagcctgaca ctgagcttga ttgttaaag attgcagttg tcgagcggca taaaggatta 1320 aaagaaaccg gacttggtgt tgtgaaggt tttggattca agagcggagc gattgccaca 1380 accattcac acgactccca taatattatt gccgtcggaa cgaatgatga ggatatcgcg 1440 gcggcagtta ataagctgca ggaattggc ggaggattaa cattataaaaatggggaa 1500 gagctccatt cagtaccgct gccgattgca gggttattat ccgaccaatc tgcagagca 1560 gtgaatcaa gcttgctgac gcttcatgat aaattgtcgt taatcggttt cacaggcgga 1620 tttaatccat tttgacatt gtcgtttta gcgttgcctg tcattcctga tattaaaatg 1680 acgactacgg gatttattcga tgtaaaatca ttcacaca tatcactgca ata 1734 <210> 10 <211> 577 <212> PRT <213> Artificial Sequence <400> 10 Met Asn Lys Glu Ala Leu Val Asn Arg Leu Asn Ala Ser Ala Lys Arg 1 5 10 15 Gln Lys Ala Asp Ile Val Ile Lys Asn Gly Lys Ile Met Asp Val Tyr 20 25 30 Asn Gln Glu Trp Ile Tyr Glu Asp Ile Ala Ile Thr Asp Gly Val Ile 35 40 45 Val Gly Leu Gly Glu Tyr Glu Gly Glu Asn Ile Ile Asp Ala Glu Gly 50 55 60 Gln Met Ile Val Pro Gly Phe Ile Asp Gly His Val His Ile Glu Ser 65 70 75 80 Ser Met Val Thr Pro Ile Glu Phe Ala Lys Ala Val Leu Pro His Gly 85 90 95 Val Thr Thr Val Val Thr Asp Pro His Glu Ile Ala Asn Val Ser Gly 100 105 110 Glu Lys Gly Ile Glu Phe Met Leu Glu Gln Ala Arg His Thr Pro Leu 115 120 125 Asn Ile His Phe Met Leu Pro Ser Ser Val Pro Ala Ala Ser Phe Glu 130 135 140 Arg Leu Gly Ala Ile Leu Lys Ala Ala Asp Leu Lys Pro Phe Tyr Glu 145 150 155 160 Glu Glu Glu Val Leu Gly Leu Ala Glu Val Met Asp Tyr Val Ser Val 165 170 175 Gln Gln Ala Glu Lys Asp Met Val Gln Lys Leu Leu Asp Ala Arg Val 180 185 190 Ala Gly Lys Arg Ile Asp Gly His Leu Ala Gly Leu Ser Thr Asp Leu 195 200 205 Ile Asn Ile Tyr Arg Thr Ala Phe Val Leu Asn Asp His Glu Val Thr 210 215 220 Ser Lys Glu Glu Ala Leu Asp Arg Ile Arg Arg Gly Met Tyr Val Met 225 230 235 240 Met Arg Glu Gly Ser Val Ala Lys Asn Thr Leu Asn Val Leu Pro Ala 245 250 255 Val Asn Glu Lys Asn Ala Arg Arg Phe Phe Phe Cys Thr Asp Asp Lys 260 265 270 His Val Asp Asp Leu Leu Ser Glu Gly Ser Val Asn His Gln Val Lys 275 280 285 Met Ala Ile Gln Ala Gly Leu Asn Pro Phe Leu Ala Tyr Gln Leu Gly 290 295 300 Ser Leu Asn Ala Ala Glu Cys Tyr Gly Leu Asp Thr Lys Gly Ala Ile 305 310 315 320 Ala Pro Gly Phe Asp Ala Asp Leu Leu Phe Val Ser Asp Leu Glu Asn 325 330 335 Val Thr Val Thr Met Thr Met Val Lys Gly Gln Thr Val Ala Glu Asp 340 345 350 Ser Lys Ala Val Tyr Gln Asp His Ala Ser Thr Ala Ala Pro Asp Gln 355 360 365 Ala Leu Leu Asp Ser Val Lys Leu Ala Ala Pro Leu Asn Lys Gln Asp 370 375 380 Phe His Met Pro Ile Asp Ser Glu Gln Gln Ile Asn Val Ile Gln Ile 385 390 395 400 Ile Pro Asn Gln Leu Glu Thr Arg Leu Val Gln Val Pro Ala Pro Val 405 410 415 Ala Arg Glu Phe Glu Pro Asp Thr Glu Leu Asp Leu Leu Lys Ile Ala 420 425 430 Val Val Glu Arg His Lys Gly Leu Lys Glu Thr Gly Leu Gly Val Val 435 440 445 Lys Gly Phe Gly Phe Lys Ser Gly Ala Ile Ala Thr Thr Ile Ser His 450 455 460 Asp Ser His Asn Ile Ile Ala Val Gly Thr Asn Asp Glu Asp Ile Ala 465 470 475 480 Ala Ala Val Asn Lys Leu Gln Glu Ile Gly Gly Gly Leu Thr Ile Ile 485 490 495 Lys Asn Gly Glu Glu Leu His