Specific marker, primer pair, detection method and application of DNA insertion variation in the intron region of ihrp gene of rockfish

Abstract

The present invention relates to the field of molecular biology, and further relates to a specific marker, primer pair, detection method and application of DNA insertion variation in the intron region of ihrp gene of spotted rockfish. The specific marker of insertion variation in the intron region of ihrp gene of spotted rockfish is a DNA fragment of non-insertion and insertion specific marker in the intron region of ihrp gene of spotted rockfish, and the nucleotide sequence of the DNA fragment is shown in SEQ ID NO:1 and SEQ ID NO:2. The present invention utilizes a pair of primers to amplify bands of 546bp and 419bp in individuals with DNA insertion variation, and only amplifies a band of 419bp in individuals without insertion variation. The detection method of the present invention significantly shortens the identification time, improves the detection efficiency, and has important application value in sex identification, preparation of Kaohsiung seedlings and family selection of spotted rockfish.

Description

Technical Field

[0001] The invention relates to the field of molecular biology, and further to a specific marker, a primer pair, a detection method and an application of DNA insertion variation in an intron region of an ihrp gene of a rockfish. Background Art

[0002] Spotted rock snapper ( Oplegnathus punctatus ) belongs to the family Oplegnathidae and the genus Oplegnathus. Oplegnathus ), mainly living in the tropical and subtropical waters of the western Pacific Ocean. The number of chromosomes of male spotted porgy is 2n=47, while the number of chromosomes of female is 2n=48, with males having one less chromosome than females. The chromosomes of male spotted porgy contain a particularly large chromosome, which indicates that they have a sex determination system of the X1X1X2X2 / X1X2Y type. Recent studies have found significant structural differences between the Y chromosome and the X1X2 homologous chromosomes of spotted porgy. In aquaculture practice, it has been observed that there are obvious differences in the growth rates of male and female spotted porgy, with males generally growing faster than females. Therefore, the development of genetic marker technology that can accurately distinguish the sex of spotted porgy, as well as the cultivation of high male ratio and all-male fry, is a key direction to promote the development of spotted porgy aquaculture and breeding work. In addition, the research and development of technology for rapid identification of the genetic sex of spotted porgy is of great significance for the preservation and utilization of high-quality male genetic resources of spotted porgy.

[0003] Insertion or deletion (indels) of gene introns has an important impact on the genetic information and function of organisms. Intron variation may affect gene expression, RNA splicing process and protein function, thus affecting the characteristics and health of organisms. Previous studies have found that the ihrp gene is highly conserved in structure, with a composition structure including 5 exons and 4 introns, and its amino acid sequence homology is very high. This gene is an important type of cell growth and differentiation regulatory gene, which plays an important role in regulating and maintaining cell cycle differentiation. So far, there has been no report on the genetic identification of male and female grouper sea bream based on the ihrp gene intron DNA insertion variation. Summary of the invention

[0004] The invention aims to overcome the shortcomings of the existing detection technology of intron DNA insertion variation of ihrp gene of rockfish, and provides a specific marker, primer pair, detection method, kit and application in male and female genetic sex identification of intron region insertion variation of ihrp gene of rockfish.

[0005] To achieve the above purpose, the present invention adopts the following technical solution:

[0006] A specific marker for insertion variation in the intron region of a rockfish gene. The specific marker for insertion variation in the intron region of the rockfish ihrp gene is a DNA fragment of a non-insertion and insertion specific marker in the intron region of the rockfish ihrp gene. The nucleotide sequences of the DNA fragments are shown in SEQ ID NO: 1 and SEQ ID NO: 2.

[0007] The bases shown in the nucleotide sequence SEQ ID NO:1 of the non-insertion and insertion specific marker of the DNA fragment in the intron region of the ihrp gene of the spotted rockfish are homologous fragments in the X1 chromosome of female and male spotted rockfish that have not undergone DNA insertion mutations in the intron region of the ihrp gene, which is a DNA characteristic marker shared by non-insertion and insertion individuals in the intron region of the ihrp gene of the spotted rockfish; and the sequence fragment (127bp) inserted between the 261st and 262nd sites of the base sequence shown in SEQ ID NO:1 is the base sequence shown in SEQ ID NO:2.

