Inflammation-targeted self-assembled nanoparticles as well as preparation method and application thereof

Abstract

The invention provides inflammation-targeted self-assembled nanoparticles as well as a preparation method and application thereof, and belongs to the technical field of biological medicines. According to the preparation method disclosed by the invention, HA is taken as a targeting ligand, and an NHS / EDC cross-linking reaction can be carried out in vitro by virtue of carboxyl of HA and VP amido, so that the inflammation-targeted nano-particle HA-VP-coated NPs is successfully constructed. The nanoparticle inherits the advantage of targeted combination of HA and CD44, can exert the inhibition effect of VP on inflammation, can effectively target the VP nanoparticle to an inflammation site in an inflammation environment, improves the efficiency of delivering VP to the inflammation site, improves the targeting property on inflammation, effectively reduces the occurrence of inflammation, and has a good application prospect. And the toxic and side effects of VP on normal tissues caused by poor targeting can be reduced. The nanoparticles have a good treatment effect on lung inflammation, and are also suitable for treating related inflammation such as acute lung injury or acute respiratory distress syndrome.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and in particular relates to a nanoparticle of hyaluronic acid (HA) coupled with verteporfin (VP), and a preparation method and application thereof. Background Art

[0002] Acute lung injury (ALI) is an acute interstitial lung disease and pulmonary edema caused by various infections and traumas. It is a clinical syndrome with a very complex etiology and may even aggravate acute respiratory distress syndrome (ARDS). In terms of pathological characteristics, patients with ALI / ARDS will experience pulmonary inflammation and increased microvascular permeability, followed by pulmonary edema, hyaline membrane formation, and pulmonary interstitial fibrosis. Lung compliance, intrapulmonary shunt, and ventilation-blood flow ratio are affected by the pathological changes of ALI / ARDS, and the body will eventually experience refractory hypoxemia and respiratory distress. To date, the clinical treatment options for ALI / ARDS remain at the level of supportive care. Mechanical ventilation therapy increases the risk of ventilator-related lung injury (VILI) and aggravates lung damage. Extracorporeal membrane oxygenation (ECMO) can achieve the effect of "resting" the lungs, but it is not effective in treating ARDS. Therefore, it is urgent to develop new drugs or new strategies to deal with ALI and prevent it from developing into more serious diseases.

[0003] Biomacromolecules can be self-assembled into nano drug delivery systems in vitro using chemical methods. NHS (N-hydroxysuccinimide) is a common coupling agent that often reacts with amino compounds. EDC (1-ethyl-3-(3-dimethylaminopropyl) carbodiimide) can be used as a coupling agent for the reaction of carboxyl groups with amine groups or phenols. The NHS / EDC cross-linking reaction is carried out in MES (morpholineethanesulfonic acid) buffer at pH 5.5. EDC first reacts with carboxyl groups to form active O-acylurea intermediates, which are easily replaced by nucleophilic attacks of primary amino groups in the reaction mixture. Primary amines form amide bonds with the original carboxyl groups, and the byproducts produced are eventually released in the form of soluble urea derivatives. O-acylisourea intermediates are unstable in aqueous solution and cannot react with amines, which leads to hydrolysis of the intermediates, regeneration of carboxyl groups, and release of n-unsubstituted urea.

[0004] HA has unique physicochemical and physiological properties, which make it widely used in facial treatment and biomedical fields. Inflammation sites are usually accompanied by highly expressed CD44 receptors on the surface of activated macrophages. HA can reach the inflammatory site through targeted delivery by binding to CD44 receptors. VP is a Yes-associated protein (YAP) inhibitor. Related studies have shown that the Hippo signaling transcription factor YAP maintains the stability of NLRP3 by blocking the binding between NLRP3 and the E3 ubiquitin ligase β-TrCP1, thereby promoting the activation of NLRP3 inflammasomes and promoting the occurrence of inflammation.

