A method for simultaneously detecting 16 pathogenic microorganisms in raw milk using liquid phase chip

Abstract

The present invention relates to the field of biotechnology. The present invention provides a method and a kit for simultaneously detecting 16 pathogenic microorganisms in raw milk using a liquid chip, and respectively designs specific upstream primers, specific downstream primers, probes and microspheres for different strain sequences, and then uses the multiple PCR products obtained after multiple PCR amplification to mix and hybridize with the liquid chip working solution with microsphere probes, and then incubate with SAPE, and then use the machine to determine the type of pathogenic microorganisms and their detection amount based on the detected microsphere fluorescence code and the MFI value of the fluorescence intensity of the reporter molecule on the microsphere. The detection method of the present invention requires a small amount of samples, and can achieve rapid, high-sensitivity, high-specificity, and high-throughput detection of multiple pathogenic microorganisms; it can provide a new method selection for laboratory testing of raw milk quality and safety, and better ensure the quality and safety of products and people's food safety.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a method for simultaneously detecting 16 pathogenic microorganisms in raw milk by using a liquid phase chip. Background Art

[0002] Fresh milk is at the top of the dairy industry chain and is an important source of raw materials for dairy production. The main risk factors affecting the quality and safety of fresh milk include chemical factors such as veterinary drug residues and disinfectant residues, as well as pathogenic hazards caused by microbial contamination and hazards caused by drug resistance factors. In addition, there are other hazards such as physical hazards and abnormal component carrying. These risk factors not only bring health risks to consumers. Among them, the disease infection caused by pathogenic microbial contamination and the drug resistance hazards caused by microbial drug resistance factors have been the focus of attention in recent years. According to monitoring data analysis, common pathogenic microorganisms in raw milk include Listeria monocytogenes, Salmonella, Staphylococcus aureus, Mycobacterium tuberculosis, Bacillus cereus, Brucella, Shigella, Streptococcus, pathogenic Escherichia coli, etc. These pathogenic microorganisms not only affect the quality and safety of raw milk and its products, but also bring health risks to consumers and even endanger their lives. Therefore, the quality and safety of raw milk has a direct impact on the dairy industry chain and is a prerequisite for product quality and safety. Summary of the invention

[0003] The purpose of the present invention is to provide a method for simultaneously detecting 16 pathogenic microorganisms in raw milk. Based on liquid chip technology, specific primers and probes are designed for different strain sequences to further identify pathogenic microorganisms, which can achieve rapid, high-sensitivity, high-specificity and high-throughput detection of multiple pathogenic microorganisms.

[0004] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0005] The present invention provides a method for simultaneously detecting 16 pathogenic microorganisms in raw milk using a liquid phase chip, comprising the following steps:

[0006] (1) Designing specific upstream primers, specific downstream primers and probes for Shigella, Bacillus anthracis, Salmonella, Clostridium botulinum, Streptococcus, Bacillus cereus, Staphylococcus aureus, Mycobacterium tuberculosis, Vibrio cholerae, Aspergillus flavus, Listeria monocytogenes, pathogenic Escherichia coli, Brucella, Enterobacter sakazakii, Clostridium perfringens and Campylobacter, respectively, and then modifying the obtained specific downstream primers and probes by adding biotin to the 5' end of the specific downstream primers and adding NH2-C to the 5' end of the probes. 12 ;

[0007] (2) taking the DNA sequence of the sample to be tested as a template, and using the corresponding specific upstream primers and the modified specific downstream primers to simultaneously perform multiple PCR amplification to obtain multiple PCR products;

[0008] (3) coupling the modified probe in step (1) with the microspheres at a volume ratio of (1-5):50 to obtain a liquid chip working solution;

[0009] (4) The multiplex PCR products were mixed with the liquid chip working solution in a volume ratio of (3-6):16, hybridized, and then incubated with SAPE. TM The instrument reads the median MFI value of the microsphere fluorescence code and the reporter molecule fluorescence; the number of each fluorescently labeled microsphere involved in the counting is ≥100, and the MFI value of the negative control of each fluorescently labeled microsphere is <100; the result is judged based on the readings: when the MFI value of the sample is greater than two times the standard deviation of the MFI of the negative control, the result is judged to be positive, and when the MFI value of the sample is less than two times the standard deviation of the MFI value of the negative control, the result is judged to be negative.

[0010] Preferably, the total system of the multiplex PCR amplification in step (2) is 50 μL, including 25 μL of multiplex PCRMix, 0.4 μL of each bacteria's specific upstream primer, 0.4 μL of each bacteria's modified specific downstream primer, 2 μL of template DNA, and then ddH2O is added to 50 μL.

[0011] Preferably, the multiplex PCR amplification program in step (2) is: pre-denaturation at 94°C for 4 min; denaturation at 94°C for 30 s; annealing at 57°C for 30 s; extension at 72°C for 1 min; 30 cycles; and finally extension at 72°C for 10 min.

[0012] Preferably, in step (4), the hybridization temperature for Campylobacter, Staphylococcus aureus, Bacillus cereus, Streptococcus, Clostridium perfringens, Listeria monocytogenes, Shigella and Clostridium botulinum is 40-52°C, and the hybridization temperature for Enterobacter sakazakii, Mycobacterium tuberculosis, Brucella, Aspergillus flavus, Salmonella, pathogenic Escherichia coli, Vibrio cholerae and Bacillus anthracis is 50-62°C; and the hybridization time is 15-35 min respectively.

[0013] The present invention also provides a kit for simultaneously detecting 16 pathogenic microorganisms in raw milk, comprising the specific upstream primers, specific downstream primers, probes and microspheres for different strain sequences.