[0008] An application of a specific marker for insertion variation in an intron region of a gene of a spotted rockfish, and an application of the specific marker in identifying the genetic sex of male and female spotted rockfish.

[0009] A method for detecting insertion variation in the intron region of a gene of a grouper bream using the specific marker,

[0010] 1) PCR amplification: Take the grouper bream to be tested and extract genomic DNA; use the obtained genomic DNA as a template and specific primers for the intron region of the ihrp gene of the grouper bream to perform PCR amplification, and compare the obtained PCR amplification product with the specific marker;

[0011] 2) Result judgment: two DNA fragments of 419 bp and 546 bp are amplified from the genomic DNA of the tested rockfish, which means that the tested rockfish is an individual with a DNA fragment insertion mutation in the intron region of the ihrp gene; 419 bp is the base shown in SEQ ID NO: 1, and 546 bp is the base shown in SEQ ID NO: 2;

[0012] 3) Only a single DNA fragment of 419 bp was amplified from the genomic DNA of the tested rockfish, which means that the tested rockfish is an individual with no DNA fragment insertion mutation in the intron region of the ihrp gene of the rockfish; 419 bp is the base shown in SEQ ID NO: 1.

[0013] The specific primers in step 1) are:

[0014] Ch ihrp _F:1 : 5'- ACTGCTCAACAAAATCACGAC-3';

[0015] Ch ihrp _R:2:5'-GGACTAAGCACCAAAGCCCT-3'.

[0016] The rockfish is a rockfish with no DNA fragment insertion mutation in the intron region of the ihrp gene, and the individual is a female X1X1X2X2;

[0017] The spotted rock bream has a DNA fragment insertion mutation in the intron region of the ihrp gene, and the individual is a male fish X1X2Y.

[0018] A primer for detecting the specific marker for detecting insertion variation in the intron region of the gene of the spotted sea bream:

[0019] Ch ihrp _F:1 : 5'- ACTGCTCAACAAAATCACGAC-3';

[0020] Ch ihrp _R:2:5'-GGACTAAGCACCAAAGCCCT-3'.

[0021] An application of primers for detecting insertion variation of intron regions of grouper bream genes, and application of the primers in detecting the genetic sex of male and female grouper breams.

[0022] A kit for identifying the genetic sex of male and female spotted sea bream, the kit containing the primers.

[0023] The advantages of the present invention are:

[0024] The present invention relates to a rapid and accurate method for detecting DNA insertion variation in the intron of the ihrp gene of the spotted rock bream. The method compares the ihrp gene on the Y fusion chromosome of the male spotted rock bream with the homologous gene on the X chromosome of the female fish, and finds that a large sequence fragment has been inserted into the intron of the ihrp gene on the Y chromosome. This discovery is of great significance for understanding the differences in the cell proliferation regulation mechanism of male and female spotted rock bream, and can achieve rapid genetic sex identification, thereby accelerating the genetic breeding process of spotted rock bream and improving the large-scale production efficiency of high-quality seedlings;