[0005] However, there are currently no reports on HA-based inflammation-targeted self-assembled nanoparticles and related technologies that can be used to treat ALI. Summary of the invention

[0006] In order to solve the above technical problems, the present invention provides an inflammation-targeted self-assembled nanoparticle and its preparation method and application. The present invention uses HA as a targeting ligand, and utilizes its carboxyl group and VP amine group to undergo NHS / EDC cross-linking reaction in vitro, and successfully constructs an inflammation-targeted nanoparticle HA-VP@NPs. The nanoparticle inherits the advantages of HA and CD44 targeted binding, and can exert the inhibitory effect of VP on inflammation. It can effectively target VP nanoparticles to the inflammation site in an inflammatory environment, improve the efficiency of VP delivery to the inflammation site, improve the targeting of inflammation, and effectively reduce the occurrence of inflammation while reducing the toxic and side effects of VP on normal tissues caused by weak targeting. The nanoparticles in the present invention have a good therapeutic effect on lung inflammation, and are also suitable for the treatment of related inflammations such as acute lung injury or acute respiratory distress syndrome.

[0007] In order to achieve the above object, the present invention adopts the following technical solutions:

[0008] The present invention provides an inflammation-targeted self-assembled nanoparticle, which is constructed by using hyaluronic acid (HA) as a targeting ligand and utilizing the NHS / EDC cross-linking reaction between the carboxyl group of HA and the amine group of verteporfin (VP) in vitro; the relative molecular mass of HA is 3 to 15 kDa, and the molar ratio of HA to VP is 0.5:1 to 4:1.

[0009] The particle size of the nanoparticles provided in the present invention is 200-300 nm.

[0010] The HA in the present invention is a hydrophilic biomacromolecule.

[0011] Furthermore, the relative molecular mass of the HA is 3 to 5 kDa.

[0012] Furthermore, the relative molecular mass of the HA is 3kDa.

[0013] The VP in the present invention has a MW of 1437.5884 and is hydrophobic.

[0014] Furthermore, the molar ratio of the HA to the VP is 0.5:1 to 2:1.

[0015] Furthermore, the molar ratio of the HA to the VP is 1:1.

[0016] In the present invention, since VP is hydrophobic and HA has good water solubility, the amphiphilic complex HA-VP can self-assemble into nanoparticles with VP core and HA in the hydrophilic layer on the surface in aqueous solution.

[0017] The present invention also provides a method for preparing the self-assembled nanoparticles, comprising the following steps:

[0018] (1) HA activation with EDC and NHS;

[0019] (2) adding VP into the reaction system in (1);

[0020] (3) The nanoparticles obtained by dialysis purification (2) are the self-assembled nanoparticles HA-VP@NPs.

[0021] Furthermore, the step (1) includes the following steps:

[0022] (I) preparing a MES buffer solution with a concentration of 4 to 6 mg / mL and a pH of 5.0 to 6.0;

[0023] (II) Weigh HA, EDC and NHS respectively and add them into the buffer solution, wherein the molar ratio of HA, EDC and NHS is (0.8-1.2):(9-11):(9-11), and stir in the dark at room temperature for 1.5-2.5 hours.

[0024] Furthermore, the concentration of the MES buffer solution is 5 mg / mL, and the pH is 5.5; the molar ratio of HA, EDC, and NHS is 1:10:10, and the mixture is stirred at room temperature in the dark for 2 hours.

[0025] Furthermore, in the step (2), VP is added to a molar ratio of VP to HA of 0.5:1 to 2:1.

[0026] Furthermore, the VP is added so that the molar ratio of the VP to the HA is 1:1.

[0027] Furthermore, in step (3), the dialysis bag has a molecular weight cutoff of 3000 to 4000, ultrapure water is used as the dialysis fluid, the dialysis fluid is replaced 6 to 8 times, and the dialysis is performed for 1.5 to 2.5 hours after the last replacement, followed by freeze-drying, and the obtained powder is HA-VP@NPs.