[0014] Preferably, the specific upstream primer sequence of Shigella is shown as SEQ ID NO.1, the specific downstream primer sequence of Shigella is shown as SEQ ID NO.2, and the probe sequence of Shigella is shown as SEQ ID NO.3;

[0015] The specific upstream primer sequence of Bacillus anthracis is shown in SEQ ID NO.4, the specific downstream primer sequence of Bacillus anthracis is shown in SEQ ID NO.5, and the probe sequence of Bacillus anthracis is shown in SEQ ID NO.6;

[0016] The specific upstream primer sequence of Salmonella is shown in SEQ ID NO.7, the specific downstream primer sequence of Salmonella is shown in SEQ ID NO.8, and the probe sequence of Salmonella is shown in SEQ ID NO.9;

[0017] The specific upstream primer sequence of Clostridium botulinum is shown in SEQ ID NO.10, the specific downstream primer sequence of Clostridium botulinum is shown in SEQ ID NO.11, and the probe sequence of Clostridium botulinum is shown in SEQ ID NO.12;

[0018] The specific upstream primer sequence of the streptococcus is shown in SEQ ID NO.13, the specific downstream primer sequence of the streptococcus is shown in SEQ ID NO.14, and the probe sequence of the streptococcus is shown in SEQ ID NO.15;

[0019] The specific upstream primer sequence of the Bacillus cereus is shown in SEQ ID NO.16, the specific downstream primer sequence of the Bacillus cereus is shown in SEQ ID NO.17, and the probe sequence of the Bacillus cereus is shown in SEQ ID NO.18;

[0020] The specific upstream primer sequence of Staphylococcus aureus is shown in SEQ ID NO.19, the specific downstream primer sequence of Staphylococcus aureus is shown in SEQ ID NO.20, and the probe sequence of Staphylococcus aureus is shown in SEQ ID NO.21;

[0021] The specific upstream primer sequence of Mycobacterium tuberculosis is shown in SEQ ID NO.22, the specific downstream primer sequence of Mycobacterium tuberculosis is shown in SEQ ID NO.23, and the probe sequence of Mycobacterium tuberculosis is shown in SEQ ID NO.24;

[0022] The specific upstream primer sequence of Vibrio cholerae is shown in SEQ ID NO.25, the specific downstream primer sequence of Vibrio cholerae is shown in SEQ ID NO.26, and the probe sequence of Vibrio cholerae is shown in SEQ ID NO.27;

[0023] The specific upstream primer sequence of Aspergillus flavus is shown in SEQ ID NO.28, the specific downstream primer sequence of Aspergillus flavus is shown in SEQ ID NO.29, and the probe sequence of Aspergillus flavus is shown in SEQ ID NO.30;

[0024] The specific upstream primer sequence of Listeria monocytogenes is shown in SEQ ID NO.31, the specific downstream primer sequence of Listeria monocytogenes is shown in SEQ ID NO.32, and the probe sequence of Listeria monocytogenes is shown in SEQ ID NO.33;

[0025] The specific upstream primer sequence of the pathogenic Escherichia coli is shown in SEQ ID NO.34, the specific downstream primer sequence of the pathogenic Escherichia coli is shown in SEQ ID NO.35, and the probe sequence of the pathogenic Escherichia coli is shown in SEQ ID NO.36;

[0026] The specific upstream primer sequence of the Brucella is shown in SEQ ID NO.37, the specific downstream primer sequence of the Brucella is shown in SEQ ID NO.38, and the probe sequence of the Brucella is shown in SEQ ID NO.39;

[0027] The specific upstream primer sequence of Enterobacter sakazakii is shown in SEQ ID NO.40, the specific downstream primer sequence of Enterobacter sakazakii is shown in SEQ ID NO.41, and the probe sequence of Enterobacter sakazakii is shown in SEQ ID NO.42;

[0028] The specific upstream primer sequence of Clostridium perfringens is shown in SEQ ID NO.43, the specific downstream primer sequence of Clostridium perfringens is shown in SEQ ID NO.44, and the probe sequence of Clostridium perfringens is shown in SEQ ID NO.45;

[0029] The specific upstream primer sequence of Campylobacter is shown in SEQ ID NO.46, the specific downstream primer sequence of Campylobacter is shown in SEQ ID NO.47, and the probe sequence of Campylobacter is shown in SEQ ID NO.48.

[0030] Preferably, the kit further comprises multiplex PCR Mix, MES solution, EDC solution, Tween 20 solution, SDS solution, TE solution and SAPE reporter solution.

[0031] By adopting the above technical solution, the present invention has the following beneficial effects:

[0032] The technical solution of the present invention designs specific upstream primers, specific downstream primers, probes and microspheres for different strain sequences, and modifies the obtained specific downstream primers and probes, and then mixes and hybridizes the multiple PCR products obtained after multiple PCR amplification with the liquid chip working solution, and then incubates with SAPE, and finally determines the type and content of pathogenic microorganisms based on the machine-read microsphere fluorescence coding and the measured reporter molecule fluorescence MFI value. The detection method of the present invention can quickly lock the pathogen of infection, requires a small amount of sample, has high sensitivity, strong specificity, and has the advantages of wide linear range, good repeatability, low cost, and easy operation. The rapid and high-throughput multiple pathogenic microorganism detection method based on liquid chip technology described in the present invention can provide a new method selection for laboratory testing of raw milk quality and safety, and better ensure the quality safety of products and people's food safety. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 The detection specificity of the detection method of the present invention for 16 pathogenic strains;

[0034] Figure 2 The detection sensitivity of the detection method of the present invention to 16 pathogenic strains ( Figure 2 1-7 in represents 10 7 -10 1 , 8 represents negative control);

[0035] Figure 3 The detection sensitivity of real-time fluorescence PCR for 16 pathogenic strains ( Figure 3 A in the figure indicates the sensitivity test result of Enterobacter sakazakii; Figure 3 The B in it indicates the sensitivity test result of Listeria monocytogenes; Figure 3 The C in it indicates the sensitivity test result of Bacillus cereus; Figure 3 The D in the figure indicates the sensitivity test result of Salmonella; Figure 3 The E in it indicates the sensitivity test result of Shigella; Figure 3 The F in it indicates the sensitivity test result of Campylobacter; Figure 3 The G in it indicates the sensitivity test result of Clostridium perfringens; Figure 3 The H in represents the sensitivity test result of Staphylococcus aureus; Figure 3 The I in it indicates the sensitivity test result of Clostridium botulinum; Figure 3 The J in it indicates the sensitivity test result of pathogenic Escherichia coli; Figure 3 The K in it indicates the sensitivity test result of Streptococcus; Figure 3 The L in it indicates the sensitivity test result of Aspergillus flavus; Figure 3 The M in represents the sensitivity test result of Vibrio cholerae; Figure 3 The N in represents the sensitivity test result of Mycobacterium tuberculosis; Figure 3 The O in the figure indicates the sensitivity test result of Bacillus anthracis; Figure 3 The P in the figure indicates the sensitivity test result of Brucella. DETAILED DESCRIPTION

