Application of Kale BoabHLH137 Gene in Regulating Plant Growth and Development and Carotenoid Content

Abstract

The present invention relates to the field of gene editing and breeding, and in particular to the application of the kale BoabHLH137 gene in regulating plant growth and development and carotenoid content. The present invention can increase the size of kale flower organs and seeds or increase the carotenoid content in kale by changing the expression of the BoabHLH137 gene. In the specific embodiment of the present invention, the size of the flower organs and seeds of the BoabHLH137 overexpressing plant obtained by genetic engineering is significantly increased, and the carotenoid content in the tissue and plant in which the gene is knocked out is increased. It can be seen that changing the expression amount of the BoabHLH137 gene can effectively increase the size of kale flower organs and seeds and increase the carotenoid content in the kale plant. It can be seen that the gene has application prospects in cultivating and improving high-quality kale varieties.

Description

Technical Field

[0001] The present invention relates to the field of gene editing and breeding, and in particular to the application of the kale BoabHLH137 gene in regulating plant growth and development and carotenoid content. Background Art

[0002] The Brassicaceae Burnett family is a large family of plants that include a variety of annual, biennial or perennial plants. This plant family includes about 338 genera and nearly 4,000 species. Crucifers are widely distributed throughout the world, especially in temperate regions. Distinctive features of the Brassicaceae family include their flowers, which usually have four petals and four sepals arranged in a cross shape, which is also the origin of the family name. This group of plants is not only rich in biodiversity, but also has important economic value. Many crucifers, such as cabbage, mustard, rapeseed and radish, are important leaf vegetables or crops harvested for seeds. In addition, there are many ornamental plants in the Brassicaceae family.

[0003] Carotenoids are widely distributed fat-soluble pigments and are important coloring factors in plants. They are more abundant in yellow-orange fruits, but in fact, green leafy vegetables also have a high content of carotenoids, but they are masked by the green color of chlorophyll, which leads to the fact that their high carotenoid content is often overlooked. Carotenoids play an important role in protecting vision, anti-oxidation, anti-aging, anti-cancer and defense against cardiovascular and cerebrovascular diseases. Since humans cannot directly synthesize carotenoids, vegetables have become the main source of dietary carotenoids. At the same time, carotenoids are also widely used in the cosmetics and pharmaceutical industries.

[0004] However, a method for regulating the size of seeds and flowers and the content of carotenoids has not been found so far. The present invention intends to regulate the size of plant seeds and flowers and the content of carotenoids by changing the expression of the BoabHLH137 gene, which has important reference significance for improving the ornamental value of flower organs of cruciferous plants, increasing seed yield or cultivating high carotenoid content. Summary of the invention

[0005] The purpose of the present invention is to provide an application of the BoabHLH137 gene of kale in regulating plant growth and development and carotenoid content to solve the problems existing in the above-mentioned prior art. The present invention regulates the size of plant seeds and flowers and the content of carotenoids by changing the expression of the BoabHLH137 gene, which has important reference significance for improving the ornamental value of flower organs of cruciferous plants, increasing seed yield or cultivating high carotenoid content.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides the use of BoabHLH137 gene, biological materials containing BoabHLH137 gene or proteins encoded by BoabHLH137 gene in regulating the content of carotenoids in plants. The nucleotide sequence of the BoabHLH137 gene is shown in SEQ ID NO.1; the amino acid sequence of the protein encoded by the BoabHLH137 gene is shown in SEQ ID NO.2.

[0008] Preferably, the plant comprises a plant of the family Cruciferae.

[0009] Further preferably, the cruciferous plants include mustard, cabbage and kale, but are not limited to mustard, cabbage and kale.

[0010] Further preferably, the biological material includes a recombinant vector or a recombinant bacterium.

[0011] The present invention provides a method for increasing the carotenoid content in a plant, which includes overexpressing a BoabHLH137 gene in a plant to increase the carotenoid content in the plant; the nucleotide sequence of the BoabHLH137 gene is shown in SEQ ID NO.1.

[0012] Preferably, the plant comprises a plant of the family Cruciferae.

[0013] Further preferably, the cruciferous plants include mustard, cabbage and kale, but are not limited to mustard, cabbage and kale.

[0014] Further preferably, the biological material includes a recombinant vector or a recombinant bacterium.

[0015] The present invention provides the use of the BoabHLH137 gene, a biological material containing the BoabHLH137 gene or a protein encoded by the BoabHLH137 gene in cultivating transgenic plants with high carotenoid content and / or improving transgenic plants. The nucleotide sequence of the BoabHLH137 gene is shown in SEQ ID NO.1; the amino acid sequence of the protein encoded by the BoabHLH137 gene is shown in SEQ ID NO.2.

[0016] Preferably, the plant comprises a plant of the family Cruciferae.

