Application of vaccinium myrtillus MYB transcription factor VcMYB4a gene in improvement of vaccinium myrtillus salt tolerance

Abstract

The invention is applicable to the technical fields of molecular biology and biology, and provides application of a vaccinium myrtillus MYB transcription factor VcMYB4a gene in improvement of vaccinium myrtillus salt tolerance. The nucleotide sequence of the VcMYB4a gene is as shown in SEQ ID NO: 1, and the amino acid sequence of the encoded protein of the VcMYB4a gene is as shown in SEQ ID NO: 2. The recombinant RNAi plant expression vector contains a specific RNAi sequence aiming at the C2 negative regulation region of the VcMYB4a gene. The constructed recombinant RNAi plant expression vector is transferred into the bilberry callus, the expression of the C2 negative regulation region of the VcMYB4a gene is inhibited, the phenotype of the transgenic callus is observed after salt stress treatment, and the result shows that the inhibition of the expression of the C2 negative regulation region of the VcMYB4a gene improves the salt tolerance of the bilberry callus.

Description

Technical Field

[0001] The invention belongs to the fields of molecular biology and biotechnology, and particularly relates to application of a blueberry MYB transcription factor VcMYB4a gene in improving blueberry salt tolerance. Background Art

[0002] Plants in nature often face abiotic stresses such as salt damage, low temperature, and drought, which significantly affect crop yield and quality. Soil salinity is the main abiotic stress factor affecting the growth and development of horticultural crops. Blueberry, as a plant with low salt tolerance, is extremely sensitive to increased soil salinity. In view of the serious salinization of soil in coastal and northern my country, blueberry yield and quality are seriously affected. In order to expand the blueberry planting area, the cultivation of salt-tolerant varieties has become a key measure to promote the development of the blueberry industry.

[0003] MYB (v-myb avian myeloblastosis viral oncogene homolog) family transcription factors are one of the largest transcription families in plants, playing an important role in plant growth and development, cell construction and differentiation, plant primary and secondary metabolism, and response to biotic and abiotic stresses. The MYB domain generally contains 1-4 incompletely repeated R sequences, each of which consists of 50-53 amino acid residues. According to the number and position of these incompletely repeated sequences, MYB family transcription factors can be divided into four categories, namely 1R (R1 / 2, R3-MYB), 2R (R2R3-MYB), 3R (R1R2R3-MYB) and 4R (R1R1R2R1 / 2), among which R2R3-MYB is the most common in plants. The N-terminal region of the MYB protein has a conserved MYB domain, which is essential for DNA binding, while the C-terminal region is diverse, which determines the functional diversity of MYB family genes. In particular, the MYB protein, which acts as an inhibitor, has a C1 motif at its C-terminus, also known as the GIDP (lsrGIDPxT / N) domain, and a C2 motif (pdLNLD / ELxiG / S) including the EAR motif, which participates in the process of inhibiting gene expression. MYB transcription factors bind to MYB binding elements in the promoter regions of many functional genes, thereby activating the expression of stress-responsive genes. For example, in Arabidopsis, MYB transcription factors mainly regulate salt stress responses by recognizing target genes such as RD22, RD29A, RD29B, ISP, COR15A, and ADH1. Existing MYB proteins, such as AtMYB44 / AtMYBR1, AtMYB41, AtMYB15, and AtMYB20 proteins in Arabidopsis, and TaMYB32, TaMYB33, TaMYB56-B, and TaMYB73 proteins in wheat, all play a role in transcriptional activation under salt stress. Only a few MYB transcription factors play a negative role in regulation under salt stress. For example, the Arabidopsis R2R3-MYB transcription factor AtDIV2 negatively regulates salt stress by regulating ABA signal transduction.