[0036] The present invention provides a method for simultaneously detecting 16 pathogenic microorganisms in raw milk using a liquid phase chip, comprising the following steps:

[0037] (1) Designing specific upstream primers, specific downstream primers and probes for Shigella, Bacillus anthracis, Salmonella, Clostridium botulinum, Streptococcus, Bacillus cereus, Staphylococcus aureus, Mycobacterium tuberculosis, Vibrio cholerae, Aspergillus flavus, Listeria monocytogenes, pathogenic Escherichia coli, Brucella, Enterobacter sakazakii, Clostridium perfringens and Campylobacter, respectively, and then modifying the obtained specific downstream primers and probes by adding biotin to the 5' end of the specific downstream primers and adding NH2-C to the 5' end of the probes. 12 ;

[0038] (2) taking the DNA sequence of the sample to be tested as a template, and using the corresponding specific upstream primers and the modified specific downstream primers to simultaneously perform multiple PCR amplification to obtain multiple PCR products;

[0039] (3) coupling the modified probe in step (1) with the microspheres at a volume ratio of (1-5):50 to obtain a liquid chip working solution;

[0040] (4) The multiplex PCR products were mixed with the liquid chip working solution in a volume ratio of (3-6):16, hybridized, and then incubated with SAPE and incubated on Luminex 200 TM The instrument reads the median MFI value of the microsphere fluorescence code and the reporter molecule fluorescence; the number of each fluorescently labeled microsphere involved in the counting is ≥100, indicating that the number of fluorescent microspheres used for counting is valid and the generated MFI value is valid and reliable; the MFI value of the negative control of each fluorescently labeled microsphere is <100; the result is judged based on the readings: when the MFI value of the sample is greater than two times the standard deviation of the MFI of the negative control, the result is judged to be positive, and when the MFI value of the sample is less than two times the standard deviation of the MFI value of the negative control, the result is judged to be negative.

[0041] In the present invention, the total system of the multiplex PCR amplification is 50 μL, including 25 μL of multiplex PCR Mix, 0.4 μL of each bacteria's specific upstream primer, 0.4 μL of each bacteria's modified specific downstream primer, 2 μL of template DNA, and then ddH2O is added to 50 μL.

[0042] In the present invention, the multiplex PCR amplification program is: pre-denaturation at 94°C for 4 minutes; denaturation at 94°C for 30 seconds; annealing at 57°C for 30 seconds; extension at 72°C for 1 minute; 30 cycles; and finally extension at 72°C for 10 minutes.

[0043] In the present invention, the microspheres are preferably suitable for Luminex 200 TM The magnetic microspheres of the liquid chip detector, the probes modified by different strains in the present invention correspond to different microsphere numbers, and the microspheres are specifically: Clostridium botulinum corresponds to microsphere number 26, Staphylococcus aureus corresponds to microsphere number 19, pathogenic Escherichia coli corresponds to microsphere number 76, Mycobacterium tuberculosis corresponds to microsphere number 64, Brucella corresponds to microsphere number 56, Salmonella corresponds to microsphere number 52, Enterobacter sakazakii corresponds to microsphere number 53, The corresponding microspheres are numbered 48, 29 for Vibrio cholerae, 20 for Streptococcus, 27 for Aspergillus flavus, 28 for Campylobacter, 33 for Clostridium perfringens, 35 for Listeria monocytogenes, 37 for Bacillus anthracis, 39 for Bacillus cereus, and 43 for Shigella. Microspheres with different numbers were purchased from Luminex. The operation of coupling the modified probes and microspheres in the present invention is preferably: (1) adding microspheres to a centrifuge tube and placing it on a magnetic rack, and then aspirating the supernatant; (2) adding MES solution to resuspend the microspheres, aspirating the supernatant, and repeating once; (3) adding the modified probes and EDC solution in sequence and incubating; (4) adding Tween 20 solution and SDS solution in sequence and aspirating the supernatant respectively, and then adding TE solution to obtain a liquid chip working solution. The volume ratio of the modified probes to the microspheres in the present invention is preferably (1-5):50, further preferably (2-4):50, and further preferably 3:50; the concentration of the modified probes is preferably 18-23μM / μL, further preferably 19-22μM / μL, and further preferably 20μM / μL. The liquid chip working solution of the present invention is preferably stored at 4°C in the dark.

[0044] In the present invention, the volume ratio of the multiplex PCR products to the liquid chip working solution is preferably (3-6):16, further preferably (3.7-5.5):16, and further preferably 5:16.

[0045] In the present invention, the multiple PCR products are preferably placed in a PCR instrument for hybridization after being mixed with the liquid chip working solution, so that the multiple PCR products are hybridized with the microspheres. Campylobacter, Staphylococcus aureus, Bacillus cereus, Streptococcus, Clostridium perfringens, Listeria monocytogenes, Shigella and Clostridium botulinum are preferably optimized for temperature hybridization at 40-52°C, and Enterobacter sakazakii, Mycobacterium tuberculosis, Brucella, Aspergillus flavus, Salmonella, pathogenic Escherichia coli, Vibrio cholerae and Bacillus anthracis are preferably optimized for temperature hybridization at 50-62°C; the hybridization time is preferably 15-35min. Further preferably, the multiple PCR products are mixed with the liquid chip working solution and placed in a PCR instrument set at 52°C and 20min for hybridization. After the hybridization is completed, SAPE reporter solution is added, and after oscillation and mixing, it is placed in a PCR instrument again for hybridization at 50°C and 5min. The operation of the present invention enables the cross-linked probe microspheres to carry the reporter molecule phycoerythrin carried by the amplified product, and then the Luminex 200 TM Detection and analysis of microspheres. Luminex 200 TM Microfluidics technology is used to make the microspheres pass through the detection channel in a single column quickly, and red and green lasers are used to detect the classification fluorescence on a single microsphere and the reporter fluorescence on the reporter molecule respectively. The red laser can classify the microspheres to identify different types of reactions (i.e. qualitative); the green laser can determine the number of reporter fluorescent molecules bound to the microspheres, thereby determining the number of target molecules bound to the microspheres (i.e. quantitative). Therefore, through the simultaneous detection of red and green dual-color lasers, real-time qualitative and quantitative analysis of the reaction is completed.

[0046] The present invention also provides a kit for simultaneously detecting 16 pathogenic microorganisms in raw milk, comprising the above-mentioned specific upstream primers, specific downstream primers, probes and microspheres for different strain sequences.