Ser Val Pro Leu Pro Ile Ala Gly Leu 500 505 510 Leu Ser Asp Gln Ser Ala Glu Gln Val Asn Gln Ser Leu Leu Thr Leu 515 520 525 His Asp Lys Leu Ser Leu Ile Gly Phe Thr Gly Gly Phe Asn Pro Phe 530 535 540 Leu Thr Leu Ser Phe Leu Ala Leu Pro Val Ile Pro Asp Ile Lys Met 545 550 555 560 Thr Thr Thr Gly Leu Phe Asp Val Lys Ser Phe Gln His Ile Ser Leu 565 570 575 Gln <210> 11 <211> 1748 <212> DNA <213> Artificial Sequence <400> 11 ttgaataaag aagcgctagt caataggctg aatgcttcag ccaaaagaca aaaagctgat 60 atcgtcatta aaaacggaaa aatcatggac gtatataatc aagaatggat atatgaagat 120 attgcgatta cagatggagt tattgtaggc ctcggtgagt atgaaggcga aaatatcatt 180 gatgcagagg gacaaatgat tgttccgggt tttattgatg gacatgtaca tattgagtcg 240 tcaatggtta caccgattga gttcgctaaa gcagtgttgc ctcatggcgt gacgacggtt 300 gttacagatc cgcatgagat cgcgaatgtg tctggtgaaa aagggattga gtttatgctt 360 gaacaagctc ggcatacacc gctgaatatc cattttatgc ttccttccag tgtgcctgcc 420 gcaagttttg agcgattagg cgcaattctc aaagctgccg atctcaagcc gccgatctca 480 agccttttta tgaagaagaa gaagtattag ggctggctga agttatggat tatgtgtcgg 540 ttcagcaggc tgaaaaagac atggttcaga aactgcttga tgcccgtgtg gcaggaaaaa 600 ggatagacgg tcatttagct ggtttatcaa cagacctcat taacatttac agaaccgcat 660 ttgtcttaaa cgaccatgaa gtaacatcga aggaagaagc ccttgatcgt atcagaaggg 720 gcatgtatgt catgatgcgt gaaggatcag tcgccaaaaa cacgctcaat gtgctgccgg 780 cggtgaatga aaagaacgca cgccggttct ttttctgtac ggatgataag catgtggatg 840 atttattgtc agagggaagt gtaaaccatc aggtgaaaat ggcgattcaa gccggactta 900 atccgttttt agcctatcag ctaggaagcc tcaatgcagc cgaatgctac ggattagata 960 caaagggagc gattgccccg ggttttgacg ctgatttgct ttttgtatct gatctggaaa 1020 atgtcactgt cacaatgacg atggtaaaag ggcagactgt tgctgaagac agcaaagcgg 1080 tctatcagga tcatgcttca actgcagcac cagatcaggc actgcttgat tctgttaagc 1140 ttgctgctcc tcttaacaaa caggattttc atatgccaat cgattcagag cagcagatca 1200 atgtcattca aatcatacca aatcagcttg aaacacgatt agtacaagtt ccggctcctg 1260 ttgcccgcga atttgagcct gacactgagc ttgatttgtt aaagattgca gttgtcgagc 1320 ggcataaagg attaaaagaa accggacttg gtgttgtgaa aggttttgga ttcaagagcg 1380 gagcgattgc cacaaccatt tcacacgact cccataatat tattgccgtc ggaacgaatg 1440 atgaggatat cgcggcggca gttaataagc tgcaggaaat tggcggagga ttaacaatta 1500 taaaaaatgg ggaagagctc cattcagtac cgctgccgat tgcagggtta ttatccgacc 1560 aatctgcaga gcaagtgaat caaagcttgc tgacgcttca tgataaattg tcgttaatcg 1620 gtttcacagg cggatttaat ccatttttga cattgtcgtt tttagcgttg cctgtcattc 1680 ctgatattaa aatgacgact acgggattat tcgatgtaaa atcatttcaa cacatatcac 1740 tgcaataa 1748 <210> 12 <211> 169 <212> PRT <213> Artificial Sequence <400> 12 Met Asn Lys Glu Ala Leu Val Asn Arg Leu Asn Ala Ser Ala Lys Arg 1 5 10 15 Gln Lys Ala Asp Ile Val Ile Lys Asn Gly Lys Ile Met Asp Val Tyr 20 25 30 Asn Gln Glu Trp Ile Tyr Glu Asp Ile Ala Ile Thr Asp Gly Val Ile 35 40 45 Val Gly Leu Gly Glu Tyr Glu Gly Glu Asn Ile Ile Asp Ala Glu Gly 50 55 60 Gln Met Ile Val Pro Gly Phe Ile Asp Gly His Val His Ile Glu Ser 65 70 75 80 Ser Met Val Thr Pro Ile Glu Phe Ala Lys Ala Val Leu Pro His Gly 85 90 95 Val Thr Thr