[0004] Bilberry, belonging to the genus Vaccinium of the Ericaceae family, has red or blue fruits (blue fruits are often called blueberries). In recent years, its fruit has a high nutritional and health value. However, compared with other fruit trees, the research on abiotic stress of bilberry is relatively lagging, especially the existing bilberry varieties are extremely sensitive to salt stress, which makes it difficult to improve its salt tolerance through traditional breeding methods. At present, there are no reports on improving the salt tolerance of bilberry by molecular biological means, and the molecular mechanism is still unclear. With the rapid development of salt-tolerant genetic engineering technology, it is very important to use molecular biological means to obtain salt-tolerant varieties of bilberry to promote the development of the bilberry industry. For this reason, a bilberry MYB transcription factor VcMYB4a gene is proposed for improving the salt tolerance of bilberry. Summary of the invention

[0005] The purpose of the present invention is to provide an application of a blueberry MYB transcription factor VcMYB4a gene in improving the salt tolerance of blueberry, aiming to solve the problems raised in the above background technology.

[0006] To achieve the above object, the present invention provides the following technical solutions:

[0007] A DNA sequence is a MYB transcription factor screened under blueberry salt stress and is named VcMYB4a. The nucleotide sequence of the VcMYB4a gene is shown in SEQ ID NO: 1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO: 2.

[0008] A recombinant RNAi plant expression vector contains a specific RNAi sequence targeting the C2 negative regulatory region of the VcMYB4a gene as described above.

[0009] A use of the above-mentioned blueberry MYB transcription factor VcMYB4a gene in improving the salt tolerance of blueberry, which improves the salt tolerance of blueberry by inhibiting the expression of the VcMYB4a gene.

[0010] Compared with the prior art, the present invention has the following beneficial effects:

[0011] The invention provides a nucleotide sequence of a bilberry MYB transcription factor VcMYB4a gene for negatively regulating salt tolerance of bilberry and an amino acid sequence of a protein encoded thereof, constructs an RNAi vector containing a specific RNAi sequence for a C2 negative regulatory region of the VcMYB4a gene, observes the phenotype of transgenic callus after salt stress treatment, and the result shows that the transgenic callus with the expression of the C2 negative regulatory region of the VcMYB4a gene suppressed has higher salt tolerance than the transgenic callus with overexpression of the VcMYB4a gene and the wild-type callus, so that the expression of the C2 negative regulatory region of the VcMYB4a gene in bilberry is suppressed by genetic engineering technology, so that a bilberry variety with higher salt tolerance can be obtained. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 This is a multiple sequence comparison of VcMYB4a; among them: VvMYB4a and VvMYB4b are grapes; CsMYB4a is tea plant; AtMYB4 is Arabidopsis thaliana; PvMYB4 is switchgrass; PhMYB4 is petunia.

[0013] Figure 2is the phylogenetic tree of VcMYB4a; VvMYB4a is grape; ZmMYB11 is corn; SmMYB39 is Salvia miltiorrhiza; VcMYB193 is blueberry; CsMYB4a is tea plant; VvMYB4b is grape; PhMYB4 is petunia; EgMYB1 is gentiana; AtMYB4 is Arabidopsis thaliana; ZmMYB42 is corn; PvMYB4 is switchgrass; AtMYB7 is Arabidopsis thaliana; A tMYB32, AtMYB6 and AtMYB8 are Arabidopsis thaliana; AmMYB330 is antirrhinum; VcMYB97, VcMYB44 and VcMYB98 are blueberry; GhMYB6 is cotton; FaMYB1 is strawberry; VvMYBC2-L1 is grape; PhMYB27 is petunia; GbMYBF2 is Ginkgo biloba; PtMYB182 is poplar; MdMYB6 is apple; MtMYB2 is Medicago truncatula.

[0014] Figure 3 Salt stress treatment inhibits seed germination of overexpressing Arabidopsis; wherein: A is 0mM NaCl; B is 100mMNaCl; WT is wild-type Arabidopsis; VcMYB4a-OE1, VcMYB4a-OE2 and VcMYB4a-OE3 represent three strains in which the VcMYB4a gene is overexpressed in Arabidopsis.

