Application of F-box gene OsFBX49 in brown planthopper resistance of rice

Abstract

The invention discloses application of an F-box gene OsFBX49 to brown planthopper resistance of rice, and belongs to the technical field of plant genetic engineering. The amino acid sequence of a protein encoded by the gene OsFBX49 is as shown in SEQ ID NO. 1. According to the invention, through agrobacterium-mediated genetic transformation, the OsFBX49 gene is transferred into insect-sensitive rice, and the result shows that the resistance of a plant over-expressing the OsFBX49 gene to brown planthopper is enhanced. After the brown planthopper eats the transgenic plant, the survival rate of the brown planthopper is obviously reduced, the weight of the brown planthopper is increased, and the amount of secreted honeydew is obviously reduced. The gene provided by the invention provides a basis for research on interaction of rice and brown planthopper genes, and has reference significance for research on gene molecular functions and breeding.

Description

Technical Field

[0001] The invention relates to the technical field of plant genetic engineering, and in particular to application of an F-box gene OsFBX49 in rice resistance to brown planthoppers. Background Art

[0002] Rice is one of the most important food crops, and more than half of the world's population relies on it as their staple food. At the same time, rice production is directly related to my country's food security, farmers' income increase and rural stability. Brown planthoppers are the pests with the largest occurrence and damage area in rice production. Adults or nymphs of brown planthoppers gather at the base of rice bushes, sucking the sap from the phloem and consuming the nutrients of rice plants. When brown planthoppers break out, the lower part of the rice plants turns black, paralyzed and lodged, and rice fields wither in large areas, resulting in reduced or even no harvest. According to statistics, in the ten years from 2006 to 2015, my country suffered from brown planthoppers in an area of ​​3.87 mu per year, with a loss of 120 tons of rice, accounting for 29.5% of the total loss of various rice diseases and pests, and is the number one pest in my country's rice production (Liu Wancai et al., 2016). Brown planthoppers are also the number one pest in rice production in Asia, often causing heavy losses to rice in various countries. Especially since the beginning of the 21st century, the frequency and scale of brown planthopper outbreaks in rice-producing areas throughout Asia have gradually increased. It has become the biggest threat to rice production and is considered the number one pest of rice (Heong & Hardy, 2009; IRRI, Annual report 2011). Therefore, curbing the development and harm of brown planthoppers is a major need to ensure the safety of rice production.

[0003] F-box protein was first discovered in the cell cycle protein CyclinF and is a key factor in the SCF complex (Glickman MH et al., 2002; Jain M., 2007). It is named F-box because its N-terminus contains an F-box motif consisting of about 40-50 amino acids. These positions are occupied by a combination of highly conserved Leu-Pro dipeptide and other hydrophobic or branched (Val and Ile) amino acids. F-box protein can interact with the core subunit of SCF ubiquitin E3 ligase-S phase kinase-associated protein 1 (SKP1) to form an SCF complex, which participates in plant growth and development, plant photomorphogenesis, plant hormone signal transduction, and resistance to biological stress. F-box protein is essential for plant growth and development and stress adaptation, however, its function in plant insect resistance is rarely studied. Summary of the invention

[0004] In view of the above deficiencies in the prior art, the present invention provides an application of a rice F-box domain protein gene OsFBX49 in improving the resistance of rice to brown planthoppers.

[0005] To achieve the above purpose, the specific technical solutions of the present invention are as follows:

[0006] In a first aspect, the present invention provides an application of an F-box gene OsFBX49 in improving resistance of rice to brown planthoppers, wherein the nucleotide sequence of the gene OsFBX49 is (i) or (ii):

[0007] (i) The nucleotide sequence shown in SEQ ID NO.1, whose ORF is 1176 bp in length and encodes 391 amino acids;

[0008] (ii) A nucleotide sequence in which one or more nucleotides are substituted, deleted and / or added to the nucleotide sequence shown in SEQ ID NO.1 and which expresses the same protein as the nucleotide sequence shown in SEQ ID NO.1.