Val Val Thr Asp Pro His Glu Ile Ala Asn Val Ser Gly 100 105 110 Glu Lys Gly Ile Glu Phe Met Leu Glu Gln Ala Arg His Thr Pro Leu 115 120 125 Asn Ile His Phe Met Leu Pro Ser Ser Val Pro Ala Ala Ser Phe Glu 130 135 140 Arg Leu Gly Ala Ile Leu Lys Ala Ala Asp Leu Lys Pro Pro Ile Ser 145 150 155 160 Ser Leu Phe Met Lys Lys Lys Lys Tyr 165 <210> 13 <211> 1182 <212> DNA <213> Artificial Sequence <400> 13 atgaagtatt tgattgggat tatcggttta atcgtgtttt taggcctcgc gtggatcgcg 60 agcagcggca aaaaaagaat taagatccgc ccaattgttg ttatgctcat tttgcaattt 120 attcttggct acattctcct caataccgga atagggaatt tcctcgtggg aggatttgca 180 aaaggattcg gttacctgct tgaatacgcg gcagaggggaa ttaactttgt gtttggcggc 240 ttggtgaatg cggaccaaac gacattcttt atgaatgttc tcttgccaat cgtgtttatt 300 tccgctctga tcgggattct gcaaaagtgg aaagtcctcc cgtttatcat tagatatatc 360 ggccttgccc tcagcaaggt aaacggtatg ggaagattgg aatcgtataa cgcagtggct 420 tctgcgattt tagggcagtc agaagtattt atctccttga agaaagaact cggtctttta 480 aatcagcagc gcttgtacac gctttgcgca tctgcgatgt cacctgtatc aatgtcgatt 540 gtcggtgcgt atatgacaat gctgaaaccg gaatatgttg taacagcgct tgttttgaac 600 ttatttggcg gtttcattat cgcttctatt atcaatccgt acgaggttgc aaaagaagag 660 gatatgcttc gtgttgagga agaagaaaaa caatccttct tcgaagtgct cggagaatac 720 attcttgacg gtttcaaagt agcggttgtc gtcgctgcga tgctgattg atttgtcgcg 780 attattgcat tgatcaatgg catttttaat gcagtattcg gtatttcgtt ccaaggcatt 840 cttggatatg tgtttgctcc attcgcttt cttgcggta tcccatggaa tgaagctgtt 900 aatgcgggaa gcattatggc aacaaaaatg gtatcgaatg aatttgtcgc catgacgtcg 960 cttacgcaaa acggtttcca tttcagcggc cgtacaacag cgatcgtatc ggtattcctt 1020 gtgtcatttg cgaacttctc ctcaatcgga atcattgccg gtgccgtaaa aggactgaat 1080 gaaaagcaag gaaatgtcgt cgctcgtttc ggcttgaaat tattatacgg tgctacgctt 1140 gtcagctttt tatcagcagc aattgtgggc ttgatttact ga 1182 <210> 14 <211> 393 <212> PRT <213> Artificial Sequence <400> 14 Met Lys Tyr Leu Ile Gly Ile Ile Gly Leu Ile Val Phe Leu Gly Leu 1 5 10 15 Ala Trp Ile Ala Ser Ser Gly Lys Lys Arg Ile Lys Ile Arg Pro Ile 20 25 30 Val Val Met Leu Ile Leu Gln Phe Ile Leu Gly Tyr Ile Leu Leu Asn 35 40 45 Thr Gly Ile Gly Asn Phe Leu Val Gly Gly Phe Ala Lys Gly Phe Gly 50 55 60 Tyr Leu Leu Glu Tyr Ala Ala Glu Gly Ile Asn Phe Val Phe Gly Gly 65 70 75 80 Leu Val Asn Ala Asp Gln Thr Thr Phe Phe Met Asn Val Leu Leu Pro 85 90 95 Ile Val Phe Ile Ser Ala Leu Ile Gly Ile Leu Gln Lys Trp Lys Val 100 105 110 Leu Pro Phe Ile Ile Arg Tyr Ile Gly Leu Ala Leu Ser Lys Val Asn 115 120 125 Gly Met Gly Arg Leu Glu Ser Tyr Asn Ala Val Ala Ser Ala Ile Leu 130 135 140 Gly Gln Ser Glu Val Phe Ile Ser Leu Lys Lys Glu Leu Gly Leu Leu 145 150 155 160 Asn Gln Gln Arg Leu Tyr Thr Leu Cys Ala Ser Ala Met Ser Pro Val 165 170 175 Ser Met Ser Ile Val Gly Ala Tyr Met Thr Met Leu Lys Pro Glu Tyr 180 185 190 Val Val Thr Ala Leu Val Leu Asn Leu Phe Gly Gly Phe Ile Ile Ala 195 200 205 Ser Ile Ile Asn Pro Tyr Glu Val Ala Lys Glu Glu Asp Met Leu Arg 210 215 220 Val Glu Glu Glu Glu Lys Gln Ser Phe Phe Glu Val Leu Gly Glu Tyr 225 230 235 240 Ile Leu Asp Gly Phe