[0015] Figure 4 Salt stress treatment (50 mM NaCl) inhibits the root growth of overexpressing Arabidopsis; WT is wild-type Arabidopsis; VcMYB4a-OE1, VcMYB4a-OE2 and VcMYB4a-OE3 represent three strains in which the VcMYB4a gene is overexpressed in Arabidopsis.

[0016] Figure 5 The amplified 249-bp sequence containing the C2 negative regulatory region of the VcMYB4a gene, where the blue fonts are the forward and reverse primer sequences, and the red fonts are the base sequence of the C2 negative regulatory region.

[0017] Figure 6 RNAi vector pGWRNAi-VcMYB4a for inhibiting the expression of the C2 negative regulatory region of the VcMYB4a gene; wherein: the red base sequence is the C2 negative regulatory region sequence encoding the VcMYB4a protein; attR1, Cm R The sequences of the ccdB and attR2 regions were replaced by a 249-bp base sequence of the C2 negative regulatory region of the VcMYB4a gene.

[0018] Figure 7Screening of transgenic callus; A is the screening of transgenic callus that inhibits the expression of the C2 negative regulatory region of the VcMYB4a gene; B is the screening of transgenic callus that overexpresses the VcMYB4a gene; the red circle indicates the transgenic callus that may be obtained.

[0019] Figure 8 qRT-PCR analysis of transgenic callus; A represents the expression of transgenic callus with the expression of C2 negative regulatory region of VcMYB4a gene inhibited; B represents the expression of transgenic callus with overexpression of VcMYB4a gene; WT represents wild-type callus; RNAi-VcMYB4a-1, RNAi-VcMYB4a-2 and RNAi-VcMYB4a-3 represent three transgenic callus with the expression of C2 negative regulatory region of VcMYB4a gene inhibited; OE-VcMYB4a-1, OE-VcMYB4a-2 and OE-VcMYB4a-3 represent three transgenic callus with overexpression of VcMYB4a gene; the values ​​represent the mean ± standard deviation of three biological replicates, and the asterisk indicates the significant difference between the transgenic lines and the control WT using Duncan's test (***P < 0.001).

[0020] Fig. 9 The figure shows the effect of salt stress on blueberry callus; wherein: A is a culture medium without NaCl; B is a culture medium containing 50 mM NaCl; WT is wild-type callus; RNAi-VcMYB4a is three transgenic callus that inhibit the expression of the C2 negative regulatory region of the VcMYB4a gene; OE-VcMYB4a is three transgenic callus that overexpress the VcMYB4a gene.

[0021] Fig.10 Effect of salt stress on the growth of blueberry callus; WT is wild-type callus; RNAi-VcMYB4a is three transgenic callus that inhibit the expression of the C2 negative regulatory region of the VcMYB4a gene; OE-VcMYB4a is three transgenic callus that overexpress the VcMYB4a gene; different lowercase letters represent significant differences between different samples at the 0.05 level. DETAILED DESCRIPTION

[0022] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0023] The specific implementation of the present invention is described in detail below in conjunction with specific embodiments.

[0024] Example 1: Cloning of the blueberry VcMYB4a gene;

[0025] 1. Extraction of total RNA and synthesis of cDNA from blueberry;

[0026] Total RNA extraction from blueberry was performed using a column-based plant total RNA extraction and purification kit (Shanghai Biotech). Young leaves of blueberry variety "Lanfeng" were ground into powder with liquid nitrogen and added to a centrifuge tube pre-added with Buffer Rlysis-PG. The mixture was immediately shaken and stirred for 5 minutes. Centrifuged at 12,000 rpm for 3 minutes at 4°C, and the supernatant was transferred to a centrifuge tube treated with RNase. Anhydrous ethanol was added in a volume of half the supernatant and mixed thoroughly. The mixture was transferred to an adsorption column, allowed to stand for 1 minute, and then centrifuged at 12,000 rpm for 1 minute, and the waste liquid in the collection tube was discarded. 500 μL GT Solution was added to the adsorption column, allowed to stand for 2 minutes, and then centrifuged at 12,000 rpm for 1 minute, and the waste liquid in the collection tube was discarded. 500 μL NT Solution was added to the adsorption column, allowed to stand for 2 minutes, and then centrifuged at 12,000 rpm for 1 minute, and the waste liquid in the collection tube was discarded. To avoid affecting subsequent experiments, finally, centrifuge at 12000 rpm for 3 min to ensure that the anhydrous ethanol in the adsorption column is completely removed. Transfer the adsorption column to an RNase-free centrifuge tube, add 40 μL DEPC-treated ddH2O to the center of the adsorption membrane, let it stand for 2 min, centrifuge at 12000 rpm for 2 min, and collect the eluted RNA solution. Use a spectrophotometer at OD 260 / OD 280 Measure the RNA concentration. If the ratio is between 1.8 and 2.0, it means that the RNA extracted this time has a high purity and can be retained for use.