[0025] The present invention successfully screened and obtained the specific large-fragment DNA insertion marker sequence of the homologous segments of the ihrp gene introns of the X and Y chromosomes by analyzing the whole genome sequence of the spotted rock bream. Based on this, a method for quickly detecting the DNA insertion variation of the ihrp gene introns of the spotted rock bream was established. The method uses a pair of primers to amplify two DNA fragments of 546bp and 419bp in the individuals with DNA insertion, and only amplify the 419bp fragment in the individuals without insertion. The two situations can be easily distinguished by agarose gel electrophoresis technology, which significantly improves the speed and accuracy of detection. The method of the present invention not only simplifies the identification process of the ihrp gene intron variation of the spotted rock bream, but also shortens the identification time and improves the detection efficiency. In addition, the method has a wide range of application prospects in the fields of sex identification of the spotted rock bream, preparation of Kaohsiung seedlings, and family selection, and has important economic and scientific value for promoting the development of the spotted rock bream aquaculture industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 A nucleotide sequence alignment diagram of the intron region of the Y chromosome ihrp gene and the intron region of the X chromosome ihrp gene provided in an embodiment of the present invention; the modules connected by connecting lines in the figure represent highly homologous regions of the intron region of the ihrp gene on chromosomes X and Y, wherein the region framed by left and right slashes is the target sequence ChrX1 of the present invention ihrp and ChrY ihrp The location.

[0027] Figure 2 ChrX1 provided in the embodiment of the present invention ihrp and ChrY ihrp Specific location information on chromosomes X and Y; 419bp represents ChrX1 ihrp The length of the fragment, 546 bp represents ChrY intergenic Length; ChrY ihrp The middle low region represents the inserted 127 bp nucleotide sequence, which is closely related to ChrX1 ihrp The fragment has no homologous matching sequence.

[0028] Figure 3 The obtained X chromosome ChrX1 provided in the embodiment of the present invention ihrp ChrY ihrp Nucleotide sequence alignment, the positions of the primers at both ends are indicated by black thick underlines; *: represents ChrX1 ihrp and ChrY ihrp Sequence consistency: the blank area indicates inconsistent base sequences between the two; _ _ _ _: represents insertion and deletion sequences; the black underline represents the area where the insertion sequence is located.

[0029] Figure 4 The X chromosome ChrX1 provided in the embodiment of the present invention ihrp ChrY ihrp Schematic diagram of nucleotide sequence homologous insertion difference DNA fragments; black areas represent homologous regions, and blank areas represent missing regions and site information.

[0030] Figure 5 The 1.5% agarose gel electrophoresis result diagram of the PCR products of male and female individuals of the spotted sea bream provided in an embodiment of the present invention, M: DL 2000 DNA Maker; ♂: physiological male fish; ♀: physiological female fish; the individual showing two bands (546bp and 419bp) in the figure is an individual with DNA insertion in the intron of the ihrp gene, which is also a genetic male fish, and the physiological sex histological identification is male fish, and the individual showing a single band (419bp) is an individual with no DNA insertion mutation in the intron of the ihrp gene, which is also a genetic female, and the physiological sex histological identification is female. DETAILED DESCRIPTION

[0031] The specific implementation modes of the present invention are further described below in conjunction with examples. It should be noted that the specific implementation modes described here are only for illustrating and explaining the present invention, and are not limited to the present invention.

[0032] The present invention uses the published genome information of the rockfish (CNP0001488, Li et al., 2021) and finds through genomic bioinformatics analysis that the ihrp gene on the Y chromosome of male fish has a large DNA sequence insertion mutation compared to the homologous gene on the X1 chromosome of female fish (e.g. Figure 1 The present invention selects the 19,200bp to 19,700bp region of the ihrp gene on the X1 chromosome of female fish and the 180bp to 730bp region on the Y chromosome of male fish that is homologous to the ihrp gene and has a DNA sequence insertion as the research target region. On the X1 chromosome, the DNA fragment is 419bp long and is named ChrX1 ihrp , whose sequence is shown in SEQ ID NO:1; on the Y chromosome, the DNA fragment is 546 bp in length and contains a sequence homologous to the ihrp gene on the X1 chromosome (without the insertion sequence), and is named ChrY ihrp , whose sequence is shown in SEQ ID NO: 2. ihrp ChrX1 ihrp The homologous sequences of ChrX1 ihrp There is a 127 bp DNA sequence inserted between the 261st and 262nd positions (e.g. Figure 2This insertion sequence is used as a DNA marker to detect whether the base insertion mutation occurs in the intron of the ihrp gene of the spotted rockfish; at the same time, because the marker is located on the Y chromosome of male fish and has male-associated genetic characteristics, this fragment is also a DNA marker unique to the Y chromosome of male spotted rockfish, and ChrX1 ihrp It is a DNA characteristic marker shared by male and female spotted sea bream.