Lys Val Ala Val Val Val Ala Ala Met Leu Ile 245 250 255 Gly Phe Val Ala Ile Ile Ala Leu Ile Asn Gly Ile Phe Asn Ala Val 260 265 270 Phe Gly Ile Ser Phe Gln Gly Ile Leu Gly Tyr Val Phe Ala Pro Phe 275 280 285 Ala Phe Leu Val Gly Ile Pro Trp Asn Glu Ala Val Asn Ala Gly Ser 290 295 300 Ile Met Ala Thr Lys Met Val Ser Asn Glu Phe Val Ala Met Thr Ser 305 310 315 320 Leu Thr Gln Asn Gly Phe His Phe Ser Gly Arg Thr Thr Ala Ile Val 325 330 335 Ser Val Phe Leu Val Ser Phe Ala Asn Phe Ser Ser Ile Gly Ile Ile 340 345 350 Ala Gly Ala Val Lys Gly Leu Asn Glu Lys Gln Gly Asn Val Val Ala 355 360 365 Arg Phe Gly Leu Lys Leu Leu Tyr Gly Ala Thr Leu Val Ser Phe Leu 370 375 380 Ser Ala Ala Ile Val Gly Leu Ile Tyr 385 390 <210> 15 <211> 1182 <212> DNA <213> Artificial Sequence <400> 15 atgaagtatt tgattgggat tatcggttta atcgtgtttt taggcctcgc gtggatcgcg 60 agcagcggca aaaaaagaat taagatccgc ccaattgttg ttatgctcat tttgcaattt 120 attcttggct acattctcct caataccgga atagggaatt tcctcgtggg aggatttgca 180 aaaggattcg gttacctgct tgaatacgcg gcagagggaa ttaactttgt gtttggcggc 240 ttggtgaatg cggaccaaac gacattcttt atgaatgttc tcttgccaat cgtgtttatt 300 tccgctctga tcgggattct gcaaaagtgg aaagtcctcc cgtttatcat tagatatatc 360 ggccttgccc tcagcaaggt aaacggtatg ggaagattgg aatcgtataa cgcagtggct 420 tctgcgattt tagggcagtc agaagtattt atctccttga agaaagaact cggtctttta 480 aatcagcagc gcttgtacac gctttgcgca tctgcgatgt catctgtatc aatgtcgatt 540 gtcggtgcgt atatgacaat gctgaaaccg gaatatgttg taacagcgct tgttttgaac 600 ttatttggcg gtttcattat cgcttctatt atcaatccgt acgaggttgc aaaagaagag 660 gatatgcttc gtgttgagga agaagaaaaa taatccttct tcgaagtgct cggagaatac 720 attcttgacg gtttcaaagt agcggttgtc gtcgctgcga tgctgattgg atttgtcgcg 780 attattgcat tgatcaatgg catttttaat gcagtattcg gtatttcgtt ccaaggcatt 840 cttggatatg tgtttgctcc attcgctttt cttgtcggta tcccatggaa tgaagctgtt 900 aatgcgggaa gcattatggc aacaaaaatg gtatcgaatg aatttgtcgc catgacgtcg 960 cttacgcaaa acggtttcca tttcagcggc cgtacaacag cgatcgtatc ggtattcctt 1020 gtgtcatttg cgaacttctc ctcaatcgga atcattgccg gtgccgtaaa aggactgaat 1080 gaaaagcaag gaaatgtcgt cgctcgtttc ggcttgaaat tattatacgg tgctacgctt 1140 gtcagctttt tatcagcagc aattgtgggc ttgatttact ga 1182 <210> 16 <211> 230 <212> PRT <213> Artificial Sequence <400> 16 Met Lys Tyr Leu Ile Gly Ile Ile Gly Leu Ile Val Phe Leu Gly Leu 1 5 10 15 Ala Trp Ile Ala Ser Ser Gly Lys Lys Arg Ile Lys Ile Arg Pro Ile 20 25 30 Val Val Met Leu Ile Leu Gln Phe Ile Leu Gly Tyr Ile Leu Leu Asn 35 40 45 Thr Gly Ile Gly Asn Phe Leu Val Gly Gly Phe Ala Lys Gly Phe Gly 50 55 60 Tyr Leu Leu Glu Tyr Ala Ala Glu Gly Ile Asn Phe Val Phe Gly Gly 65 70 75 80 Leu Val Asn Ala Asp Gln Thr Thr Phe Phe Met Asn Val Leu Leu Pro 85 90 95 Ile Val Phe Ile Ser Ala Leu Ile Gly Ile Leu Gln Lys Trp Lys Val 100 105 110 Leu Pro Phe Ile Ile Arg Tyr Ile Gly Leu Ala Leu Ser Lys Val Asn 115 120 125 Gly Met Gly Arg Leu Glu Ser Tyr Asn Ala Val Ala Ser Ala Ile Leu 130 135 140 Gly Gln Ser Glu Val Phe Ile Ser Leu Lys Lys Glu Leu Gly Leu Leu 145 150 155 160 Asn Gln Gln Arg Leu Tyr