[0028] Furthermore, the dialysis bag has a cutoff MW of 3500, and the dialysate is replaced 7 times at the following time points: 2h, 4h, 6h, 8h, 12h, 24h, and 26h, and the dialysis is continued for 2h after the last replacement of the dialysate.

[0029] The present invention also provides an application of the self-assembled nanoparticles or the preparation method in the preparation of drugs for preventing and treating inflammation-related diseases.

[0030] Furthermore, the inflammation-related disease is a lung inflammation-related disease.

[0031] Furthermore, the inflammation-related disease is acute lung injury and / or acute respiratory distress syndrome.

[0032] Compared with the prior art, the present invention has the following technical effects:

[0033] The present invention uses HA as a targeting ligand, and utilizes its carboxyl group and VP amine group to undergo NHS / EDC cross-linking reaction in vitro, and successfully constructs an inflammation-targeted nanoparticle HA-VP@NPs. The nanoparticle inherits the advantages of HA and CD44 targeted binding, and can exert the inhibitory effect of VP on inflammation, and can effectively target VP nanoparticles to the inflammation site in an inflammatory environment, improve the efficiency of VP delivery to the inflammation site, improve the targeting of inflammation, and while effectively reducing the occurrence of inflammation, it can also reduce the toxic and side effects of VP on normal tissues caused by weak targeting. The nanoparticles in the present invention have a good therapeutic effect on lung inflammation, and are also suitable for the treatment of related inflammations such as acute lung injury or acute respiratory distress syndrome. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 It is a schematic diagram of the overall experimental process of the present invention;

[0035] Figure 2 The particle size, PDI and binding rate analysis diagram of HA-VP@NPs synthesized in Example 1 of the present invention, wherein: Figure 2 A is the particle size diagram with n(HA):n(VP)=0.5:1; Figure 2 B is the particle size diagram with n(HA):n(VP)=1:1; Figure 2 C is the particle size diagram with n(HA):n(VP)=2:1; Figure 2 D is the particle size diagram with n(HA):n(VP)=3:1;

[0036] Figure 2 E is the particle size diagram with n(HA):n(VP)=4:1; Figure 2 F is the binding rate analysis diagram of HA-VP@NPs related to the ratio of n(HA) / n(VP);

[0037] Figure 3 The particle size and binding rate analysis diagram of HA-VP@NPs synthesized from HA and VP of different MW in Example 2 of the present invention, wherein: Figure 3 A is the particle size diagram of HA-VP@NPs synthesized when MW(HA)=3kDA; Figure 3 B is the particle size diagram of HA-VP@NPs synthesized when MW(HA)=5kDA; Figure 3 C is the particle size diagram of HA-VP@NPs synthesized when MW(HA)=10kDA; Figure 3 D is the particle size diagram of HA-VP@NPs synthesized when MW(HA)=3kDA; Figure 3 E is the binding rate analysis diagram of HA-VP@NPs synthesized from HA of different MW and VP;

[0038] Figure 4 This is an analysis diagram of the inhibitory effect of HA-VP@NPs synthesized from HA and VP of different MW on NLRP3 protein in Example 2 of the present invention;

[0039] Figure 5 This is an analysis diagram of the inhibitory effect of HA-VP@NPs synthesized from HA and VP of different MW on IL-6, TNF-α and IL-1β in Example 2 of the present invention;

[0040] Figure 6 This is an identification diagram of HA-VP@NPs synthesized when n(HA):n(VP)=1:1 in Example 3 of the present invention, wherein: Figure 6 A is the line graph of the changes in particle size and PDI of nanoparticles HA-VP@NPs within 72 h; Figure 6 B is its potential diagram; Figure 6 C is an electron microscope image; Figure 6 D is the Fourier transform infrared spectrum;