[0033] The present invention uses a specific long DNA insertion sequence found in the intron region (180bp to 730bp) of the ihrp gene on the Y chromosome of male spotted rockfish as a marker to detect whether a DNA insertion mutation has occurred in the intron of the ihrp gene of spotted rockfish. This discovery has led to a method for rapidly detecting intron mutations in the ihrp gene of spotted rockfish, and the method is further applied to rapidly identifying the genetic sex of spotted rockfish. The specific detection method is, first, to confirm whether there is a Y chromosome-specific ihrp gene nucleotide fragment (546bp) in the spotted rockfish sample to be tested. This step is achieved by designing specific PCR primers to achieve rapid identification. The present invention compares and analyzes the ihrp gene sequence on the Y chromosome of spotted rockfish with the homologous sequences on the X1 and X2 chromosomes, and determines the ihrp gene on the X1 chromosome (X ihrp ID No:1) nucleotide sequence homologous to the sequence on chromosome Y (Y ihrp ID No:1). Based on the characteristics of large DNA insertion in this homologous intron region on the Y chromosome, we designed a pair of primers. By analyzing the PCR product by 1.5% agarose gel electrophoresis, it can be quickly determined whether DNA insertion mutation has occurred in the intron of the ihrp gene of the spotted rockfish. In addition, since the DNA insertion marker is located on the Y chromosome of male fish and exhibits sex-linked inheritance characteristics, it is also suitable for accurately identifying the genetic sex of the spotted rockfish. The upstream and downstream primer sequences are:

[0034] Ch ihrp _F:1 : 5'- ACTGCTCAACAAATCACGAC-3' (X ihrp ID No:2)(SEQ ID NO:3)

[0035] Ch ihrp _R:2: 5'-GGACTAAGCACCAAAGCCCT-3' (X ihrp ID No:3) (SEQ ID NO:4).

[0036] The steps of using the above primers to identify the intron insertion variation of the ihrp gene of spotted rockfish mainly include: extracting high-quality whole genome DNA of spotted rockfish, amplifying the specific marker DNA fragment of the intron insertion on the ihrp gene of the Y chromosome, and detecting the PCR product DNA by agarose gel electrophoresis; wherein two DNA fragments of 546 bp and 419 bp were amplified in the Y chromosome and X1 chromosome of male spotted rockfish (X1X2Y), respectively, and the 546 bp fragment was the specific marker fragment of the variant intron ihrp gene; while only a single DNA fragment of 419 bp was amplified in female spotted rockfish (X1X1X2X2).

[0037] The invention is based on the whole genome sequencing of male and female banded rock bream, the positioning of the ihrp gene of female and male individuals, and the DNA sequence comparison analysis. It can be seen that the ihrp gene intron region on the Y chromosome of male banded rock bream has a long DNA fragment insertion mutation, and then the DNA fragment is used as a DNA marker specific for the ihrp gene intron insertion on the Y chromosome of the banded rock bream, and the banded rock bream ihrp gene intron insertion mutation is used to quickly identify the male and female banded rock bream. The method can quickly, accurately and efficiently distinguish whether the tested banded rock bream has the ihrp gene intron insertion mutation. The method can amplify two bands of 546bp and 419bp in the banded rock bream individuals with ihrp gene intron mutation, wherein the 546bp band is a specific target band, and only a single band (419bp) is amplified in the ihrp gene individuals with non-mutated introns. The target band can be quickly and accurately distinguished by agarose gel electrophoresis, so as to realize the rapid identification of whether the ihrp gene intron of the banded rock bream has mutation. At the same time, since this specific target band (546bp) is located on the Y chromosome of male fish and has male-associated genetic characteristics, this fragment is also a DNA marker unique to the Y chromosome of male spotted sea bream, and can be used for the rapid identification of the genetic sex of female and male spotted sea bream.