[0027] The extracted RNA was reverse transcribed to obtain cDNA using a reverse transcription kit (Thermo), and the reaction system was 5× PrimeScript RT Master Mix 2μL, add total RNA 1ug and DEPC-treated ddH2O, the final volume is 10μL. Reaction conditions are 37℃15min, 85℃5s. The cDNA after reaction is stored in a -20℃ refrigerator for subsequent experiments.

[0028] 2. Cloning of the MYB transcription factor VcMYB4a gene from blueberry;

[0029] According to the cDNA sequence of the VcMYB4a gene (GenBank accession number KP761739) registered in the NCBI of blueberry (https: / / www.ncbi.nlm.nih.gov / ), the full-length primers of the gene were designed. The forward primer VcMYB4a-f2 contained the SmaI restriction site CCCGGG and two protective bases TC, and the reverse primer removed the stop codon TGA and contained the Spe I restriction site ACTAGT and two protective bases GG. The primer sequences are as follows:

[0030] VcMYB4a-f2: TCCCCCGGGATGGGGAGGTCACCTTGTT (as shown in SEQ ID NO: 3);

[0031] VcMYB4a-r2: GGACTAGTTTTCATCTCCAAACTTCTGT (as shown in SEQ ID NO: 4);

[0032] The primer sequences were synthesized by Kumei Biotechnology Co., Ltd.

[0033] PCR amplification was performed using 2×Phanta Max Master Mix high-fidelity enzyme. The PCR system placed in the PCR instrument included: 2×Phanta Max Master Mix 25μL, 10μM VcMYB4a-f2 and VcMYB4a-r2 primers 1μL each, the above reverse transcribed cDNA 1μL, ddH2O 22μL. The PCR reaction program was: 95℃, 15s; 56℃, 15s; 72℃, 30s for 30 cycles, followed by 72℃ extension for 5min. After the PCR reaction was completed, the reaction product was verified by agarose gel electrophoresis.

[0034] DNA purification was recovered using a common agarose gel DNA recovery kit (TIANGEN). A single target DNA band was cut from the agarose gel, placed in a centrifuge tube, and an equal volume of solution PN was added. The gel was heated in a 50°C water bath to fully dissolve the gel block. The adsorption column was placed in a collection tube, 500 μL of equilibrium solution BL was added, and the waste liquid in the collection tube was discarded after centrifugation. The dissolved gel was added to the adsorption column, placed at room temperature for 2 minutes, and the waste liquid in the collection tube was discarded after centrifugation. 600 μL of rinse solution PW was added to the adsorption column, and the waste liquid in the collection tube was discarded after centrifugation, and this step was repeated once. The adsorption column was returned to the collection tube and centrifuged again. The adsorption column was placed in a clean centrifuge tube, 30 μL of elution buffer EB was added to the center of the adsorption membrane, and after being placed at room temperature for 2 minutes, it was centrifuged at 12000 rpm for 2 minutes to collect the purified DNA solution. Thus, the purified VcMYB4a gene was obtained and stored in a -20°C refrigerator for subsequent experiments.