[0009] Those skilled in the art should understand that according to the nucleotide sequence shown in SEQ ID NO. 1, replacing, deleting and / or adding one or more nucleotides to it can obtain a nucleotide sequence with the same function. For example, in the sequence under different rice backgrounds, replacing or deleting one or more nucleotides, the encoded amino acid sequence has no frameshift mutation, and only some amino acids are deleted or point mutations occur. Therefore, the nucleotide sequence of the gene OsFBX49 described in the present invention also includes the nucleotide sequence shown in SEQ ID NO. 1, which is replaced, deleted and / or added with one or more nucleotides, and expresses the same protein as the nucleotide sequence shown in SEQ ID NO. 1.

[0010] Furthermore, the gene OsFBX49 encodes the following protein (a) or (b):

[0011] (a) a protein consisting of the amino acid sequence shown in SEQ ID NO. 2;

[0012] (b) A protein derived from (a) in which the amino acid sequence shown in SEQ ID NO. 2 is substituted, deleted and / or added with one or more amino acids and has the same function as the protein composed of the amino acid sequence shown in SEQ ID NO. 2.

[0013] Those skilled in the art should understand that, under the premise of not affecting the activity of the protein encoded by the gene OsFBX49 (i.e., not in the active center of the protein), those skilled in the art can make various substitutions, additions and / or deletions of one or several amino acids to the amino acid sequence shown in SEQ ID NO. 2 to obtain an amino acid sequence with equivalent function.

[0014] The F-box gene OsFBX49 provided by the present invention is used for improving the resistance of rice to brown planthoppers. When the activity and / or expression amount of the gene OsFBX49 increases, the resistance of rice to brown planthoppers is enhanced. The enhanced resistance of rice to brown planthoppers is mainly manifested in that after the brown planthoppers feed on the rice leaf sheaths, the control rice plants die, while the plants with overexpression of the gene OsFBX49 grow normally; at the same time, after the brown planthoppers feed on the leaf sheaths of the overexpression plants, the survival rate of the brown planthoppers is reduced, the weight gain of the brown planthoppers is reduced, and the amount of honeydew secreted is reduced.

[0015] In a second aspect, the present invention provides a biomaterial, characterized in that the biomaterial contains the gene OsFBX49, and the biomaterial is recombinant DNA, an expression cassette, a transposon, a plasmid vector, a viral vector or an engineered bacterium; the nucleotide sequence of the gene OsFBX49 is (i) or (ii):

[0016] (i) the nucleotide sequence shown in SEQ ID NO.1;

[0017] (ii) A nucleotide sequence in which one or more nucleotides are substituted, deleted and / or added to the nucleotide sequence shown in SEQ ID NO.1 and which expresses the same protein as the nucleotide sequence shown in SEQ ID NO.1.

[0018] In a third aspect, a gene OsFBX49 or a use of the biological material according to claim 3 in breeding rice varieties with resistance to brown planthoppers, characterized in that the nucleotide sequence of the gene OsFBX49 is (i) or (ii):

[0019] (i) the nucleotide sequence shown in SEQ ID NO.1;

[0020] (ii) A nucleotide sequence in which one or more nucleotides are substituted, deleted and / or added to the nucleotide sequence shown in SEQ ID NO.1 and which expresses the same protein as the nucleotide sequence shown in SEQ ID NO.1.

[0021] In a fourth aspect, the present invention provides a method for enhancing resistance of rice to brown planthoppers, comprising: increasing the activity and / or expression level of the OsFBX49 gene by genetic engineering means.

[0022] Furthermore, the genetic engineering comprises: constructing an overexpression vector of the OsFBX49 gene, and transforming rice with the vector.

[0023] Furthermore, the overexpression vector is introduced into plant cells using conventional biotechnology methods, including but not limited to the use of Ti plasmids, plant virus vectors, direct DNA transformation, microinjection, and electroporation.

[0024] Furthermore, the overexpression vector is introduced into plant cells using Agrobacterium-mediated method and is used to transform rice.

[0025] In a fifth aspect, the present invention provides the use of transgenic rice obtained by the method in rice breeding.

[0026] Furthermore, the breeding methods include: transgenic, hybridization, backcrossing, selfing or asexual reproduction.

[0027] Discovery and functional verification of the OsFBX49 gene described in the present invention:

[0028] (1) Discovery process: Through transcriptome analysis of rice resistant and susceptible to brown planthoppers, we discovered a gene, OsFBX49, that was upregulated in brown planthopper-resistant rice when fed by brown planthoppers.