[0041] Figure 7 This is a diagram of the cellular uptake of HA-VP@NPs in Example 4 of the present invention, wherein: Figure 7 A is the expression of CD44 receptor on the surface of M1 macrophages, M0 macrophages, MLE-12 cells, and L929 cells; Figure 7 B is the flow cytometry fluorescence intensity graph of M1 macrophages, M0 macrophages, MLE-12 cells, and L929 cells after incubation with HA-VP@NPs under the same conditions; Figure 7 C is the confocal analysis of HA-VP@NPs uptake by M1 macrophages, MLE-12 cells, and L929 cells;

[0042] Figure 8This is a diagram of the in vitro anti-inflammatory effect of HA-VP@NPs in Example 5 of the present invention, wherein: Figure 8 A is an analysis of the inhibitory effects of HA-VP@NPs on IL-6, TNF-α and IL-1β of macrophages at different concentrations; Figure 8 B is the expression analysis diagram of IL-6, TNF-α and IL-1β in macrophages after drug administration in different groups;

[0043] Fig. 9 This is the in vivo biodistribution diagram of the nanoparticles HA-VP@NPs in Example 6 of the present invention, wherein: Fig. 9 A is a small animal live imaging image; Fig. 9 B is the in vivo imaging of the main organs of small animals;

[0044] Fig.10 This is an analysis diagram of the inhibitory effect of HA-VP@NPs on IL-6, TNF-α and IL-1β in vivo in Example 7 of the present invention;

[0045] Fig.11 This is a hematoxylin-eosin (H&E) staining image of lung tissue sections in Example 7 of the present invention. DETAILED DESCRIPTION

[0046] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Without departing from the spirit and essence of the present invention, modifications or replacements made to the method, steps or conditions of the present invention all belong to the scope of the present invention. The reagents and instruments used in the following examples can all be obtained commercially, and the methods used in the examples are consistent with the conventional methods unless otherwise specified.

[0047] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meanings as those commonly understood by those skilled in the art of the present invention. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0048] Before describing the technical solution of the present invention, the terms used in the present invention are defined as follows:

[0049] The term “HA-VP@NPs” refers to nanoparticles of hyaluronic acid cross-linked with verteporfin.

[0050] The term "MW" means: relative molecular mass.

[0051] The overall experimental process of the present invention is as follows Figure 1 As shown,

[0052] The technical solution of the present invention is further described in detail below in conjunction with embodiments.

[0053] Example 1

[0054] This embodiment provides a method for preparing self-assembled nanoparticles, which uses hyaluronic acid (HA) as a targeting ligand and is constructed by NHS / EDC cross-linking reaction between its carboxyl group and the amine group of verteporfin (VP) in vitro, wherein HA (Xi'an Haoran Biotechnology Co., Ltd., R-HF-010-3k) is a hydrophilic biomacromolecule with a MW of 3000, and VP (Merrill, M71080) has a MW of 1437.5884 and is hydrophobic. The specific steps are as follows:

[0055] (1) HA was activated with EDC (McLean, N808856) and NHS (McLean, N811124);

[0056] (I) preparing a MES buffer solution with a concentration of 5 mg / mL and a pH of 5.5 (McLean, M813439-100g);

[0057] (II) Weigh HA, EDC, and NHS separately and add them into the buffer solution, wherein the molar ratio of HA, EDC, and NHS is 1:10:10, and stir at room temperature in the dark for 2 h;

[0058] (2) adding VP into the reaction system in (1);

[0059] (3) A dialysis bag with a cutoff MW of 3500 was used, and ultrapure water was used as the dialysate. The time points for changing the dialysate were: 2h, 4h, 6h, 8h, 12h, 24h, and 26h. After the last change of the dialysate, the dialyzer was dialyzed for 2h and freeze-dried. The resulting powder was HA-VP@NPs.

[0060] In order to screen out the best combination ratio of HA and VP, in this example, different ratios of HA were added to react with VP to prepare nanoparticles.