[0035] Example 2, Bioinformatics analysis of blueberry MYB transcription factor VcMYB4a protein;

[0036] The open reading frame (ORF) of the MYB transcription factor VcMYB4a gene in blueberry contains 798 bp of nucleotides, which encode a protein consisting of 265 amino acids. Figure 1 ), this protein has conserved R2 and R3 motifs in the N-terminal region with 6 MYB transcription factors of other plants, so it is classified as an R2R3-MYB transcription factor. Further observation revealed that this protein contains C1 (LlsrGIDPxT / SHRxI / L) and C2 (pdLNLD / ELxiG / S) motifs in the C-terminal region, so it may be a negative regulatory factor. It also contains C3 / ZnF (CX1-2CX7-12CX1-2C) and C4 (dFLGL and LDE / YRxLEMK) motifs.

[0037] The amino acid sequence of this protein was systematically analyzed with the amino acid sequences of MYB transcription factors of other plants. Figure 2 The results showed that the protein had the highest similarity with VvMYB4a in grape, so it was named VcMYB4a. These proteins all have negative regulatory functions, so we speculate that VcMYB4a protein is a negative regulatory transcription factor.

[0038] Example 3, construction of overexpression vector;

[0039] Escherichia coli carrying the plant expression vector pCAMBIA1300 was suspended in LB liquid medium containing 50 mg / L kanamycin and placed in a shaker at 37°C for overnight culture. Plasmids were extracted from the culture using a plasmid mini-extraction kit (TIANGEN), and the vector and the purified product of the cloned VcMYB4a gene were double-digested using SmaⅠ and Spe I endonucleases, respectively. The reaction system contained 5 μL of 10× Quick Cut Green Buffer, 1 μg of vector plasmid or PCR purified product, 1 μL of SmaⅠ endonuclease, and 1 μL of Spe I endonuclease, supplemented with ddH2O to a total volume of 50 μL. The reaction mixture was incubated in a 30°C water bath for 30 minutes. After the digestion was completed, agarose gel electrophoresis was performed to detect and recover the digested vector and PCR product.

[0040] The recovered vector and PCR product (VcMYB4a gene) were connected by T4 DNA ligase. The reaction system was 10 μL, including 1 μL of 10×T4 DNALigase Buffer, 3 μL of vector digestion product, 5 μL of PCR digestion product and 1 μL of T4DNALigase. The mixture was placed in a connector and reacted at 25°C for 2 hours. The ligated mixture was transferred into E. coli DH5α competent cells according to the instructions. The transformed cells were spread on LB solid plates containing 50 mg / L kanamycin and cultured in a 37°C incubator overnight. Colony PCR was used to verify whether the colonies on the plate were successfully connected, and positive clones were selected and sent to a biological company for sequencing. After the sequencing results were aligned correctly, it was confirmed that the overexpression vector was successfully constructed and named pCAMBIA1300-MYB4a. The Agrobacterium plasmid containing the pCAMBIA1300-MYB4a vector was extracted using a plasmid mini-extraction kit (TIANGEN), and finally the plasmid was transferred into Agrobacterium EH105 and stored in a -80°C refrigerator for subsequent experiments.

[0041] Example 4: Heterologous expression of VcMYB4a gene in Arabidopsis thaliana;

[0042] The transgenic Arabidopsis thaliana was obtained by floral infection method. The specific method is as follows:

[0043] Select Arabidopsis plants with more flowers about to bloom, invert them so that their buds face downward, and place the plants in the Agrobacterium solution containing the pCAMBIA1300-MYB4a vector for 2 minutes. Lay the infected Arabidopsis plants flat, place them in the dark for 24 hours, and then culture them under normal light conditions. Harvest seeds after maturity, sow T0 seeds, use hygromycin to screen, and perform PCR identification on the screened positive plants to obtain transgenic lines that overexpress the VcMYB4a gene. After multiple generations of screening and identification, obtain T4 generation transgenic Arabidopsis plants for subsequent phenotypic tests.