[0017] Further preferably, the cruciferous plants include mustard, cabbage and kale, but are not limited to mustard, cabbage and kale.

[0018] Further preferably, the biological material includes a recombinant vector or a recombinant bacterium.

[0019] The present invention provides the use of BoabHLH137 gene, biological materials containing BoabHLH137 gene or proteins encoded by BoabHLH137 gene in regulating the size of floral organs and seeds of plants. The nucleotide sequence of the BoabHLH137 gene is shown in SEQ ID NO.1; the amino acid sequence of the protein encoded by the BoabHLH137 gene is shown in SEQ ID NO.2.

[0020] Preferably, the plant comprises a plant of the family Cruciferae.

[0021] Further preferably, the cruciferous plants include mustard, cabbage and kale, but are not limited to mustard, cabbage and kale.

[0022] Further preferably, the biological material includes a recombinant vector or a recombinant bacterium.

[0023] The present invention provides a method for promoting the enlargement of floral organs and seeds, which inhibits the expression of BoabHLH137 gene in plants and increases the size of floral organs and seeds of the plants; the nucleotide sequence of the BoabHLH137 gene is shown in SEQ ID NO.1.

[0024] More preferably, the plant comprises a cruciferous plant.

[0025] Further preferably, the cruciferous plants include mustard, cabbage and kale, but are not limited to mustard, cabbage and kale.

[0026] Further preferably, the biological material includes a recombinant vector or a recombinant bacterium.

[0027] The present invention provides the use of BoabHLH137 gene, biological materials containing BoabHLH137 gene or proteins encoded by BoabHLH137 gene in cultivating transgenic plants with enlarged floral organs and seeds and / or improving transgenic plants. The nucleotide sequence of the BoabHLH137 gene is shown in SEQ ID NO.1; the amino acid sequence of the protein encoded by the BoabHLH137 gene is shown in SEQ ID NO.2.

[0028] More preferably, the plant comprises a cruciferous plant.

[0029] Further preferably, the cruciferous plants include mustard, cabbage and kale, but are not limited to mustard, cabbage and kale.

[0030] Further preferably, the biological material includes a recombinant vector or a recombinant bacterium.

[0031] The present invention discloses the following technical effects:

[0032] The present invention provides the application of BoabHLH137 gene in controlling the size of flower organs and seeds of plants and the content of carotenoids in the body, wherein the BoabHLH137 gene is cloned from the wild type kale 'Four Seasons Thick Strips' by using PCR amplification technology, and changing the expression of BoabHLH137 gene can increase the size of flower organs and seeds of kale or increase the content of carotenoids in kale. In the specific embodiment of the present invention, the size of flower organs and seeds of BoabHLH137 overexpressing plants obtained by genetic engineering is significantly increased, and the content of carotenoids in tissues and plants is increased compared with that in tissues and plants in which the gene is knocked out. It can be seen that changing the expression of BoabHLH137 gene can effectively increase the size of flower organs and seeds of kale, and increase the content of carotenoids in kale plants. The gene has application prospects in cultivating and improving high-quality kale varieties; at the same time, it has important reference significance for improving the ornamental value of flower organs of cruciferous plants and increasing seed yield or cultivating high carotenoid content. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0034] Figure 1 The phenotypes of floral organs (A) and seeds (B) of WT plants and BoabHLH137-OE plants, as well as the weight analysis of every 20 seeds (C); OE-8-1, OE-13-2 and OE-25-1 are kale materials overexpressing BoabHLH137, and WT is the wild-type kale material;

[0035] Figure 2 The figure shows the phenotype of WT callus and bhlh137 callus (A) and the analysis result of lutein content in callus (B); WT is the wild-type kale material, and bhlh137 is the callus of BoabHLH137 knockout;

[0036] Figure 3 The figure shows the results of phenotypic and gene quantitative analysis of WT plants and bhlh137 plants, where A is the phenotype of WT plants and bhlh137 plants, BF are neoxanthin, violaxanthin, lutein, β-carotene and total carotenoids respectively; WT is the wild-type kale material, and bhlh137 is the kale plant with BoabHLH137 knocked out;

[0037] Figure 4The results of gene quantitative analysis in WT plants and bhlh137 plants; AF are the relative expression levels of PYS1, PYS2, PDS1, VDE, ZEP2 and LCYb; WT is the wild-type kale material, and bhlh137 is the kale plant with BoabHLH137 knocked out;

[0038] Figure 5 The results of gene quantitative analysis in WT plants and bhlh137 plants; AD is the relative expression level of CRTISO, ZISO, LCYe1 and NXS; WT is the wild-type kale material, and bhlh137 is the kale plant with BoabHLH137 knocked out. DETAILED DESCRIPTION

[0039] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0040] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0041] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0042] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0043] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0044] Example 1: Kale BoabHLH137 gene and its application in the growth and development of Kale plants

[0045] 1. Test methods

[0046] 1. Extraction of total RNA from Chinese kale and synthesis of cDNA

[0047] Total RNA was extracted from mature leaves of wild-type kale 'Si Ji Cu Tiao' using an RNA extraction kit, and the extracted total RNA was reverse transcribed into cDNA using a reverse transcription kit.