[0061] Experimental method: The molar ratios of HA and VP were 0.5:1, 1:1, 1.5:1, 2:1, 3:1, and 4:1, respectively. After the nanoparticles were prepared, the particle sizes of the nanoparticles prepared at different feed ratios were determined by a Malvern particle size analyzer, and the binding rate of HA and VP was determined by the CTAB turbidity method.

[0062] Results: Reference Figure 2 AE, the particle size of the nanoparticles HA-VP@NPs prepared at different feed ratios is less than 300nm, and Figure 2 F shows that when n(HA):n(VP)=1:1, the binding rate of HA-VP@NPs is the highest (~89%), so the HA-VP@NPs synthesized at this ratio were selected for subsequent studies.

[0063] Example 2

[0064] This example is used to further verify the anti-inflammatory effect of nanoparticles HA-VP@NPs synthesized by reacting HA of different MW with VP in vivo.

[0065] Experimental methods:

[0066] 1. Synthesis and characterization of nanoparticles

[0067] HA with MW of 3kDA, 5kDa, 10kDa and 15kDa were selected and participated in EDC / NHS reaction according to n(HA):n(VP)=1:1 (other methods were the same as in Example 1). Nanoparticles were obtained after purification by dialysis. The particle size of the nanoparticles was measured by Malvern particle size analyzer, and the binding rate was measured by CTAB turbidity method.

[0068] Results: Reference Figure 3 When the MW of AD and HA is 3kDA (Xi'an Haoran Biotechnology Co., Ltd., R-HF-010-3k), 5kDa (Xi'an Haoran Biotechnology Co., Ltd., R-Y065-5K), 10kDa (Xi'an Haoran Biotechnology Co., Ltd., R-Y065-10k), and 15kDa (Xi'an Haoran Biotechnology Co., Ltd., R-Y065-15k), the particle size and PDI are 230.1nm and 0.397, 274.9nm and 0.306, 336.5nm and 0.294, and 360.0nm and 0.322, respectively. Figure 3 E, The binding rate of HA-VP@NPs of each MW was ≥70%.

[0069] 2. In vivo anti-inflammatory evaluation of nanoparticles

[0070] The cells were seeded in 6-well plates at a density of 25 × 10 4 After LPS induction, different concentrations of HA-VP were given to each well. After incubation in the dark for 24 hours, the cells were collected and lysed with RIPA buffer, and the protein expression was determined by microplate reader. All samples were diluted with SDS-PAGE loading buffer and boiled in boiling water for 5 minutes. A 10% SDS-PAGE gel was prepared. After electrophoresis, the separation gel was transferred to a PVDF membrane, blocked with skim milk powder at room temperature for 1.5 hours, washed with TBST, and then incubated with a 1:1000 primary antibody at 4°C for 12 hours. The membrane was washed and the corresponding secondary antibody was incubated with the PVDF membrane. Finally, the enhanced chemiluminescence (ECL) reagent and Amersham 600 imager were used for imaging.

[0071] Results: Reference Figure 4 , HA-VP@NPs of each MW had a significant inhibitory effect on the expression of NLRP3 protein.

[0072] 3. Real-time fluorescence quantitative PCR analysis to determine inflammatory factors

[0073] RNA from macrophages was extracted using the Universal RNA Extraction Kit II. Reverse transcription was performed using the Evo M-MLV Reverse Transcription Reagent Premix. The SYBR Green Pro TaqHS Premix qPCR Kit IV was used to spot the plate, and the Ct value of each well was detected using the LightCycler 480II system on a real-time fluorescence quantitative PCR instrument. The relative expression of RNA was calculated using the △△Ct method. The primer sequences are shown in Table 1 below.