[0044] Example 5: Effect of salt stress on seed germination of transgenic Arabidopsis thaliana;

[0045] Wild-type and transgenic Arabidopsis T4 seeds were sown in MS medium and MS medium containing 100 mM NaCl. One week after sowing, it was found that the wild-type and transgenic Arabidopsis seeds germinated normally and there was no significant difference in growth ( Figure 3 After treatment with 100 mM NaCl, the germination of Arabidopsis seeds was inhibited, and the germination of transgenic Arabidopsis was significantly later than that of wild-type Arabidopsis ( Figure 3 The above results showed that overexpression of VcMYB4a gene in Arabidopsis thaliana significantly reduced the salt tolerance of Arabidopsis thaliana.

[0046] Example 6: Effect of salt stress on root growth of transgenic Arabidopsis thaliana;

[0047] After culturing Arabidopsis thaliana in MS medium for 10 days, the plants were transferred to MS medium containing 50 mM NaCl and cultured for another week. The root lengths of the strains were compared. Figure 4 ): Compared with the three transgenic Arabidopsis lines, the wild-type Arabidopsis has longer roots, which means that its growth is least affected by the salt solution; the three transgenic Arabidopsis lines also have obvious differences in root length, which may be related to the different expression levels of the VcMYB4a gene in them and their different responses to salt stress. Overall, overexpression of the VcMYB4a gene in Arabidopsis significantly reduced the root growth of Arabidopsis.

[0048] Example 7, Construction of RNAi vector for inhibiting expression of C2 negative regulatory region of VcMYB4a gene;

[0049] RNAi primers containing part of the vector were designed based on the location of the C2 negative regulatory region (base 520 C to base 549 C) of the VcMYB4a gene cDNA sequence SEQ ID NO: 1. The primer sequences are as follows:

[0050] VcMYB4aattB1:GGGGACAAGTTTGTACAAAAAAGCAGGCTTCCCATCAACGAGC CTCAACCG (as shown in SEQ ID NO: 5).

[0051] VcMYB4aattB2: GGGGACCACTTTGTACAAGAAAGCTGGGTCTATTTCTCCCTCCT GTCTTC (as shown in SEQ ID NO: 6).

[0052] The primer sequences were synthesized by Kumei Biotechnology Co., Ltd. PCR amplification was performed using 2×PhantaMax Master Mix high-fidelity enzyme to obtain a 249-bp cDNA fragment ( Figure 5 ). The VcMYB4a gene specific cDNA fragment was cloned into the pDONR207 vector by BP reaction using BP Clonase II Enzyme Mix. The 10 μL reaction system included 7 μL of the specific VcMYB4a gene cDNA fragment recovery product, 1 μL of the pDONR207 entry vector plasmid, and 5×BP Clonase II Enzyme Mix. TMreactionbuffer 2μL. After the reaction was carried out at 25℃ for 1h, 2μL Proteinase K was added and the reaction was terminated at 37℃ for 10min. The ligated vector was transferred into Escherichia coli DH5α competent cells, spread on solid culture medium containing 50mg / L gentamicin, and cultured at 37℃ overnight. Independent single colonies were selected for bacterial liquid PCR verification, and the positive clones were sequenced to confirm. After the sequencing was correct, the E. coli plasmid was extracted. LR Clonase II Enzyme Mix was used for LR reaction to transfer the specific fragment in the pDONR207 vector to the pGWRNAi vector. The 10μL reaction system includes 7μL of the entry vector plasmid containing the specific cDNA fragment of the VcMYB4a gene, 1μL of the pGWRNAi vector plasmid and 5×LR Clonase TM reactionbuffer 2μL. After the reaction was carried out at 25℃ for 1h, 2μL Proteinase K was added and the reaction was terminated at 37℃ for 10min. After the reaction was completed, it was transferred into E. coli DH5α competent cells and spread on LB solid plates containing 50mg / L spectinomycin, and cultured in a 37℃ incubator overnight. Then the bacterial liquid was verified by PCR, and the positive clones were sequenced. If the sequencing results were consistent with the expected results, the RNAi vector that inhibits the expression of the C2 negative regulatory region of the VcMYB4a gene was successfully constructed and named pGWRNAi-VcMYB4a( Figure 6 The E. coli plasmid containing pGWRNAi-VcMYB4a was extracted and transferred into Agrobacterium tumefaciens EH105 and stored in a -80°C refrigerator for subsequent experiments.