[0047] In the present invention, the specific upstream primer sequence of Shigella is shown in SEQ ID NO.1, which is 5'-GCTCATCAATATTACCATCGCACAT-3'; the specific downstream primer sequence of Shigella is shown in SEQ ID NO.2, which is 5'-CTTGACGACTTTCTGGAGGGATA-3'; the probe sequence of Shigella is shown in SEQ ID NO.3, which is 5'-CATGTAATGGTGTTGGTATTAAT-3'.

[0048] In the present invention, the specific upstream primer sequence of Bacillus anthracis is shown as SEQ ID NO.4, which is 5'-GAATGTATCACCAGAGGCAAGAC-3'; the specific downstream primer sequence of Bacillus anthracis is shown as SEQ ID NO.5, which is 5'-ACACTCCCACCAATATCAAAGAAC-3'; the probe sequence of Bacillus anthracis is shown as SEQ ID NO.6, which is 5'-CTTCTACAAGTAGGACACATACT-3'.

[0049] In the present invention, the specific upstream primer sequence of Salmonella is shown in SEQ ID NO.7, which is 5'-GATTGTCACCGTGGTCCAGTT-3'; the specific downstream primer sequence of Salmonella is shown in SEQ ID NO.8, which is 5'-CACCGTCAAAGGAGCCGTAA-3'; the probe sequence of Salmonella is shown in SEQ ID NO.9, which is 5'-GCGAACGGCGAAGCGTACTGGAA-3'.

[0050] In the present invention, the specific upstream primer sequence of Clostridium botulinum is shown in SEQ ID NO.10, which is 5'-ATGTGCTAATGTTACTGCTGGATC-3'; the specific downstream primer sequence of Clostridium botulinum is shown in SEQ ID NO.11, which is 5'-CGAAATGGTTATGGCTCTACTCAAT-3'; and the probe sequence of Clostridium botulinum is shown in SEQ ID NO.12, which is 5'-TTGTATCAACTTCAAGTGACTCC-3'.

[0051] In the present invention, the specific upstream primer sequence of the streptococcus is shown in SEQ ID NO.13, which is 5'-AGACATCGTTCTTGAAGCAACAG-3'; the specific downstream primer sequence of the streptococcus is shown in SEQ ID NO.14, which is 5'-GTACATGAAGCACCTGAGATAACTG-3'; the probe sequence of the streptococcus is shown in SEQ ID NO.15, which is 5'-CACTAACCATGATATTCTTGATG-3'.

[0052] In the present invention, the specific upstream primer sequence of Bacillus cereus is shown in SEQ ID NO.16, which is 5'-GCTAGTGCAACATTACGTTATCCT-3'; the specific downstream primer sequence of Bacillus cereus is shown in SEQ ID NO.17, which is 5'-GCTTACAGAGTCCGACCAAGT-3'; the probe sequence of Bacillus cereus is shown in SEQ ID NO.18, which is 5'-TAGCGTATCTTATCAACTTGGTG-3'.

[0053] In the present invention, the specific upstream primer sequence of Staphylococcus aureus is shown in SEQ ID NO.19, which is 5'-GATACACCTGAAACAAAGCATCCTA-3'; the specific downstream primer sequence of Staphylococcus aureus is shown in SEQ ID NO.20, which is 5'-TAGCCAAGCCTTGACGAACTAA-3'; the probe sequence of Staphylococcus aureus is shown in SEQ ID NO.21, which is 5'-CAAAGAACTGATAAATATGGACG-3'.

[0054] In the present invention, the specific upstream primer sequence of Mycobacterium tuberculosis is shown in SEQ ID NO.22, which is 5'-CCGTGGTGCTCAAGGTCTAC-3'; the specific downstream primer sequence of Mycobacterium tuberculosis is shown in SEQ ID NO.23, which is 5'-CGGTCTGCTTGCTCAGTTCA-3'; the probe sequence of Mycobacterium tuberculosis is shown in SEQ ID NO.24, which is 5'-GCCTATCGCAAGCCAATCACCTA-3'.

[0055] In the present invention, the specific upstream primer sequence of Vibrio cholerae is shown in SEQ ID NO.25, which is 5'-GCCTCAGTAGTACCTAATGACAGT-3'; the specific downstream primer sequence of Vibrio cholerae is shown in SEQ ID NO.26, which is 5'-GCGTAGCAGCAAGGACTTCA-3'; the probe sequence of Vibrio cholerae is shown in SEQ ID NO.27, which is 5'-AAGTGAGTTGGCAGTGAATAGCA-3'.

[0056] In the present invention, the specific upstream primer sequence of Aspergillus flavus is shown in SEQ ID NO.28, which is 5'-TTCCTAGCGAGCCCAACCT-3'; the specific downstream primer sequence of Aspergillus flavus is shown in SEQ ID NO.29, which is 5'-CGATACAATCAACTCAGACTTCACT-3'; the probe sequence of Aspergillus flavus is shown in SEQ ID NO.30, which is 5'-ACCCGTGTTTACTGTACCTTAGT-3'.

[0057] In the present invention, the specific upstream primer sequence of Listeria monocytogenes is shown in SEQ ID NO.31, which is 5'-AATGAACCTACAAGACCTTCCAGAT-3'; the specific downstream primer sequence of Listeria monocytogenes is shown in SEQ ID NO.32, which is 5'-ACCTGAGACAGATTTCCCACTTAC-3'; the probe sequence of Listeria monocytogenes is shown in SEQ ID NO.33, which is 5'-CTAATTCCCATAGTACCAAAGTA-3'.

[0058] In the present invention, the specific upstream primer sequence of the pathogenic Escherichia coli is shown in SEQ ID NO.34, which is 5'-GCTCAGTGTTAGTACAACCAGAC-3'; the specific downstream primer sequence of the pathogenic Escherichia coli is shown in SEQ ID NO.35, which is 5'-CACCATCAATACTCATTTGCTTTCC-3'; the probe sequence of the pathogenic Escherichia coli is shown in SEQ ID NO.36, which is 5'-GCGTGTTGCTGAAGTGAGTGCTC-3'.

[0059] In the present invention, the specific upstream primer sequence of Brucella is shown in SEQ ID NO.37, which is 5'-CCAGACAGGCGGCATCAATA-3'; the specific downstream primer sequence of Brucella is shown in SEQ ID NO.38, which is 5'-CACGGCGGAGGGATTATCATT-3'; and the probe sequence of Brucella is shown in SEQ ID NO.39, which is 5'-CTATCCTGACGACAAGAACAACC-3'.