Thr Leu Cys Ala Ser Ala Met Ser Thr Val 165 170 175 Ser Met Ser Ile Val Gly Ala Tyr Met Thr Met Leu Lys Pro Glu Tyr 180 185 190 Val Val Thr Ala Leu Val Leu Asn Leu Phe Gly Gly Phe Ile Ile Ala 195 200 205 Ser Ile Ile Asn Pro Tyr Glu Val Ala Lys Glu Glu Asp Met Leu Arg 210 215 220 Val Glu Glu Glu Glu Lys 225 230 <210> 17 <211> 46 <212> DNA <213> Artificial Sequence <400> 17 caaaataagg atcctctaga gtcgacgaca tttatcgtgt aagcgg 46 <210> 18 <211> 33 <212> DNA <213> Artificial Sequence <400> 18 cgcgggaaca caggaagaaa gcatgaaacg aat 33 <210> 19 <211> 33 <212> DNA <213> Artificial Sequence <400> 19 attcgtttca tgctttcttc ctgtgttccc gcg 33 <210> 20 <211> 44 <212> DNA <213> Artificial Sequence <400> 20 ttcctgataa aaaggcttta aatctgcggc tttaaatctg cggc 44 <210> twenty one <211> 44 <212> DNA <213> Artificial Sequence <400> twenty one gccgcagatt taaagccgca gatttaaagc ctttttatca ggaa 44 <210> twenty two <211> 46 <212> DNA <213> Artificial Sequence <400> twenty two ccagtgccaa gcttgcatgc ctgcagataa acagcagatc tgcgtc 46 <210> twenty three <211> 46 <212> DNA <213> Artificial Sequence <400> twenty three caaaataagg atcctctaga gtcgacatga agtatttcat cggaat 46 <210> twenty four <211> 32 <212> DNA <213> Artificial Sequence <400> twenty four attgacattg agaccggcga cattgcggat gc 32 <210> 25 <211> 32 <212> DNA <213> Artificial Sequence <400> 25 gcatccgcaa tgtcgccggt ctcaatgtca at 32 <210> 26 <211> 33 <212> DNA <213> Artificial Sequence <400> 26 acttcgaaaa aggattatttttcttcttca gga 33 <210> 27 <211> 33 <212> DNA <213> Artificial Sequence <400> 27 tcctgaagaa gaaaaataat cctttttcga agt 33 <210> 28 <211> 46 <212> DNA <213> Artificial Sequence <400> 28 ccagtgccaa gcttgcatgc ctgcagtcag tgaatcaatc ccacga 46 <210> 29 <211> 46 <212> DNA <213> Artificial Sequence <400> 29 caaaataagg atcctctaga gtcgacttga ataaagaagc gctagt 46 <210> 30 <211> 34 <212> DNA <213> Artificial Sequence <400> 30 gcaggcacac tggaagaaag cataaaatgg atat 34 <210> 31 <211> 34 <212> DNA <213> Artificial Sequence <400> 31 atatccattt tatgctttct tccagtgtgc ctgc 34 <210> 32 <211> 43 <212> DNA <213> Artificial Sequence <400> 32 ttcttcataa aaaggcttga gatcggcggc ttgagatcgg cag 43 <210> 33 <211> 43 <212> DNA <213> Artificial Sequence <400> 33 ctgccgatct caagccgccg atctcaagcc tttttatgaa gaa 43 <210> 34 <211> 46 <212> DNA <213> Artificial Sequence <400> 34 ccagtgccaa gcttgcatgc ctgcagcttt gtatctaatc cgtagc 46 <210> 35 <211> 46 <212> DNA <213> Artificial Sequence <400> 35 caaaataagg atcctctaga gtcgacatga agtatttgat tgggat 46 <210> 36 <211> 30 <212> DNA <213> Artificial Sequence <400> 36 cgacattgat acaggtgaca tcgcagatgc 30 <210> 37 <211> 30 <212> DNA <213> Artificial Sequence <400> 37 gcatctgcga tgtcacctgt atcaatgtcg 30 <210> 38 <211> 31 <212> DNA <213> Artificial Sequence <400> 38 cttcgaagaa ggattatttt tcttcttcct c 31 <210> 39 <211> 31 <212> DNA <213> Artificial Sequence <400> 39 gaggaagaag aaaaataatc cttcttcgaa g 31 <210> 40 <211> 46 <212> DNA <213> Artificial Sequence <400> 40 ccagtgccaa gcttgcatgc ctgcagtcag taaatcaagc ccacaa 46