[0048] 2. Cloning of the BoabHLH137 gene from Kale

[0049] The nucleotide sequence of the BoabHLH137 gene is shown in SEQ ID NO.1, specifically: ATGGCATCTTTCTCTTATTTCCAACATTACCCTCATTCTCTTCTTGATCCTCTTCTCTTTTCCTCACCCAACTCCTCAACTAAGCTCTCTGGTTTCATCGACCAGAACCCTCTCTATCCACCACCAAACATTTCTACAATAGTAGATACTTCCTTGAACCCATTTCTTGATTCATTTAATGTTGAGAAAACCGAAAGCTCTGATGTTAAGAAACATATCAACACTAATGCAACTGCAGCACTCACAAGCGACCAGCTCAGCCCCGGACCATCCGCAGGAAAAAAACAACGGAGGAAGACCAGAAATGGGTCTAAGTCCAAGGAAGGAGTAGAGGGAAGAAAAAGCAAAAAGCCAAGAAATGGTAGCTCAAGCGACGTAAAAGAGAAGAGAGCGAACGAACAAGAGCCTCCCAAAGATTACATTCACGTTAGAGCTAGAAGAGGCCAAGCTACTGATAGCCACAGCCTCGCCGAGAGGGCGAGAAGGGAAAAGATAAGTGAACGGATGAGGACTCTGCAAAACCTTGTCCCAGGATGTGATAAGGTAACAGGGAAGGCCCTCATGTTGGATGAGATTATAAATTATGTGCAGTCCTTGCAGAATCAAGTTGAGTTTCTCTCGATGAAGCTAGCTTCCATAAGTCCAGTGGTCTATGACTTCGGTTCGGACCTTGATGGCATCATAGTTAGACCCGAGATAGGATCCGCAGACGTTGGAACGTCGTTTGCTAATGCAATGCCAACAACTACTACTAACTTTTCTTCACTATTGGATGATTCCATAATACCCGCAGAGGCACATCTTCAGGAAGATGGAGGGGAAAGGGAGAAGATTGTAGACAGAAGTGGGTTCAACAATAACAGCTTTTGTTCTTTCTCTTAA。

[0050] The amino acid sequence of the protein encoded by the BoabHLH137 gene is shown in SEQ ID NO.2, specifically: MASFSYFQHYPHSLLDPLLFSSPNSSTKLSGFIDQNPLYPPPNISTIVDTSLNPFLDSFNVEKTESSDVKKHINTNATAALTSDQLSPGPSAGKKQRRKTRNGSKSKEGVEGRKSKKPRNGSSSDVKEKRANEQEPPKDYIHVRARRGQATDSHSLAERARREKISERMRTLQNLVPGCDKVTGKALMLDEIINYVQSLQNQVEFLSMKLASISPVVYDFGSDLDGIIVRPEIGSADVGTSFANAMPTTTTNFSSLLDDSIIPAEAHLQEDGGEREKIVDRSGFNNNSFCSFS.

[0051] Specific primers for BoabHLH137 gene cloning were designed according to the nucleotide sequence of BoabHLH137 gene:

[0052] Forward primer: 5'-ATGGCATCTTTCTCTTATTTCCAAC-3' (SEQ ID NO. 3); reverse primer: 5'-TTAAGAGAAAGAACAAAAGCTGTTATTG-3' (SEQ ID NO. 4).

[0053] The cDNA of 'Four Seasons Thick Strip' was used as template for amplification. The PCR reaction conditions were: 98℃ pre-denaturation for 30s; 98℃ denaturation for 10s, 57℃ annealing for 5s, 72℃ extension for 5s, 34 cycles in total; 72℃ extension for 1min. The PCR product was subjected to 1.0% mass volume fraction agarose gel electrophoresis to recover the target band, ligated to pClone007 vector (Beijing Qingke Biotechnology Co., Ltd.) and transformed into Escherichia coli DH5α, the plasmid was extracted, and after PCR identification, it was entrusted to Beijing Qingke Biotechnology Co., Ltd. for sequencing.