[0060] In the present invention, the specific upstream primer sequence of Enterobacter sakazakii is shown in SEQ ID NO.40, which is 5'-GCGTGCTGACTCCTCTTCTAA-3'; the specific downstream primer sequence of Enterobacter sakazakii is shown in SEQ ID NO.41, which is 5'-CATCTTCCTGCTGACCGAAAC-3'; the probe sequence of Enterobacter sakazakii is shown in SEQ ID NO.42, which is 5'-ATATCGCTACCCGTCTGGAATAC-3'.

[0061] In the present invention, the specific upstream primer sequence of Clostridium perfringens is shown in SEQ ID NO.43, which is 5'-GCATGAGCTTCAATTAGGTTCTACT-3'; the specific downstream primer sequence of Clostridium perfringens is shown in SEQ ID NO.44, which is 5'-TTCCTCTTTGCCATTCATATCTAGC-3'; the probe sequence of Clostridium perfringens is shown in SEQ ID NO.45, which is 5'-AAAGGATAATAGTTGGTATTTAG-3'.

[0062] In the present invention, the specific upstream primer sequence of Campylobacter is shown in SEQ ID NO.46, which is 5'-CAAGAACAGCCACTCCAACAG-3'; the specific downstream primer sequence of Campylobacter is shown in SEQ ID NO.47, which is 5'-TTACACGATTAGCTCCTACATCAAC-3'; the probe sequence of Campylobacter is shown in SEQ ID NO.48, which is 5'-TATTGATGAATATGAGTGGAATT-3'.

[0063] In the present invention, the kit further comprises multiple PCRMix, MES solution, EDC solution, Tween 20 solution, SDS solution, TE solution and SAPE reporter solution.

[0064] In the present invention, the concentration of the MES solution is preferably 0.05-0.12M, further preferably 0.08-0.11M, and further preferably 0.1M; the concentration of the EDC solution is preferably 8-13mg / mL, further preferably 9-11mg / mL, and further preferably 10mg / mL; the volume concentration of the Tween 20 solution is preferably 0.01-0.03%, further preferably 0.015-0.025%, and further preferably 0.02%; the volume concentration of the SDS solution is preferably 0.08-0.13%, further preferably 0.09-0.12%, and further preferably 0.1%; the concentration of the SAPE reporter solution is preferably 2-8μg / mL, further preferably 3-7μg / mL, and further preferably 5μg / mL.

[0065] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0066] Example 1

[0067] (I) Experimental strains

[0068] The 16 pathogenic strains used in this experiment are as follows:

[0069] Shigella ATCC29903, Salmonella ATCC14028, Streptococcus ATCC13813, Staphylococcus aureus ATCC29213, Listeria monocytogenes ATCC19111, pathogenic Escherichia coli ATCC25922, Clostridium perfringens ATCC13124, Campylobacter ATCC33560, Bacillus cereus ATCC11778, Enterobacter sakazakii ATCC29544, Vibrio cholerae CICC23794, Aspergillus flavus CICC41668 were provided by the Pathogenic Microorganism Monitoring Office of the China Animal Health and Epidemiology Center. Clostridium botulinum, Mycobacterium tuberculosis, Brucella and Bacillus anthracis were all commissioned to be synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0070] The synthetic sequence of the strain of Bacillus anthracis is shown in SEQ ID NO. 49, which is GAATGTATCACCAGAGGCAAGACACCCCCTTGTGGCAGCTTATCCGATTGTACATGTAGATATGGAGAATATTATTCTCTCAAAAAATGAGGATCAATCCACACAGAATACTGATAGTCAAACGAGAACAATAAGTAAAAATACTTCTACAAGTAGGACACATACTAGTGAAGTACATGGAAATGCAGAAGTGCATGCGTCGTTCTTTGATATTGGTGGGAGTGT;

[0071] The synthetic sequence of the Clostridium botulinum strain is shown in SEQ ID NO.50, which is ATGTGCTAATGTTACTGCTGGATCTGTAGCAAATTTGCCTGCACCTAAAAGAGGATTTGTATCAACTTCAAGTGACTCCTCAAAACCAAATGTAAAATCTGGGCTAAATCTAATGTATTGAGTAGAGCCATAACCATTTCG;

[0072] The synthetic sequence of the Brucella strain is shown in SEQ ID NO.51, which is CCAGACAGGCGGCATCAATATCCAGCCGATTTATGTCTATCCTGACGACAAGAACAACCTGAAAGAGCCTACCATCACCGGCTATTCTGTATCCACCAGTCTCACGGTTCGCGTGCGTGAACTGGCCAATGTTGGAAAAATTTTGGATGAATCCGTCACGCTCGGTGTTAATCAGGGCGGTGATTTGAACCTGGTCAATGATAATCCCTCCGC;

[0073] The synthetic sequence of the Mycobacterium tuberculosis strain is shown in SEQ ID NO. 52, which is CCGTGGTGCTCAAGGTCTACCAGAACGCCGGCGGCACGCACCCAACGACCACGTACAAGGCCTTCGATTGGGACCAGGCCTATCGCAAGCCAATCACCTATGACACGCTGTGGCAGGCTGACACCGATCCGCTGCCAGTCGTCTTCCCCATTGTGCAAGGTGAACTGAGCAAGCAGACCG.

[0074] (II) Construction of pathogenic microorganism positive plasmid

[0075] Specific upstream primers, specific downstream primers and oligonucleotide probes were designed for the gene sequences of the above 16 pathogenic strains, respectively, as shown in Table 1.

[0076] Table 1 Specific upstream primers, specific downstream primers and probe sequences of 16 pathogenic strains

[0077]

[0078]

[0079] Based on the specific upstream primers, specific downstream primers and probes of each strain in Table 1, the corresponding DNA sequences were PCR amplified. The PCR amplification reaction system was as follows: the reaction system was PCR Mix 12.5 μL, specific upstream primer 1 μL, specific downstream primer 1 μL, template DNA 2 μL, and water was added to 25 μL. The PCR amplification reaction conditions were as follows: 94℃ pre-denaturation for 4 min; 94℃ denaturation for 30 s; 58℃ annealing for 30 s; 72℃ extension for 1 min; 30 cycles; and final extension at 72℃ for 10 min.