[0038] Example 1 Screening and verification of DNA markers specific to the ihrp gene intron insertion mutation of rockfish

[0039] Discovery of homologous segments of ihrp genes on chromosomes X and Y of spotted rockfish and containing large inserted target DNA sequences: The DNA sequences of the male fish neo-Y chromosome and the female fish X1 chromosome were derived from the published genome information of spotted rockfish (CNP0001488, Li et al., 2021). Comparative genomic bioinformatics analysis of the genome sequences of male and female spotted rockfish showed that the ihrp gene on the neo-Y chromosome of male spotted rockfish was homologous to the ihrp gene on the X1 chromosome of female spotted rockfish, and there was a large DNA insertion fragment, of which the target DNA fragment of the ihrp gene on chromosome X1 was 419 bp in length and was named ChrX1. ihrp, whose sequence is SEQ ID NO:1:

[0040] ACTGCTCAACAAAATCACGACTGTTTGCTGTCCTGGCTCCACAATGGTGGAATGAGCTCCCCATTGACATCAGGACAGCAGAAACTCTACACAAATGAAACTCCTCGTTCAGACTGCACCTTGGCCAATAATAAAACAAGAAAAAAAAATCTCTATCTTTAACTGTTCCTAAATGTAACACTTGAAGCAGTTCATAAAGAAGAGCAATA AGCCAAAATGTAGTATGCAGAGTGTCAACTGATGTAACTTTAATATGCACAGTGTAAAAAATCCGGTGTCCAGTGTCATCATGGCGCCATTATGTGTAGTATAGTTAAACAGTTAAATACAGATCAAAATTTTGCACCACTGAATAATGTACCTGTTTGTCTGCATGTGTTTTGGTGATGGCATTAGCCAGGGCTTTGGTGCTTAGTCC.

[0041] The target DNA fragment of the ihrp homologous gene on the male fish heteromorphic chromosome Y is 546 bp long, which contains the homologous sequence to X1 and is named ChrY ihrp , whose sequence is SEQ ID NO:2:

[0042] .

[0043] The whole genome scanning of males and females and the location and DNA sequence comparison of the ihrp gene in males and females showed that the ihrp gene fragment ChrX ihrp Homologous ChrY ihrp (Y chromosome) An intron DNA sequence insertion occurred, corresponding to ChrX1 ihrp Between the 261st and 262nd positions, the size is 127 bp ( Figure 3 , Figure 4 ). The target region of the ihrp gene on chromosome Y (ChrY ihrp ) DNA sequence is homologous to the X1 chromosome DNA region (ChrX1 ihrp ) inserted a 127bp DNA sequence, which is a DNA marker specific to the intron insertion mutation of the ihrp gene of the rockfish. Its presence or absence can be used to identify the ChrY ihrp Whether the gene has intron insertion mutation. At the same time, because the marker is located on the Y chromosome of male fish, it has male-associated genetic characteristics. Therefore, ChrY ihrp This fragment is also a DNA marker unique to the Y chromosome of male spotted sea bream, and ChrX1ihrp It is the common DNA characteristic marker of the genetic sex of male and female spotted sea bream, such as Figure 3 shown.