[0074] Table 1 Primer sequences

[0075]

[0076] IL-6TTCCATCCAGTTGCCTTCTTG(SEQ ID NO.3)TTGGGAGTGGTATCCTCTGTGA(SEQ IDNO.4)

[0077] IL-1βCTTCAGGCAGGCAGTATCACTCAT(SEQ ID NO.5)TCTAATGGGAACGTCACACACCAG(SEQ ID NO.6)

[0078] TNF - αCCCTCACACTCAGATCATCTTCT(SEQ ID NO.7)GCTACGACGTGGGCTACAG(SEQ ID NO.8)

[0079] Results: Reference Figure 5 The PBS group was the LPS-treated group. The expression levels of cellular proinflammatory factors were significantly upregulated after LPS treatment. HA-VP@NPs with different kDA had a significant inhibitory effect on the expression of IL-6, TNF-α and IL-β, and the HA-VP@NPs synthesized from 3kDA HA had the best inhibitory effect. Therefore, HA-VP@NPs synthesized from 3kDA HA and VP were selected for subsequent studies.

[0080] Example 3

[0081] A group of nanoparticles with the highest binding rate was selected for characterization, that is, nanoparticles HA-VP@NPs were synthesized when the ratio n(HA):n(VP) was 1:1. The characterization content included: Malvern particle sizer to measure its potential, the change of particle size and PDI within 72 hours, transmission electron microscopy to observe its morphology, FTIR Fourier transform infrared spectra to measure its infrared spectrum, and NMR superconducting nuclear magnetic resonance to measure its H spectrum.

[0082] Experimental methods:

[0083] HA:VP:EDC:NHS were weighed in a ratio of 1:1:10:10 to synthesize nanoparticles HA-VP@NPs. After purification by dialysis, HA-VP@NPs were uniformly dispersed in ultrapure water. The potential was measured using a Malvern particle size analyzer, and the changes in PDI and particle size within 72 hours were observed.

[0084] 10 μL of HA-VP@NPs nanoparticle samples were dropped onto the electron microscope copper grid. After standing for 10 minutes, excess liquid was removed along the edge of the copper grid using absorbent paper, and the copper grid was left to dry overnight at room temperature. Electron microscope photos of the samples were taken according to the transmission electron microscope operating procedures to obtain the morphological characteristics of the nanoparticles of each sample.

[0085] The HA-VP@NPs sample was dissolved in deuterated DMSO and tested in an infrared transmission cell.

[0086] Results: Reference Figure 6 A, The particle size and PDI of HA-VP@NPs were measured within 72 h, indicating good stability. Figure 6 As shown in B, the zeta potential drops from ~-3mV to ~-30mV, indicating that its stability is improved. The morphology of the nanoparticles was observed under a transmission electron microscope (TEM). Figure 6 It is spherical in shape as shown in C. Figure 6 In the EDC / NHS reaction, the amine group of VP and the carboxyl group of HA generate a new tertiary amide structure with a wave number of 1644 cm -1 .

[0087] Example 4

[0088] This example is used to identify the cellular uptake of nanoparticles HA-VP@NPs.

[0089] Experimental methods:

[0090] M0 macrophages, M1 macrophages, MLE-12 cells, and L929 cells were inoculated into 6-well plates, respectively. After the cells adhered to the wall and grew to 80%, the cells were digested with trypsin, centrifuged at 3000 rpm for 5 min, the supernatant was discarded, and the cells were blown evenly with 1 ml of PBS. After centrifugation at 3000 rpm for 5 min, CD44 antibodies were added, and the cells were incubated in the dark for 30 min. The expression of CD44 on the surface of each cell membrane was observed under ImageStreamX imaging flow cytometry (Amnis, USA).

[0091] Use 1×10 5M1 macrophages, MLE-12 cells, and L929 cells with the same cell density were inoculated into a 35nm confocal dish. When the cell attachment grew to 80%, 4ug / mL was administered respectively. After incubation in the dark for 12 hours, the cell imaging was observed using a LSM880 laser confocal microscope (Carl Zeiss, Germany). Macrophages were inoculated into six-well plates in the same way and incubated at the same drug concentration. After 12 hours, the uptake of HA-VP@NPs by macrophages was observed under ImageStreamX imaging flow cytometry.