[0080] After PCR amplification, 2% agarose gel electrophoresis was used to identify the PCR amplification products. The product was quickly purified and recovered according to the operating instructions of Gel Extraction Kit D6294 (purchased from Omega Biotechnology Co., Ltd.), and then the target fragment was connected to the pMD18-T vector, and then transformed into DH5α chemical competent cells. After culturing at 37°C overnight, PCR identification was performed. The positive clones were picked and inoculated into LB medium containing Amp, and an appropriate amount of bacterial liquid of the positive recombinant plasmid was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The results showed that the specific upstream primers and specific downstream primers described in Table 1 can successfully amplify the positive recombinant plasmid and obtain the positive strain.

[0081] (III) Modification of specific primers and probes

[0082] The specific primers and probes for the 16 pathogenic strains in Table 1 were modified as follows: biotin was added to the 5' end of the specific downstream primer, and NH2-C 12 The modified primers were synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.

[0083] (IV) Multiplex PCR reaction

[0084] The DNA sequence of the positive strain was extracted by water bath method and used as a template for amplification. The corresponding specific upstream primers and modified specific downstream primers were used to perform multiple PCR amplification to obtain multiple PCR products. The multiple PCR amplification reaction system is as follows: 25 μL of multiple PCR Mix, 0.4 μL of each specific upstream primer of each bacterium, 0.4 μL of each modified specific downstream primer of each bacterium, and 2 μL of template DNA were added with water to 50 μL. The multiple PCR amplification reaction conditions are as follows: 94℃ pre-denaturation for 4 min; 94℃ denaturation for 30 s; 57℃ annealing for 30 s; 72℃ extension for 1 min; 30 cycles; and finally 72℃ extension for 10 min.

[0085] (V) Preparation of liquid chip working solution

[0086] The microspheres used in this experiment are suitable for Luminex 200 TM The magnetic microspheres of the liquid chip detector are specifically: the microspheres corresponding to Clostridium botulinum are numbered 26, the microspheres corresponding to Staphylococcus aureus are numbered 19, the microspheres corresponding to pathogenic Escherichia coli are numbered 76, the microspheres corresponding to Mycobacterium tuberculosis are numbered 64, the microspheres corresponding to Brucella are numbered 56, the microspheres corresponding to Salmonella are numbered 52, the microspheres corresponding to Enterobacter sakazakii are numbered 48, the microspheres corresponding to Vibrio cholerae are numbered 29, the microspheres corresponding to Streptococcus are numbered 20, the microspheres corresponding to Aspergillus flavus are numbered 27, the microspheres corresponding to Campylobacter are numbered 28, the microspheres corresponding to Clostridium perfringens are numbered 33, the microspheres corresponding to Listeria monocytogenes are numbered 35, the microspheres corresponding to Bacillus anthracis are numbered 37, the microspheres corresponding to Bacillus cereus are numbered 39, and the microspheres corresponding to Shigella are numbered 43.

[0087] Preparation steps of liquid chip working solution:

[0088] (1) Take 50 μL of microspheres and transfer them to a 1.5 ml centrifuge tube. Place the tube on a magnetic rack for 2 min and discard the supernatant.

[0089] (2) Add 50 μL of 0.1 M MES (pH 4.5) to resuspend the microspheres, vortex and discard the supernatant.

[0090] (3) Add 7 μL 0.1 M MES (pH 4.5) and vortex to mix.

[0091] (4) Add 3 μL of the modified probe diluted to a concentration of 20 μM / μL.

[0092] (5) Add 2 μL of freshly prepared EDC solution (10 mg / mL) to the microspheres and shake immediately after addition.

[0093] (6) Incubate at room temperature for 30 min.

[0094] (7) Add 2 μL of freshly prepared EDC solution (10 mg / mL) to the microspheres and shake immediately after addition.

[0095] (8) Add 1 mL of 0.02% Tween 20 solution, vortex to mix, place on a magnetic stand for 2 min, and discard the supernatant.

[0096] (9) Add 1 mL of 0.1% SDS solution, vortex to mix, place on a magnetic stand for 2 min, and discard the supernatant.

[0097] (10) Add 100 μL TE solution and shake to mix well to obtain the liquid chip working solution.

[0098] (11) Store at 4°C away from light.

[0099] (VI) Microsphere on-machine testing

[0100] The multiple PCR product (5 μL) and the microsphere working solution (16 μL) were mixed, then oscillated and mixed, and then placed in a PCR instrument, set at 52°C for 20 min to allow the product and the microsphere to hybridize. After the hybridization, 79 μL of SAPE reporter solution (5 μg / mL) was added, oscillated and mixed, and then placed in a PCR instrument, set at 50°C for 5 min to allow hybridization, and the MFI value (threshold) was measured.

[0101] Example 2 Specificity

[0102] Each positive plasmid obtained in Example 1 was used as a template, and 5 μL of the multiplex PCR amplification product was taken for specific detection using the liquid chip detection method; a negative control group (with the same volume of DEPC water) was set up for the same specific detection.

[0103] The results are as follows Figure 1 As shown, it can be seen that the specific upstream primer, the modified specific downstream primer and the modified probe of the present invention can specifically detect the corresponding pathogenic strains with higher specificity.

[0104] Example 3 Sensitivity (one)

[0106] Each positive plasmid obtained in Example 1 was diluted 10 times (10 7 , 10 6 , 10 5 , 10 4 , 10 3 , 10 2 , 10 1), using positive plasmids of different concentrations as templates, performing multiplex PCR amplifications respectively, and then using the liquid chip detection method to perform sensitivity testing; at the same time, a negative control group (adding the same volume of DEPC water) was set up to perform the same sensitivity testing (when the MFI value of the sample was greater than two times the standard deviation of the MFI of the negative control, the result was judged to be positive, and when the MFI value of the sample was less than two times the standard deviation of the MFI of the negative control, the result was judged to be negative).