[0044] Sequence verification of DNA markers specific to intron insertion mutations in the ihrp gene: Based on the nucleotide sequence of SEQ ID NO:2 of the ihrp gene on the Y chromosome and the nucleotide sequence characteristics of the homologous gene SEQ ID NO:1 on the X1 chromosome, two primers were designed ( Figure 1 ). Female and male rockfish of known physiological sex were selected and their high-quality DNA was extracted. ihrp _F:1,Ch ihrp _R:2 two primers for PCR amplification, the reaction conditions and procedures are as follows: PCR reaction system 20μL, including 10×Buffer 5.8μL, dNTP 4.0μL, rTaq enzyme (5U / μL) 0.2μL, upstream and downstream primers (Ch ihrp _F:1,Ch ihrp _R:2) 0.4µL each, DNA template 2.0µL, ddH2O 7.2µL. Touch down PCR amplification program: 94℃ 3mins, 60.5℃ (-1℃, 3 cycles) 1min, 72℃ 1min30s, 3 cycles; 94℃ 30s, 58.5℃ 30s, 72℃ 1min30s, 30 cycles; 72℃10min, 15℃ storage. 1.5% agarose gel electrophoresis of PCR products can distinguish the differences between intron variant and non-variant ihrp gene individuals. The difference fragment products of intron variant and non-variant ihrp genes were cut and recovered and transformed into competent cells through PMD18-T vector, and the positive clones were picked and sent to Qingdao Paisonno Gene Biotechnology Co., Ltd. for sequencing. The sequencing results verified that the homologous ihrp genes of chromosomes X and Y of the spotted sea bream contained large fragments inserted into the target DNA sequence fragment.

[0045] Example 2 Establishment and application of intron insertion mutation identification technology of ihrp gene of rock bream

[0046] Genetic identification was conducted on the spotted sea bream (of which 12 were female and 12 were male) farmed by Laizhou Mingbo Aquatic Products Co., Ltd. in Laizhou City, Yantai, Shandong Province.

[0047] High-quality DNA extraction: The fin ray DNA of the spotted sea bream was extracted using the Tiangen marine animal DNA extraction kit. The integrity of the genomic DNA was identified by 1.0% agarose gel electrophoresis. The OD value of the DNA supernatant was measured by a UV spectrophotometer. The DNA concentration was adjusted to 70 ng / µL and stored at -20°C for later use.

[0048] PCR reaction system and PCR amplification identification: using the DNA fragment primers Ch specific for the intron insertion mutation of the ihrp gene of the rockfish ihrp _F:1 and Ch ihrp _R:2 Detect the intron variation of ihrp gene in rockfish by PCR. The PCR reaction system is 20μL, including 10×Buffer 5.8μL, dNTP 4.0μL, rTaq enzyme (5U / μL) 0.2μL, upstream and downstream primers (Ch ihrp _F:1,Ch ihrp _R:2) 0.4µL each, DNA template 2.0µL, ddH2O 7.2µL. Touch down PCR amplification program: 94℃ 3mins, 60℃ (-1℃, 3 cycles) 1min, 72℃ 1min30s, 3 cycles; 94℃ 30s, 58℃ 30s, 72℃ 1min30s, 30 cycles; 72℃ 10min, 4℃ storage. Using 1.5% agarose gel electrophoresis at 110V constant voltage for 20 minutes, gel imaging can clearly distinguish between individuals with DNA insertion and non-insertion of ihrp genes in the intron of the spotted sea bream (see Figure 5 ).

[0049] Depend on Figure 5 It can be seen that two target bands (546 bp and 419 bp) were amplified in the individuals of the rockfish with DNA insertion in the ihrp gene intron, of which the 546 bp band was the specific target band ChrY ihrp However, in individuals without DNA insertion mutation in the ihrp gene intron, only a single band type ChrX1 could be amplified. ihrp (419 bp). ihrp The marker is located on the Y chromosome of male fish and has male-linked genetic characteristics, so ChrY ihrp This fragment is also a DNA marker unique to the Y chromosome of male spotted sea bream, and ChrX1 ihrp The method is a DNA characteristic marker shared by male and female genetic sexes of spotted bream, and the selected spotted bream can be distinguished. The method of the present invention can not only quickly, accurately and efficiently identify whether the ihrp gene of the spotted bream to be tested has a gene intron insertion mutation, but also has important significance and application value in the study of the difference in growth and differentiation regulation of female and male cells based on the ihrp gene of spotted bream, as well as in the identification of male and female sexes, the preparation of high male seedlings and family selection.