[0029] (2) Genetic transformation to verify function: An OsFBX49 gene overexpression vector was constructed. The vector backbone was a pCXUN vector containing the Ubiquinti promoter. The overexpression vector was introduced into susceptible rice plants using Agrobacterium EHA105-mediated genetic transformation. Transgenic plants were screened and finally, positive transgenic rice plants with overexpression of the OsFBX49 gene were obtained. Quantitative PCR analysis was performed on the T2 generation plants, and two representative lines with relatively high expression levels (OsFBX49-1 and OsFBX49-6) were selected for functional verification. The insect resistance of the T2 generation transgenic plants was identified using the seedling group method, survival rate, insect weight gain and honeydew amount. It was found that the two lines had significantly enhanced resistance to brown planthoppers.

[0030] Compared with the prior art, the present invention is beneficial in that:

[0031] The present invention increases the expression of the OsFBX49 gene in insect-susceptible rice varieties and finds that the over-expressed transgenic rice plants have enhanced insect resistance. The present invention reveals for the first time that the OsFBX49 gene enhances the resistance of rice to brown planthoppers and can be used for research on plant insect resistance. There are many OsFBX49 gene members in plant cells, which participate in multiple biological functions. Therefore, the research on the OsFBX49 gene in the present invention has a good reference value for subsequent research on other F-box domain-containing protein members. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 The quantitative PCR test results of transgenic plants; **, P < 0.01; ***, P < 0.001, ****, P < 0.0001;

[0033] Figure 2 The insect resistance phenotype of transgenic rice lines FBX49-1 and FBX49-6; Figure 2 A is a physical picture of rice after brown planthoppers have eaten it; Figure 2 B is the level of rice resistance to brown planthoppers, the smaller the value, the stronger the resistance; **, P < 0.01; ***, P < 0.001, ****, P < 0.0001.

[0034] Figure 3 The changes in survival rate, insect weight gain and honeydew amount after brown planthoppers fed on different transgenic strains; Figure 3 A shows the changes in the survival rate of brown planthoppers after feeding on different transgenic strains; Figure 3 B shows the changes in the weight gain of brown planthoppers after feeding on different transgenic strains; Figure 3 C shows the changes in honeydew amount after brown planthoppers fed on different transgenic strains; **, P < 0.01; ***, P < 0.001, ****, P < 0.0001. DETAILED DESCRIPTION

[0035] The technical solution of the present invention will be described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0036] The present invention provides an application of an F-box gene OsFBX49 in improving resistance of rice to brown planthoppers. The nucleotide sequence of the gene OsFBX49 is (i) or (ii):

[0037] (i) The nucleotide sequence shown in SEQ ID NO.1, whose ORF is 1176 bp in length and encodes 391 amino acids;

[0038] (ii) A nucleotide sequence in which one or more nucleotides are substituted, deleted and / or added to the nucleotide sequence shown in SEQ ID NO.1 and which expresses the same protein as the nucleotide sequence shown in SEQ ID NO.1.

[0039] The present invention studies the transcriptome analysis of resistant and susceptible rice before and after brown planthopper feeding, and finds that the OsFBX49 gene is significantly upregulated in insect-resistant rice after brown planthopper feeding, but there is no obvious change in susceptible rice, suggesting that the OsFBX49 gene may play a certain role in the rice insect resistance mechanism pathway. In order to study the specific role of the gene in rice resistance to brown planthoppers, the present invention transfers its overexpression vector into the insect-susceptible rice variety Nipponbare through Agrobacterium-mediated genetic transformation. The results show that the overexpressed transgenic plants show stronger resistance to brown planthoppers than the control Nipponbare plants, which is mainly manifested in that after brown planthoppers feed, the control Nipponbare withers and dies, while the transgenic plants still survive well. At the same time, the survival rate, insect weight gain and honeydew secretion of the transgenic plants after brown planthoppers feed are significantly reduced. The present invention has a good reference significance for studying gene molecular functions and breeding work.