[0107] The results are shown in Figure 2. Bacillus cereus 10 7 The MFI value is 934, 10 2 82; Clostridium perfringens 10 7 When the MFI value is 460, 10 2 75; Mycobacterium tuberculosis 10 7 The MFI value is 542, 10 1 97; Clostridium botulinum 10 7 The MFI value is 672, 10 2 122 at 9:00; Shigella 10 7 The MFI value is 943, 10 1 195 for Staphylococcus aureus and 10 for 7 The MFI value is 5107, 10 1 It was 1703; Brucella 10 7 The MFI value is 599, 10 1 204 at 9:00; Salmonella 10 7 The MFI value is 2523, 10 2 168 at 9:10; Streptococcus 10 7 The MFI value is 3095, 10 1 172; Enterobacter sakazakii 10 7 When the MFI value is 290, 10 2 69; Listeria monocytogenes 10 7 When the MFI value is 1201, 10 2 124 at 9:10; Vibrio cholerae 7 The MFI value is 13783, 10 1 The time is 8253,10 3 -10 5 The MFI values ​​of Bacillus anthracis 10 7 The MFI value is 567, 10 2 49 at 9:10; Campylobacter 7 The MFI value is 11504, 10 1 The time is 9030, 10 4 -10 5 The MFI values ​​of Aspergillus flavus 107 When the MFI value is 500, 10 2 46 at 9:46; pathogenic Escherichia coli 10 7 The MFI value is 5741, 10 1 Among them, Shigella, Brucella, Mycobacterium tuberculosis, Streptococcus, Staphylococcus aureus, pathogenic Escherichia coli, Campylobacter and Vibrio cholerae were 1175 in 10 1 The MFI values ​​of the other 2 The MFI values ​​of the positive control were all greater than those of the negative control. The highest detection sensitivity was for Vibrio cholerae, and the lowest was for Enterobacter sakazakii.

[0108] Based on the above, it can be seen that when the detection method of the present invention is used, the minimum detection limit of Shigella, Brucella, Mycobacterium tuberculosis, Streptococcus, Staphylococcus aureus, pathogenic Escherichia coli, Campylobacter and Vibrio cholerae is 10 1 The remaining minimum detection limits are all 10 2 .

[0109] (II) Real-time fluorescence PCR detection of susceptibility of 16 pathogenic strains

[0110] Each positive plasmid obtained in Example 1 was diluted 10 times (10 8 , 10 7 , 10 6 , 10 5 , 10 4 , 10 3 , 10 2 , 10 1 ), using different concentrations of positive plasmids as templates, real-time fluorescence PCR amplification was performed for sensitivity testing (real-time fluorescence PCR was judged to be positive based on a ct value greater than 35 for negative, 30-35 for uncertainty, and less than 30 for positive).

[0111] The multiplex real-time fluorescence PCR reaction program for Salmonella, Enterobacter sakazakii, Bacillus cereus and Listeria monocytogenes was as follows: 95°C pre-denaturation for 5 min, 95°C denaturation for 15 s, 52°C annealing for 50 s, 72°C extension for 15 s, and 40 cycles. The reaction system was as follows: 2X Pro TaqHS Probe PremixⅢ10 μL, 0.5 μL each of the specific upstream primers, modified specific downstream primers and modified probes for Salmonella, Bacillus cereus and Listeria monocytogenes, 0.7 μL each of the specific upstream primers, modified specific downstream primers and modified probes for Enterobacter sakazakii, 1 μL of template, and water was added to make up to 20 μL.

[0112] The multiplex real-time fluorescence PCR reaction program for Clostridium perfringens, Campylobacter, Shigella, and Staphylococcus aureus was: 95°C pre-denaturation for 5 min, 95°C denaturation for 15 s, 52°C annealing for 50 s, 72°C extension for 15 s, and 40 cycles. The reaction system was: 2X ProTaqHS Probe PremixⅢ10 μL, 0.5 μL each of the specific upstream primer, modified specific downstream primer, and modified probe for each bacterium, 1 μL of template, and water was added to 20 μL.

[0113] The multiplex real-time fluorescence PCR program for Streptococcus, pathogenic Escherichia coli, Clostridium botulinum, and Aspergillus flavus was as follows: 95°C pre-denaturation for 5 min, 95°C denaturation for 15 s, 54°C annealing for 50 s, 72°C extension for 30 s, and 40 cycles. The reaction system was as follows: 2X ProTaqHS Probe PremixⅢ10 μL, 0.5 μL each of the specific upstream primer, modified specific downstream primer, and modified probe for each bacterium, 1 μL of template, and water was added to make up to 20 μL.

[0114] The multiplex real-time fluorescence PCR program for Mycobacterium tuberculosis, Brucella, Bacillus anthracis, and Vibrio cholerae was: 95°C pre-denaturation for 5 min, 95°C denaturation for 15 s, 54°C annealing for 50 s, 72°C extension for 30 s, and 40 cycles. The reaction system was: 2X ProTaqHS Probe PremixⅢ10 μL, 0.5 μL each of the specific upstream primers, modified specific downstream primers, and modified probes for Brucella and Vibrio cholerae, 0.6 μL each of the specific upstream primers, modified specific downstream primers, and modified probes for Mycobacterium tuberculosis, 0.4 μL each of the specific upstream primers, modified specific downstream primers, and modified probes for Bacillus anthracis, 1 μL of template, and water was added to 20 μL.

[0115] The results are shown in Figure 3. The minimum detection limit of Brucella is 10 2 The minimum detection limits of other strains were all below 10 3 -10 5 . (Note: hlya is Listeria monocytogenes, ompa is Enterobacter sakazakii, cytk is Bacillus cereus, inva is Salmonella, vir is Shigella, nuc is Staphylococcus aureus, cpa is Clostridium perfringens, cdtb is Campylobacter, gapc is Streptococcus, escv is pathogenic Escherichia coli, toxina is Clostridium botulinum, ist1 is Aspergillus flavus, mpt64 is Mycobacterium tuberculosis, pag is Bacillus anthracis, bp26 is Brucella, and ampw is Vibrio cholerae).

[0116] In summary, it can be seen that the detection method of the present invention has a higher sensitivity for detecting 16 pathogenic strains.

[0117] It can be seen from the above embodiments and test examples that the detection method of the present invention, which designs specific primers and probes for 16 pathogenic strain sequences and distinguishes pathogenic strains based on liquid phase chip technology, can detect 16 pathogenic strains at the same time, quickly lock the infected pathogens, requires a small amount of sample, has high sensitivity and strong specificity.