Claims

1. Use of a protein mutant or a nucleic acid encoding the protein mutant or a biological material containing the nucleic acid in any of the following aspects: (1) constructing a nucleoside high-yield strain; (2) screening a nucleoside high-yield strain; the nucleic acid encoding the protein mutant is: the nucleotide sequence of the gene encoding the adenine deaminase mutant is as shown in SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 9, or SEQ ID NO. 11; and / or, the nucleotide sequence of the gene encoding the pyrimidine nucleotide transporter mutant is as shown in SEQ ID NO. 5, SEQ ID NO. 7, SEQ ID NO. 13, or SEQ ID NO. 15; the strain is selected from one of Bacillus subtilis, Bacillus amyloliquefaciens; the nucleoside is one or more of adenosine, inosine.

2. A nucleoside-producing strain, characterized by, which expresses the protein mutant; and / or, which contains the nucleic acid encoding the protein mutant; the nucleic acid encoding the protein mutant is: the nucleotide sequence of the gene encoding the adenine deaminase mutant is as shown in SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 9, or SEQ ID NO. 11; and / or, the nucleotide sequence of the gene encoding the pyrimidine nucleotide transporter mutant is as shown in SEQ ID NO. 5, SEQ ID NO. 7, SEQ ID NO. 13, or SEQ ID NO. 15; the nucleoside production strain is selected from one of Bacillus subtilis, Bacillus amyloliquefaciens.

3. A method for producing a nucleoside, characterized by, which comprises: culturing the nucleoside production strain of claim 2 to produce, accumulate and collect nucleosides; the nucleoside is one or more of adenosine, inosine.

Citation Information

Patent Citations

  • Bacillus subtilis and construction method and application thereof

    CN110257315A

  • Recombinant microbe for producing cytosine and method for producing cytosine

    CN110408580A

  • Adenosine deaminase and related biomaterial and application thereof

    CN112126637A