[0092] Results: Referring to Result 7A, it can be seen that the expression of CD44 protein on the surface of M1 macrophages is higher than that of MLE-12 cells and L929 cells. Figure 7 B shows that M1 macrophages express the most CD44, followed by MLE-12 cells, and L929 cells express the least CD44. Figure 7 C shows that M1 macrophages have the best uptake ability for HA-VP@NPs, followed by MLE-12 cells, and L929 cells have the lowest uptake ability for drugs.

[0093] Example 5

[0094] This example is used to identify the anti-inflammatory effect of nanoparticles HA-VP@NPs in vitro, and the expression levels of inflammatory factors such as IL-6, IL-1β, and TNF-α are determined by real-time fluorescence quantitative PCR analysis.

[0095] Experimental method: The real-time fluorescence quantitative PCR analysis method for determining inflammatory factors in Example 2 was used to determine the expression of pro-inflammatory factors such as IL-6, TNF-α and IL-β.

[0096] Results: Reference Figure 8 A, After LPS treatment, the levels of cellular proinflammatory factors were significantly upregulated, HA-VP@NPs had a significant inhibitory effect on the expression of IL-6, TNF-α, and IL-β, and the gene expression levels of inflammatory factors decreased in a dose-dependent manner. Figure 8 B shows that VP also has an inhibitory effect on the mRNA expression of IL-6, TNF-α and IL-β, and the inhibitory effect of HA-VP@NPs is slightly stronger than that of VP. These results indicate that HA-VP@NPs can effectively reduce the expression of proinflammatory factors, thereby reducing the occurrence of inflammation.

[0097] Example 6

[0098] This example is used to analyze the targeting effect of nanoparticles HA-VP@NPs in animals in vivo.

[0099] Experimental method: The experimental samples were divided into saline group, HA group, VP group, and HA-VP@NPs group. A small animal in vivo imaging device was used to detect the specific distribution of samples in mice.

[0100] After 4 hours of LPS instillation, the mice were randomly divided into 4 groups, 3 mice in each group, and mice not treated with LPS were used as negative controls. A group of mice treated with LPS were injected with normal saline through the tail vein as positive controls. The other three groups were injected with equal amounts of HA, VP, and HA-VP@NPs through the tail vein, and the images were detected by IVIS LuminaXRMS Series III (XRMS, USA) at 1, 4, 8, 12, 24, and 48 hours. After the detection, the mice in each group were dissected, and their main organs (heart, liver, spleen, lung, and kidney) were taken and imaged to detect their in vitro fluorescence intensity using the same method, and the fluorescence analysis was performed using the in vivo Image V4.5.5 software.

[0101] Results: Reference Fig. 9 A, In normal mice, HA-VP@NPs mainly accumulated in the liver, while in the LPS-infected pneumonia mouse model, VP mainly accumulated in the mouse liver. In addition, due to the occurrence of lung inflammation, CD44 is highly expressed on the surface of macrophages, and HA-VP@NPs can also accumulate in the inflammatory site of the lung. After 24 hours, the fluorescence in the mouse body decreases rapidly. Fig. 9 B, The in vitro fluorescence results of major organs such as heart, liver, spleen, lung, and kidney showed that VP in pneumonia mice and HA-VP@NPs in normal mice were mainly concentrated in the liver, while HA-VP@NPs in pneumonia mice were mainly concentrated in the lungs. These results indicate that HA-VP@NPs have inflammatory targeting in vivo.

[0102] Example 7

[0103] This example is used to analyze the anti-inflammatory effect of nanoparticles HA-VP@NPs in vivo.