[0054] 3. Construction of recombinant expression vector of BoabHLH137 gene

[0055] (1) First, the pGWB5 linearized vector was obtained by double digestion with Xho I and Sal II (Thermo Fisher Scientific (China) Co., Ltd.), and then purified and recovered;

[0056] (2) Using CE Design V1.04, a homologous recombination primer pair of the BoabHLH137 gene was designed (the nucleotide sequence of the upstream primer is shown in SEQ ID NO.5, specifically 5'-tcactatggcggcccctcgagATGGCATCTTTCTCTTATTTCCAAC-3', and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.6, specifically 5'-tatccagtcactatggtcgacTTAAGAGAAAGAACAAAAGCTGTTATTG-3'). The target fragment of the BoabHLH137 gene was amplified and recovered using the primer pair with homology arms (the method is the same as step 1). The target fragment DNA and the linearized vector pGWB5 were recombined using a homologous recombination kit (Nanjing Novogene Biotech Co., Ltd.), and 5 μL of the reaction solution was added to 50 μL of DH5a competent cells. The mixture was gently mixed with a pipette, incubated on ice for 30 min, heat-shocked in a 42°C water bath for 45 s, and then quickly cooled on ice for 2 min.

[0057] (3) Add 700 μL LB liquid medium, incubate at 37°C for 1 h, then centrifuge at 5000 rpm for 1 min to collect the cells, discard part of the supernatant, resuspend the cells with the remaining medium, spread on LB solid medium containing Kan antibiotic (concentration 50 μg / mL), and culture inverted in a 37°C incubator for 20 h;

[0058] (4) Several clones on the recombination reaction transformation plate were selected for colony PCR identification. The positive colonies were selected and cultured in a liquid LB medium containing Kan antibiotics (concentration 50 μg / mL) in an incubator at 37°C and 200 rpm overnight. The bacterial solution was entrusted to Beijing Qingke Biotechnology Co., Ltd. for sequencing to identify the accuracy of the vector. The colony containing the correct sequence was selected to extract the plasmid, and the vector pGWB5-BoabHLH137 was obtained.

[0059] 4. Transform the recombinant vector into Agrobacterium GV3101

[0060] (1) Add 0.5 μg of the recombinant vector pGWB5-BoabHLH137 to every 50 μL of GV3101 Agrobacterium competent cells, stir the bottom of the tube by hand to mix, and place on ice for 5 min, in liquid nitrogen for 5 min, in a 37°C water bath for 5 min, and in an ice bath for 5 min. Then add 700 μL of LB liquid medium without antibiotics and culture at 28°C with shaking for 2 h;

[0061] (2) Collect the cells by centrifugation at 6000 rpm for 1 min, and keep about 100 μL of the supernatant. Gently blow to resuspend the cells and evenly spread them on LB solid medium containing Kan and Rif (the concentration of Kan is 50 μg / mL, and the concentration of Rif is 20 μg / mL). Incubate the culture medium upside down at 28°C for 2 days, pick several positive clones, and verify the results by colony PCR. The positive clones that are correctly verified are recombinant Agrobacterium GV3101.

[0062] 5. Explant culture of Chinese kale

[0063] Sterile kale seeds were sown on 1 / 2MS solid culture medium and cultured in a tissue culture room. The conditions in the tissue culture room were: temperature 25 / 20°C (day / night), photoperiod 16 / 8h (day / night), and light intensity 36μmol·m -2 ·S -1 After 7 days of culture, kale cotyledons with 1-2 mm petioles were cut and used as explants for Agrobacterium-mediated transformation.

[0064] 6. Genetic transformation of Chinese kale

[0065] (1) Explants were pre-cultured in MS medium for 3 days with a photoperiod of 16 h light / 8 h dark and a light intensity of 80 μmol·m -2 ·S -1 ;

[0066] (2) Infect with Agrobacterium strain GV3101 into which the recombinant vector has been transferred for 1-2 minutes;

[0067] (3) The explants were co-cultured with Agrobacterium in MS medium for 3 days under dark conditions;

[0068] (4) The explants were transferred to delayed selection medium (0.03 mg / L NAA + 0.75 mg / L 6-BA + 0.8% agar + 325 mg / L Carb + 325 mg / L Timentin) and grown for 7 days;

[0069] (5) The explants were transferred to a resistance screening medium containing selective antibiotics (0.03 mg / L NAA + 0.75 mg / L 6-BA + 0.8% agar + 325 mg / L Carb + 325 mg / L Timentin + 12 mg / L Hyg) for resistance screening. The explants were subcultured every 20 days. During subculture, the subculture medium used was the same as the resistance screening medium containing selective antibiotics.

[0070] (6) After the explants grew for 3 months, hygromycin-resistant plants were obtained and then transplanted into a matrix composed of nutrient soil, perlite, and vermiculite in a volume ratio of 3:1:1. The explants were placed under a light intensity of 80 μmol·m -2 ·S -1 , cultured in an artificial climate box with a temperature of 25 / 20°C (day / night), a photoperiod of 12 / 12h (day / night), and a relative humidity of 75%.