[0053] Example 8, obtaining transgenic callus of VcMYB4a gene;

[0054] The Agrobacterium infection method is as follows:

[0055] The blueberry callus was cultured in WPM liquid medium and subcultured once every 10 days. After three subcultures, the callus was immersed in the activated Agrobacterium culture solution containing the target gene for about 15 minutes, and the culture solution was absorbed with sterile filter paper. The callus was rinsed with sterile ddH2O three times, each time for 15 minutes, to remove the remaining Agrobacterium. The infected callus was transferred to WPM solid medium without antibiotics, cultured in the dark for 2 days, and then transferred to WPM solid screening culture containing 50 mg / L cephalosporin and 50 mg / L antibiotics. White fresh callus was obtained through antibiotic screening, which was predicted to be transgenic callus that inhibited the expression of the C2 negative regulatory region of the VcMYB4a gene ( Figure 7 A) and transgenic callus overexpressing VcMYB4a gene ( Figure 7 B), the newly grown callus was screened at least 3 times, antibiotics were added to maintain the screening pressure, and RNA of the callus was extracted after 3 subcultures. qRT-PCR was used to detect whether it was a transgenic callus. Finally, three transgenic calli with low expression of the VcMYB4a gene that inhibited the expression of the C2 negative regulatory region of the VcMYB4a gene were selected ( Figure 8 A) and three transgenic calli with high expression of VcMYB4a gene ( Figure 8 Middle B) is used for subsequent functional verification.

[0056] Example 9: Effect of salt stress on transgenic callus;

[0057] Wild-type callus (WT) and callus overexpressing VcMYB4a gene (OE-VcMYB4a) were used as controls, and transgenic callus (RNAi-VcMYB4a) inhibiting the expression of the C2 negative regulatory region of the VcMYB4a gene was treated with salt. Three transgenic lines were taken from the callus overexpressing the VcMYB4a gene and the transgenic callus inhibiting the expression of the C2 negative regulatory region of the VcMYB4a gene for testing. On a medium without NaCl, the three types of callus, WT, OE-VcMYB4a, and RNAi-VcMYB4a, grew for 21 days, and there was no significant difference in growth ( Fig. 9 Middle A and Fig.10 ). In the medium containing 50 mM NaCl, salt stress inhibited the growth of OE-VcMYB4a, but promoted the growth of RNAi-VcMYB4a compared with WT ( Fig. 9 Medium B and Fig.10 ), so inhibiting the expression of the C2 negative regulatory region of the VcMYB4a gene can improve the salt tolerance of blueberry. The above results show that the VcMYB4a gene negatively regulates salt tolerance in blueberry, and inhibiting the expression of the VcMYB4a gene can improve the salt tolerance of callus tissue.

[0058] The above are only preferred embodiments of the present invention. It should be pointed out that, for those skilled in the art, several modifications and improvements can be made without departing from the concept of the present invention. These should also be regarded as the protection scope of the present invention. These will not affect the effect of the implementation of the present invention and the practicality of the patent.

Claims

1. A blueberry MYB transcription factor VcMYB4a gene, It is characterized in that The nucleotide sequence of the VcMYB4a gene is shown in SEQ ID NO: 1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO:

2.

2. A recombinant RNAi plant expression vector, It is characterized in that It contains a specific RNAi sequence targeting the C2 negative regulatory region of the VcMYB4a gene as claimed in claim 1.

3. Use of the blueberry MYB transcription factor VcMYB4a gene according to claim 1 in improving blueberry salt tolerance, It is characterized in that Improving salt tolerance in blueberry by inhibiting the expression of the VcMYB4a gene.

Images