[0104] Experimental methods:

[0105] 1. Real-time fluorescence quantitative PCR analysis to determine inflammatory factors

[0106] BALB / c mice were randomly divided into 5 groups: Normol group, saline group, HA group, VP group, and HA-VP@NPs group. Except for the Normol group, the other mice were instilled with 5 mg / kg lipopolysaccharide (LPS) (Sigma-Aldrich, USA) through the trachea to induce acute lung injury (ALI) and pneumonia in mice. Each group of mice was treated by tail vein injection of different drugs (saline, HA, VP, HA-VP@NPs) in equal amounts. After treatment, the lung tissue of each mouse was collected, and the mRNA levels of cytokines in the lung tissue were detected by real-time fluorescence quantitative PCR.

[0107] Results: Reference Fig.10 It can be seen that HA-VP@NPs have a strong inhibitory effect on the expression of proinflammatory factors IL-6, TNF-α and IL-1β. These results indicate that HA-VP@NPs can reduce the level of inflammation in mice.

[0108] 2. Hematoxylin-eosin (H&E) staining

[0109] After treatment, lung tissues of mice in each group were obtained. The mouse tissues were fixed in 4% paraformaldehyde, embedded in paraffin, and lung tissue sections were stained with hematoxylin-eosin (H&E).

[0110] Results: Reference Fig.11 The results of H&E sections of lung tissue showed that the lung tissue of ALI mice was obviously damaged, and the therapeutic effect of HA was not obvious. VP and HA-VP@NPs could significantly improve the lung damage of mice, and the latter had a more obvious effect.

[0111] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. An inflammation-targeted self-assembled nanoparticle, characterized in that: It uses hyaluronic acid (HA) as a targeting ligand, and utilizes its carboxyl group and the amine group of verteporfin (VP) to undergo NHS / EDC cross-linking reaction in vitro; the relative molecular mass of the HA is 3 to 15 kDa, and the molar ratio of the HA to VP is 0.5:1 to 4:

1.

2. The self-assembled nanoparticle according to claim 1, characterized in that The relative molecular mass of the HA is 3-5 kDa.

3. The self-assembled nanoparticle according to claim 2, characterized in that The molar ratio of the HA to the VP is 0.5:1 to 2:

1.

4. The method for preparing the self-assembled nanoparticles according to any one of claims 1 to 3, characterized in that: The following steps are involved: (1) HA was activated with 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) and N-hydroxysuccinimide (NHS); (2) adding VP into the reaction system in (1); (3) The nanoparticles obtained by dialysis purification (2) are the self-assembled nanoparticles HA-VP@NPs.

5. The preparation method according to claim 4, characterized in that: The step (1) comprises the following steps: (I) preparing a MES buffer solution with a concentration of 4 to 6 mg / mL and a pH of 5.0 to 6.0; (II) Weigh HA, EDC and NHS respectively and add them into the buffer solution, wherein the molar ratio of HA, EDC and NHS is (0.8-1.2):(9-11):(9-11), and stir in the dark at room temperature for 1.5-2.5 hours.

6. The preparation method according to claim 4, characterized in that: In the step (2), VP is added to a molar ratio of VP to HA of 0.5:1 to 2:

1.

7. The preparation method according to claim 4, characterized in that: In the step (3), the dialysis bag has a molecular weight cutoff of 3000 to 4000, ultrapure water is used as the dialysis fluid, the dialysis fluid is replaced 6 to 8 times, and the dialysis is performed for 1.5 to 2.5 hours after the last replacement, followed by freeze drying, and the obtained powder is HA-VP@NPs.

8. Use of the self-assembled nanoparticles according to any one of claims 1 to 3 or the preparation method according to any one of claims 4 to 7 in the preparation of drugs for the prevention and treatment of inflammation-related diseases.

9. The use according to claim 8, characterized in that: The inflammation-related disease is a lung inflammation-related disease.

10. The use according to claim 8, characterized in that: The inflammation-related disease is acute lung injury and / or acute respiratory distress syndrome.

Images