[0071] 7. Positive plant screening

[0072] Specific primers Hyg-F and Hyg-R (SEQ ID NO.7 and SEQ ID NO.8, see Table 1 for details) were designed according to the hygromycin sequence contained in the vector, and PCR amplification was performed using the genomic DNA of each transgenic plant as a template. After detection by agarose gel electrophoresis, transgenic positive plants were screened and kept as seeds to obtain the T1 generation of kale overexpressing the BoabHLH137 gene (OE-8-1, OE-13-2 and OE-25-1).

[0073] Table 1 Detailed information of primers

[0074] name sequence SEQ ID NO. Hyg-F CGATTGCGTCGCATCGACC 7 Hyg-R TTCTACAACCGGTCGCGGAG 8

[0075] 8. Phenotypic observation

[0076] (1) Wild-type kale (WT) and BoabHLH137-overexpressing kale T1 generation (BoabHLH137-OE) seeds were sown simultaneously in a matrix composed of nutrient soil, perlite, and vermiculite in a volume ratio of 3:1:1. The seeds were grown under a light intensity of 80 μmol·m -2 ·S -1 , cultured in an artificial climate chamber with a temperature of 25 / 20°C (day / night), a photoperiod of 12 / 12h (day / night), and a relative humidity of 75%;

[0077] (2) The biological morphology of floral organs and dry seeds of WT plants and BoabHLH137 overexpressing kale T1 plants was observed and statistically analyzed. Figure 1As shown. Compared with the wild type, the floral organs of the transgenic lines were significantly enlarged. The diagonal diameter of the floral organs of the wild type plants was about 3 cm. The floral organ phenotype of the OE-13-2 plants was more different, with a diagonal diameter of about 4.5 cm, followed by the diagonal diameter of the floral organs of the OE-25-1 plants, which was about 4 cm, and the diagonal diameter of the floral organs of the OE-8-1 plants, which was about 3.5 cm. In terms of the seed size of the plants, the diameter of 20 seeds of the WT plants was about 3.8 cm, the diameter of 20 seeds of the OE-8-1 plants was about 4.3 cm, the diameter of 20 seeds of the OE-13-2 plants was about 4.4 cm, and the diameter of 20 seeds of the OE-25-1 plants was about 4.5 cm, which were about 1.13 times, 1.15 times, and 1.18 times that of the WT plants, respectively. Judging from the dry seed weight of the plants, the seed weight of the T1 generation of kale plants overexpressing the BoabHLH137 gene increased significantly. The average weight of 20 seeds of WT plants, OE-8-1 plants, OE-13-2 plants and OE-25-1 plants were approximately 0.046g, 0.056g, 0.054g and 0.053g, respectively. The average weight of 20 seeds of OE-8-1 plants had a large difference, which was approximately 122% of the wild type weight. The seed weights of OE-13-2 plants and OE-25-1 plants were approximately 117% and 115% of the wild type, respectively.

[0078] The above results show that overexpression of the BoabHLH137 gene in kale can significantly increase the size of the plant's floral organs and seeds.

[0079] Example 2: Kale BoabHLH137 gene and its application in regulating carotenoid content in Kale callus

[0080] 1. Test methods

[0081] 1. Construction of entry vector for bHLH137 gene knockout vector

[0082] (1) Target primer design The target was designed based on the bHLH137 gene obtained by sequencing, and the efficiency prediction and evaluation were performed to select the optimal target 4, with the sequence of AACAGGGAAGGCCCTCATGT (SEQ ID NO. 9);

[0083] (2) Dissolve the target primers in water to a 10 μM stock solution, take 10 μL of each and add them to 80 μL 0.5×TE (pH 8.0), with a final concentration of 1 μM; heat the water to boiling, turn off the heater power, put the EP tube containing the target primers into the hot water, take it out after 30 seconds, and cool it naturally to room temperature. Alternatively, heat it at 98°C for 3 minutes in a PCR instrument, take out the PCR tube immediately, cool it naturally to room temperature, and use it for connection;

[0084] (3) Take 1 μg of AtU6-26-sgRNA-SK plasmid and digest it with 10U Bsa I-HF at 37℃ for 60min in a 50μL reaction. Use T4 ligation kit (Beijing Quanshijin Biotechnology Co., Ltd.) to connect the target primer and the digestion product. Transform 10μL of the ligation product into Escherichia coli DH5α and coat with Amp + LB plate, single clones were selected for colony PCR identification and sequencing after 12 hours. The correct clones were expanded and cultured, and plasmids were extracted. The obtained Target4-AtU6-26-sgRNA-SK vector plasmid was stored at -20℃.

[0085] 2. Construction of CRISPR-cas9 knockout vector for bHLH137 gene

[0086] (1) The obtained Target4-AtU6-26-sgRNA-SK vector plasmid was double-digested with Nhe I and Spe I, and the fragment with a size of about 642 bp was cut and recovered after electrophoresis to obtain the target fragment Target4-sgRNA cassette.