[0050] As can be seen from the above, the present invention uses a pair of primers to amplify bands of 546bp and 419bp in individuals with DNA insertion mutation, and only amplifies a band of 419bp in individuals without insertion mutation. These bands can be distinguished by agarose gel electrophoresis, thereby quickly and accurately identifying the DNA insertion mutation of the ihrp gene intron of the spotted rockfish. The detection method of the present invention significantly shortens the identification time, improves the detection efficiency, and has important application value in the sex identification, Kaohsiung seed preparation and family selection of spotted rockfish.

Claims

1. A specific marker for DNA insertion mutation in the intron region of the ihrp gene of rock bream, characterized in that: The specific markers of insertion variation in the intron region of the ihrp gene of the rockfish are DNA fragments of non-insertion and insertion specific markers in the intron region of the ihrp gene of the rockfish, and the nucleotide sequences of the DNA fragments are shown in SEQ ID NO:1 and SEQ ID NO:

2.

2. The specific marker for DNA insertion mutation in the intron region of the ihrp gene of the rockfish according to claim 1, characterized in that: The bases shown in the nucleotide sequence SEQID NO:1 of the non-insertion and insertion specific markers of the ihrp gene intron region DNA fragment of the spotted rockfish are the common DNA characteristic markers of the non-insertion and insertion individuals of the ihrp gene intron region base of the spotted rockfish.

3. An application of a specific marker for DNA insertion mutation in the intron region of the ihrp gene of the rockfish according to claim 1, characterized in that: The specific marker is used to identify the genetic sex of male and female spotted sea bream.

4. A method for detecting insertion variation in the intron region of a gene of a grouper using the specific marker described in claim 1, characterized in that: 1) PCR amplification: Take the grouper porgy to be tested and extract genomic DNA; use the obtained genomic DNA as a template and specific primers for the intron region of the grouper porgy ihrp gene to perform PCR amplification, and compare the obtained PCR amplification product with the specific marker described in claim 1; 2) Result judgment: two DNA fragments of 419 bp and 546 bp were amplified from the genomic DNA of the tested rockfish, which means that the tested rockfish is an individual with a DNA fragment insertion mutation in the intron region of the ihrp gene; 419 bp are the bases shown in SEQ ID NO: 1, and 546 bp are the bases shown in SEQ ID NO: 2; 3) Only a single DNA fragment of 419 bp was amplified from the genomic DNA of the tested rockfish, which means that the tested rockfish is an individual with no DNA fragment insertion mutation in the intron region of the ihrp gene of the rockfish; 419 bp is the base shown in SEQ ID NO:

1.

5. The method for detecting insertion variation of the intron region of the gene of the grouper sea bream according to claim 4, characterized in that: The specific primers in step 1) are: Ch ihrp _F:1 : 5’- ACTGCTCAACAAAATCACGAC-3’; Ch ihrp _R:2 : 5'- GGACTAAGCACCAAAGCCCT-3'。 6. The method for detecting insertion variation of the intron region of the gene of the grouper sea bream according to claim 4, characterized in that: The individual of the spotted rockfish with no DNA fragment insertion mutation in the intron region of the ihrp gene was female X1X1X2X2; The male fish of the spotted rockfish has a mutation in which a DNA fragment is inserted into the intron region of the ihrp gene, and the individual is X1X2Y.

7. A primer for detecting specific markers of insertion mutations in the intron region of the gene of the rockfish of claim 1, characterized in that: Ch ihrp _F:1 : 5’- ACTGCTCAACAAAATCACGAC-3’; Ch ihrp _R:2 : 5'- GGACTAAGCACCAAAGCCCT-3'。 8. Use of a primer for specific markers of insertion mutation in the intron region of a gene of a grouper sea bream according to claim 7, characterized in that: The primers are used in detecting the genetic sex of male and female rock bream.

9. A kit for identifying the genetic sex of male and female rock bream, characterized in that: The kit contains the primers described in claim 7.

Images