[0040] In the following specific embodiments, unless otherwise specified, all are carried out according to conventional experimental methods and described recombination techniques (such as Sambrook et al. Molecular Cloning Laboratory Manual, Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2001, etc.), or according to the conditions recommended in the manufacturer's instructions.

[0041] Example 1

[0042] 1. Obtaining the Rice OsFBX49 Gene

[0043] Through the transcriptome sequencing ID, the full-length sequence of the OsFBX49 gene in the Nipponbare database was found. Primers were designed according to the ORF, and PCR amplification was performed using the Nipponbare rice cDNA as a template. The high-fidelity enzyme Phanta Max Super-Fidelity DNA Polymerase (Vazyme) 50µL reaction system was used for amplification. The PCR conditions were: 95°C pre-denaturation for 3 min; 95°C denaturation for 15 s, 58°C annealing extension for 30 s / kb, 30 cycles. The PCR system is as follows:

[0044]

[0045] After the PCR product was recovered, it was connected to the pMD18-T vector, and the positive clones were screened and sequenced. The sequencing results showed that the sequence of the PCR product was shown in SEQ ID NO. 1.

[0046] 2. Construction of OsFBX49 gene overexpression vector and Agrobacterium-mediated genetic transformation

[0047] 1. Construction of OsFBX49 overexpression vector

[0048] The inventors cut a section at each end of the ORF to design primers, the sequences are as follows:

[0049] F: cccggggggatccccaatactatggaagacatggttacgg (5'-3'), as shown in SEQ ID NO. 3;

[0050] R: aacccgctgttatccccaatactataagtgatccgaacgagac (5'-3'), as shown in SEQ ID NO. 4;

[0051] The vector used was pCXUN (kindly donated by Professor Wang Guoliang of Ohio State University, USA, GenBank: FJ905215.1, from a paper published in Plant Pathlology in 2009 by Songbiao Chen, Pattavipha Songkumarn, JianliLiu, Guo-Liang Wang, titled A Versatile ZeroBackground T-Vector System for Gene Cloning and Functional Genomics). The pCXUN vector was cut with XcmI, and the exogenous fragment was directly connected after adding A. After sequencing verification, the resulting vector was the Os02g27400 gene overexpression vector, which was electroporated into Agrobacterium EHA105. A single clone was picked for expansion and culture, and after PCR verification, an equal volume of 50% glycerol was added to mix and stored at -80 ℃ for later use.

[0052] 2. Genetic transformation

[0053] The OsFBX49 gene overexpression vector was introduced into the japonica rice variety Nipponbare using the Agrobacterium EHA105-mediated genetic transformation method (Hiei et al., 1994, Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant Journal 6:271-282) to obtain transgenic plants, and the positive plants were detected using the universal primers Hyg-L and Hyg-R for hygromycin.

[0054] The T2 positive plants were harvested from the flag leaves to extract RNA, which was then converted into cDNA and its expression was detected by quantitative PCR. Figure 1 The results showed that the overexpression effects of the two different transgenic lines (FBX49-1-7 and FBX49-6-9) were obvious.

[0055] 3. Phenotypic analysis of OsFBX49 overexpressing plants

[0056] 1. Seedling Group Method

[0057] Overexpressed transgenic plants FBX49-1 and FBX49-6 and control plants Nipponbare (transgenic background plants, showing insect resistance) were sown in milk tea cups, with 15 seeds per cup, and each group was repeated 3 times. When the rice reached the three-leaf stage, insects were released to ensure that there were 8 2-3-year-old brown planthopper nymphs per rice seedling. When the mortality rate of the insect-susceptible control group was above 90%, photos were taken and the resistance level of each rice plant in each cup was read. The average value was the insect resistance level of the transgenic line. The test results are shown in Figure 2 ,in, Figure 2 A is a physical picture of rice after brown planthoppers have eaten it; Figure 2 B is the level of rice resistance to brown planthoppers, and the smaller the value, the stronger the resistance. Figure 2 A It can be seen that when brown planthoppers feed on Nipponbare and cause it to wither and die, the transgenic plants FBX49-1-7 and FBX49-6-9 still survive.