[0087] (2) The pCAMBIA1300-pYAO-CAS9 vector plasmid was digested with Spe I (Thermo Fisher Scientific (China) Co., Ltd.), and then purified and recovered using a magnetic bead micro-gel DNA recovery kit (Shanghai Sangon Biotechnology Co., Ltd.) to obtain its linearized vector;

[0088] (3) Using homologous recombination, the recovered target fragment Target4-sgRNA cassette was connected to the linearized PCAMBIA1300-PYAO-CAS9 vector and transformed into Escherichia coli DH5α; 700 μL LB liquid medium was added, incubated at 37°C for 1 hour, centrifuged at 5000 rpm for 1 minute to collect the cells, discarded part of the supernatant, and resuspended the cells with the remaining culture medium. A sterile coating rod was used to gently spread the cells on the LB solid culture medium containing Kan resistance (recombination reaction transformation plate), and inverted incubator at 37°C for 20 hours;

[0089] (4) Pick several clones on the recombination reaction transformation plate for colony PCR identification. Pick the positive colonies and culture them in liquid LB medium containing Kan antibiotics in an incubator at 37°C and 200 rpm overnight. Entrust Beijing Qingke Biotechnology Co., Ltd. to sequence the bacterial solution to identify the accuracy of the vector;

[0090] (5) Then, colony PCR was performed to identify positive colonies, and then the plasmid was extracted to obtain the knockout vector pYAO-Cas9-Target4, which was stored at -80°C;

[0091] (6) After successful identification, save the recombinant vector pYAO-Cas9-target4.

[0092] 3. Transform the recombinant vector into Agrobacterium EHA105:

[0093] (1) Add 0.5 μg of the recombinant vector pYAO-Cas9-target4 to every 50 μL of EHA105 Agrobacterium competent cells, stir the bottom of the tube by hand to mix, place on ice for 5 min, place in liquid nitrogen for 5 min, place in a 37°C water bath for 5 min, and place in an ice bath for 5 min, then add 700 μL of LB liquid medium without antibiotics and culture at 28°C with shaking for 2 h;

[0094] (2) Collect the cells by centrifugation at 6000 rpm for 1 min, and keep about 100 μL of the supernatant. Gently blow to resuspend the cells and evenly spread them on LB solid medium containing kan and rif (the concentration of kan in the medium is 50 μg / mL, and the concentration of rif is 20 μg / mL). Incubate the culture medium upside down at 28°C for 2 days, pick several positive clones, and verify the results by colony PCR. The positive clones that are correctly verified are recombinant Agrobacterium EHA105.

[0095] 4. Explant culture of Chinese kale

[0096] Sterile seeds were sown on 1 / 2MS solid medium and cultured in a tissue culture room. The conditions in the tissue culture room were: temperature 25 / 20°C (day / night), photoperiod 16 / 8h (day / night), and light intensity 36μmol·m -2 ·S -1 After 7 days of culture, 0.5-1.0 cm of kale hypocotyls were cut and placed as explants for Agrobacterium-mediated transformation.

[0097] 5. Genetic transformation of Chinese kale callus

[0098] (1) The explants were precultured in MS medium containing 2,4-D and 6-BA for 7 days, wherein the concentration of 2,4-D was 0.5 mg / L and the concentration of 6-BA was 2 mg / L;

[0099] (2) Infect with Agrobacterium strain EHA105 into which the recombinant vector has been transferred for 1-2 minutes;

[0100] (3) The explants were co-cultured with Agrobacterium for 3 days in MS medium containing 2,4-D, 6-BA, and AS (acetosyringone), wherein the concentration of 2,4-D was 0.5 mg / L, the concentration of 6-BA was 2 mg / L, and the concentration of AS was 0.2 mM;

[0101] (4) The explants were transferred to a screening medium (0.5 mg / L 2,4-D + 2 mg / L 6-BA + 0.8% agar + 200 mg / L Carb + 300 mg / L Timentin + 12 mg / L Hyg) and grown for 7 days to obtain bHLH137 gene knockout kale callus (bhlh137).

[0102] 6. Phenotypic observation

[0103] Wild-type Chinese kale callus (WT) and bHLH137 gene knockout Chinese kale callus (bhlh137) were placed under a NSZ-608T stereo microscope and photographed. Figure 2 As shown in A. The BoabHLH137 gene cloned from the present invention was knocked out in wild-type kale callus. The bhlh137 kale callus was yellow, while the uninfected wild-type kale callus was white.