[0118] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Use of a specific upstream primer, a specific downstream primer and a probe in preparing a kit for simultaneously detecting 16 pathogenic microorganisms in raw milk using a liquid phase chip, characterized in that: The steps include: (1) Design specific upstream primers, specific downstream primers and probes for Shigella, Bacillus anthracis, Salmonella, Clostridium botulinum, Streptococcus, Bacillus cereus, Staphylococcus aureus, Mycobacterium tuberculosis, Vibrio cholerae, Aspergillus flavus, Listeria monocytogenes, pathogenic Escherichia coli, Brucella, Enterobacter sakazakii, Clostridium perfringens and Campylobacter, respectively, and then modify the obtained specific downstream primers and probes by adding biotin to the 5' end of the specific downstream primer and adding NH2-C to the 5' end of the probe. 12 ; (2) taking the DNA sequence of the sample to be tested as a template, and using the corresponding specific upstream primers and the modified specific downstream primers to simultaneously perform multiple PCR amplification to obtain multiple PCR products; (3) coupling the modified probe in step (1) with the microspheres at a volume ratio of (1-5):50 to obtain a liquid chip working solution; (4) The multiplex PCR products were mixed with the liquid chip working solution in a volume ratio of (3-6):16, hybridized, and then incubated with SAPE. TM The instrument reads the median MFI value of the microsphere fluorescence code and the reporter molecule fluorescence; the number of each fluorescently labeled microsphere involved in the counting is ≥100, and the MFI value of the negative control of each fluorescently labeled microsphere is <100; the result is determined based on the reading: when the MFI value of the sample is greater than the MFI value of the negative control, the result is judged as positive, and when the MFI value of the sample is less than the MFI value of the negative control, the result is judged as negative; The specific upstream primer, specific downstream primer and probe sequences are as follows: The specific upstream primer sequence of Shigella is shown in SEQ ID NO.1, the specific downstream primer sequence of Shigella is shown in SEQ ID NO.2, and the probe sequence of Shigella is shown in SEQ ID NO.3; The specific upstream primer sequence of Bacillus anthracis is shown in SEQ ID NO.4, the specific downstream primer sequence of Bacillus anthracis is shown in SEQ ID NO.5, and the probe sequence of Bacillus anthracis is shown in SEQ ID NO.6; The specific upstream primer sequence of Salmonella is shown in SEQ ID NO.7, the specific downstream primer sequence of Salmonella is shown in SEQ ID NO.8, and the probe sequence of Salmonella is shown in SEQ ID NO.9; The specific upstream primer sequence of Clostridium botulinum is shown in SEQ ID NO.10, the specific downstream primer sequence of Clostridium botulinum is shown in SEQ ID NO.11, and the probe sequence of Clostridium botulinum is shown in SEQ ID NO.12; The specific upstream primer sequence of the streptococcus is shown in SEQ ID NO.13, the specific downstream primer sequence of the streptococcus is shown in SEQ ID NO.14, and the probe sequence of the streptococcus is shown in SEQ ID NO.15; The specific upstream primer sequence of the Bacillus cereus is shown in SEQ ID NO.16, the specific downstream primer sequence of the Bacillus cereus is shown in SEQ ID NO.17, and the probe sequence of the Bacillus cereus is shown in SEQ ID NO.18; The specific upstream primer sequence of Staphylococcus aureus is shown in SEQ ID NO.19, the specific downstream primer sequence of Staphylococcus aureus is shown in SEQ ID NO.20, and the probe sequence of Staphylococcus aureus is shown in SEQ ID NO.21; The specific upstream primer sequence of Mycobacterium tuberculosis is shown in SEQ ID NO.22, the specific downstream primer sequence of Mycobacterium tuberculosis is shown in SEQ ID NO.23, and the probe sequence of Mycobacterium tuberculosis is shown in SEQ ID NO.24; The specific upstream primer sequence of Vibrio cholerae is shown in SEQ ID NO.25, the specific downstream primer sequence of Vibrio cholerae is shown in SEQ ID NO.26, and the probe sequence of Vibrio cholerae is shown in SEQ ID NO.27; The specific upstream primer sequence of Aspergillus flavus is shown in SEQ ID NO.28, the specific downstream primer sequence of Aspergillus flavus is shown in SEQ ID NO.29, and the probe sequence of Aspergillus flavus is shown in SEQ ID NO.30; The specific upstream primer sequence of Listeria monocytogenes is shown in SEQ ID NO.31, the specific downstream primer sequence of Listeria monocytogenes is shown in SEQ ID NO.32, and the probe sequence of Listeria monocytogenes is shown in SEQ ID NO.33; The specific upstream primer sequence of the pathogenic Escherichia coli is shown in SEQ ID NO.34, the specific downstream primer sequence of the pathogenic Escherichia coli is shown in SEQ ID NO.35, and the probe sequence of the pathogenic Escherichia coli is shown in SEQ ID NO.36; The specific upstream primer sequence of the Brucella is shown in SEQ ID NO.37, the specific downstream primer sequence of the Brucella is shown in SEQ ID NO.38, and the probe sequence of the Brucella is shown in SEQ ID NO.39; The specific upstream primer sequence of Enterobacter sakazakii is shown in SEQ ID NO.40, the specific downstream primer sequence of Enterobacter sakazakii is shown in SEQ ID NO.41, and the probe sequence of Enterobacter sakazakii is shown in SEQ ID NO.42; The specific upstream primer sequence of Clostridium perfringens is shown in SEQ ID NO.43, the specific downstream primer sequence of Clostridium perfringens is shown in SEQ ID NO.44, and the probe sequence of Clostridium perfringens is shown in SEQ ID NO.45; The specific upstream primer sequence of Campylobacter is shown in SEQ ID NO.46, the specific downstream primer sequence of Campylobacter is shown in SEQ ID NO.47, and the probe sequence of Campylobacter is shown in SEQ ID NO.

48.

2. The use according to claim 1, characterized in that: The total system of the multiplex PCR amplification in step (2) is 50 μL, including 25 μL of multiplex PCR Mix, 0.4 μL of each bacteria's specific upstream primer, 0.4 μL of each bacteria's modified specific downstream primer, 2 μL of template DNA, and then ddH2O is added to 50 μL.

3. A kit for simultaneously detecting 16 pathogenic microorganisms in raw milk, characterized in that: The method comprises the specific upstream primers, specific downstream primers, probes and microspheres for 16 different strain sequences as described in claim 1.

4. The kit according to claim 3, characterized in that It also includes multiplex PCR Mix, MES solution, EDC solution, Tween 20 solution, SDS solution, TE solution and SAPE reporter solution.

Images