[0058] 2. Determination of survival rate, insect weight gain and honeydew amount

[0059] Similarly, transgenic plants FBX49-1, FBX49-6 and control plants Nipponbare were sown in milk tea cups. Each group had 10 cups, with one plant in each cup. When the plants grew to the five-leaf stage, 20 2-3-year-old brown planthopper nymphs were inoculated into each cup. The number of brown planthoppers surviving on different plants was recorded every day, and their survival rates were calculated. The results are as follows: Figure 3 As shown in A. The results showed that the survival rate of brown planthoppers decreased significantly after feeding on overexpressed transgenic plants.

[0060] Transgenic plants FBX49-1, FBX49-6 and control plant Nipponbare were sown in milk tea cups. There were 3 cups in each group and 6 seeds in each cup. When the rice grew to the five-leaf stage, folded wax bags were tied to the rice stems, two wax bags per plant, and a brown planthopper was placed in each wax bag. After feeding for 48 hours, the wax bags were taken down, and the brown planthopper and the wax bags were weighed. The difference in weight of the brown planthopper before and after feeding was calculated as the insect weight gain of the brown planthopper, and the difference in the wax bags before and after feeding was calculated as the amount of honeydew secreted by the brown planthopper. The results were as follows: Figure 3B, 3C. The results showed that after feeding on the overexpressed transgenic plants, the weight gain and honeydew secretion of brown planthoppers were significantly reduced.

[0061] The above specific embodiments describe the implementation of the present invention in detail, but the present invention is not limited to the specific details in the above embodiments. Within the scope of the claims and technical concept of the present invention, the technical solution of the present invention can be modified and changed in many simple ways, and these simple modifications all belong to the protection scope of the present invention.

Claims

1. Application of F-box gene OsFBX49 in improving rice resistance to brown planthopper, characterized in that: The nucleotide sequence of the gene OsFBX49 is (i) or (ii): (i) the nucleotide sequence shown in SEQ ID NO.1; (ii) A nucleotide sequence in which one or more nucleotides are substituted, deleted and / or added to the nucleotide sequence shown in SEQ ID NO.1 and which expresses the same protein as the nucleotide sequence shown in SEQ ID NO.

1.

2. The use of the F-box gene OsFBX49 according to claim 1 in improving the resistance of rice to brown planthoppers, characterized in that: The gene OsFBX49 encodes the following protein (a) or (b): (a) a protein consisting of the amino acid sequence shown in SEQ ID NO. 2; (b) A protein derived from (a) in which the amino acid sequence shown in SEQ ID NO. 2 is substituted, deleted and / or added with one or more amino acids and has the same function as the protein composed of the amino acid sequence shown in SEQ ID NO.

2.

3. A biomaterial, characterized in that: The biological material contains the gene OsFBX49, and the biological material is recombinant DNA, an expression cassette, a transposon, a plasmid vector, a viral vector or an engineered bacterium; the nucleotide sequence of the gene OsFBX49 is (i) or (ii): (i) the nucleotide sequence shown in SEQ ID NO.1; (ii) A nucleotide sequence in which one or more nucleotides are substituted, deleted and / or added to the nucleotide sequence shown in SEQ ID NO.1 and which expresses the same protein as the nucleotide sequence shown in SEQ ID NO.

1.

4. A gene OsFBX49 or a use of the biological material according to claim 3 in breeding rice varieties with brown planthopper resistance, characterized in that: The nucleotide sequence of the gene OsFBX49 is (i) or (ii): (i) the nucleotide sequence shown in SEQ ID NO.1; (ii) A nucleotide sequence in which one or more nucleotides are substituted, deleted and / or added to the nucleotide sequence shown in SEQ ID NO.1 and which expresses the same protein as the nucleotide sequence shown in SEQ ID NO.

1.

5. A method for enhancing rice resistance to brown planthoppers, characterized in that: include: The activity and / or expression level of the OsFBX49 gene is increased by genetic engineering means.

6. A method for enhancing rice resistance to brown planthopper according to claim 5, characterized in that: The genetic engineering comprises: constructing an overexpression vector of the OsFBX49 gene and transforming rice with the vector.

7. Use of the transgenic rice obtained by the method of claim 5 or 6 in rice breeding.

8. The use according to claim 7, characterized in that: The breeding methods include: transgenic, hybridization, backcrossing, self-pollination or asexual reproduction.

Images