[0104] 7. Pigment content analysis

[0105] (1) 200 mg of WT and bHLH137 knockout kale callus were taken, carotenoids were extracted with 25 mL of acetone, and then ultrasonically treated for 20 min. The carotenoids were centrifuged at 4000 × g for 5 min at room temperature. The supernatant was filtered with a 0.22 μm cellulose acetate filter and then analyzed by high performance liquid chromatography (HPLC);

[0106] (2) Chlorophyll and carotenoids were analyzed by HPLC using an Agilent 1260 instrument with a VWD detector at 30°C using isopropanol and 80% acetonitrile-water at a rate of 0.5 mL min -1 The flow rate is in Waters C 18 The sample (10 μL) was separated on a chromatographic column (150×3.9 mm inner diameter; particle size 3 μm), and the absorbance was detected at 448 nm and 428 nm.

[0107] HPLC analysis results showed that only lutein content was detected in callus tissue. After knocking out the bHLH137 gene in kale callus tissue, the lutein content increased significantly, about 1.8 times that of the wild type ( Figure 2 B).

[0108] Example 3 Application of the Kale BoabHLH137 gene to regulate carotenoid content in Kale plants

[0109] 1. Transform the recombinant vector into Agrobacterium EHA105

[0110] (1) The recombinant vector pYAO-Cas9-target4 in Example 2 was used for Agrobacterium transformation. 0.5 μg of the recombinant vector pYAO-Cas9-target4 was added to every 50 μL EHA105 Agrobacterium competent cells, and the tube bottom was stirred by hand to mix well. The tube was placed on ice for 5 min, placed in liquid nitrogen for 5 min, in a 37°C water bath for 5 min, and in an ice bath for 5 min, and then 700 μL of LB liquid medium without antibiotics was added, and the tube was shaken and cultured at 28°C for 2 h;

[0111] (2) Collect the cells by centrifugation at 6000 rpm for 1 min, and keep about 100 μL of the supernatant. Gently blow and resuspend the cells, and evenly spread them on LB solid medium containing kan and rif (the concentration of kan in the medium is 50 μg / mL, and the concentration of rif is 20 μg / mL). Invert and place in a 28°C incubator for 2 days. Pick several positive clones and use colony PCR to simply verify the results. The positive clones that are correctly verified are recombinant Agrobacterium EHA105.

[0112] 2. Explant culture of Chinese kale

[0113] Sterile kale seeds were sown on 1 / 2MS solid culture medium and cultured in a tissue culture room. The conditions in the tissue culture room were: temperature 25 / 20°C (day / night), photoperiod 16 / 8h (day / night), and light intensity 36μmol·m -2 ·S -1 After 7 days of culture, kale cotyledons with 1-2 mm petioles were cut and used as explants for Agrobacterium-mediated transformation.

[0114] 3. Genetic transformation of Chinese kale

[0115] (1) Explants were pre-cultured in MS medium for 3 days with a photoperiod of 16 h light / 8 h dark and a light intensity of 80 μmol·m -2 ·S -1 ;

[0116] (2) Infect with Agrobacterium strain GV3101 into which the recombinant vector has been transferred for 1-2 minutes;

[0117] (3) The explants were co-cultured with Agrobacterium in MS medium for 3 days under dark conditions;

[0118] (4) The explants were transferred to delayed selection medium (0.03 mg / L NAA + 0.75 mg / L 6-BA + 0.8% agar + 32 mg / L Carb + 325 mg / L Timentin) and grown for 7 days;

[0119] (5) The explants were transferred to a resistance screening medium (0.03 mg / L NAA + 0.75 mg / L 6-BA + 0.8% agar + 325 mg / L Carb + 325 mg / L Timentin + 12 mg / L Hyg) containing selective antibiotics for resistance screening. The explants were subcultured every 20 days. During subculture, the subculture medium used was the same as the resistance screening medium.

[0120] (6) After the explants grew for 3 months, hygromycin-resistant plants were obtained and then transplanted into a matrix composed of nutrient soil, perlite, and vermiculite in a volume ratio of 3:1:1. The explants were placed under a light intensity of 80 μmol·m -2 ·S -1 , cultured in an artificial climate box with a temperature of 25 / 20°C (day / night), a photoperiod of 12 / 12h (day / night), and a relative humidity of 75%.

[0121] 4. Positive plant screening

[0122] Specific primers Hyg-F and Hyg-R (SEQ ID NO.7 and SEQ ID NO.8, see Table 1 for details) were designed according to the hygromycin sequence contained in the vector, and PCR amplification was performed using the genomic DNA of each transgenic plant as a template. After agarose gel electrophoresis, a plant was screened out with a target sequence mutated from AACAGGGAAGGCCCTCATGT (SEQ ID NO.10) to AACAGGGAA A GGCCCTCATGT (SEQ ID NO. 11), an insertion of base A was detected at the target site. The plant was kept as a seed to obtain the bhlh137 gene knockout kale T1 generation.

[0123] 5. Phenotype and pigment content analysis

[0124] Wild-type kale plants (WT) and BoabHLH137 knockout plants (bhlh137) were photographed and sampled 30 days after sowing ( Figure 3 A) and perform pigment content analysis, the specific steps are:

[0125] (1) 200 mg of leaves from WT and bhlh137 kale plants were extracted with 25 mL of acetone, and the carotenoids were extracted. After ultrasonic treatment for 20 min, the leaves were centrifuged at 4000 × g for 5 min at room temperature, and the supernatant was filtered through a 0.22 μm cellulose acetate filter and analyzed by high performance liquid chromatography (HPLC);

[0126] (2) Chlorophyll and carotenoids were analyzed by HPLC using an Agilent 1260 instrument with a VWD detector at 30°C using isopropanol and 80% acetonitrile-water at a rate of 0.5 mL min-1 The flow rate is in Waters C 18 The sample (10 μL) was separated on a chromatographic column (150×3.9 mm inner diameter; particle size 3 μm), and the absorbance was detected at 448 nm and 428 nm.

[0127] HPLC analysis results showed that the carotenoid content in bhlh137 kale plants was higher than that in the wild type. The total carotenoid content in bhlh137 plants was about 1.18 times that of WT plants, among which the lutein content was about 1.11 times that of WT plants, the β-carotene content was about 1.23 times that of WT plants, and the violaxanthin content was about 1.27 times that of WT plants. The most obvious increase was in neoxanthin, which was about 1.31 times that of WT plants. Overall, knocking out the BoabHLH137 gene in kale increased the carotenoid content in the plants to varying degrees. ( Figure 3 BF in

[0128] 6. Gene expression analysis

[0129] (1) WT and bhlh137 kale leaves grown for 30 days were used as materials, immediately frozen with liquid nitrogen, and stored in a -80°C refrigerator;

[0130] (2) RNA and cDNA were obtained according to the method in “1. Extraction of total RNA from kale and synthesis of cDNA”;

[0131] (3) Ten genes of Chinese kale and the internal reference gene β-actin were selected to design expression detection primers. The specific sequences of the primers are shown in Table 2.

[0132] Table 2 Primer sequences

[0133]

[0134]

[0135] (3) Real-time quantitative PCR using TB Green Premix Ex Taq TM The expression of carotenoid biosynthesis genes in kale was detected according to the instructions of the II qPCR Kit (Tli RNaseH Plus, Takara);

[0136] (4) The formula for calculating the relative transcriptional expression level of the target gene is 2 -ΔΔCt , ΔΔCt=(Ct 目的基因 -Ct Actin ) treatment group-(Ct 目的基因 -Ct Actin )Control group.

[0137] The results of quantitative PCR showed that the expression of 10 carotenoid biosynthesis genes in bhlh137 kale plants was significantly higher than that in WT. After knocking out the BoabHLH137 gene in kale, the expression of CRTISO increased most significantly, about 1.4 times in bhlh137 plants compared with WT plants. The expression of PSY1, PSY2, and LCYe1 increased by about 1.3 times that of WT plants. The expression of ZISO increased the least, about 1.1 times in bhlh137 plants compared with WT plants ( Figure 4 and Figure 5 ).

[0138] The above-mentioned fluorescence quantitative expression and physiological index analysis results proved that knocking out the BoabHLH137 gene in kale can significantly increase the carotenoid content in the plant.

[0139] The above examples prove that the BoabHLH137 gene provided by the present invention can control the size of floral organs and seeds of plants and the content of carotenoids in the body. The floral organs and seed sizes of BoabHLH137 overexpressing plants obtained by genetic engineering are significantly increased, and the carotenoid content in tissues and plants knocked out of the gene is increased. It can be seen that the BoabHLH137 gene can effectively increase the size of floral organs and seeds of kale, and increase the content of carotenoids in kale plants. The gene has application prospects in cultivating and improving high-quality kale varieties.

[0140] The embodiments described above are only descriptions of the preferred embodiments of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A method for increasing the carotenoid content in kale, characterized in that: include: Inhibitory effect of BoabHLH137 The expression of the gene increases the content of carotenoids in the kale; BoabHLH137 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. BoabHLH137 The use of genes in increasing the size of kale flower organs and seeds is characterized in that: Said BoabHLH137 The nucleotide sequence of the gene is shown in SEQ ID NO.1; by overexpressing BoabHLH137 Genes that increase the size of floral organs and seeds in the plant.

3. BoabHLH137 The application of the gene in cultivating transgenic kale with enlarged flower organs and seeds is characterized in that: Said BoabHLH137 The nucleotide sequence of the gene is shown in SEQ ID NO.1; by overexpressing BoabHLH137 Genes that increase the size of floral organs and seeds in the plant.

Images