Corn internode length regulation gene ZmIL1, expression product and excellent haplotype thereof, and application of corn internode length regulation gene ZmIL1 in corn breeding

Abstract

The invention relates to a corn internode length regulation gene ZmIL1, and an expression product, an excellent haplotype and application thereof in corn breeding, and belongs to the technical field of genetic engineering breeding. The nucleotide sequence of the gene ZmIL1 is as shown in SEQ ID NO. 1. According to the expression product of the corn internode length regulation gene ZmIL1, the expression product of the gene ZmIL1 is a protein coded by the gene ZmIL1, and the amino acid sequence of the protein is as shown in SEQ ID NO. 2. According to the four haplotypes of the corn internode length regulation gene ZmIL1, the nucleotide sequences of the four haplotypes are as shown in SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6, and the SEQ ID NO.5 is an excellent haplotype. The invention further provides application of the gene ZmIL1 for regulating and controlling the internode length of the corn in genetic breeding of the corn and application of the gene ZmIL1 in corn production in Huang-Huai-Hai regions of China. The application method of the corn internode length regulation gene ZmIL1 in corn breeding practice can be popularized and applied to other related genes.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering breeding, and in particular to a corn internode length regulating gene ZmIL1, its expression product, excellent haplotype and application in corn breeding. Background Art

[0002] Ideal plant type is of great significance for improving the photosynthetic efficiency of crops, planting density, enhancing lodging resistance and adapting to mechanized harvesting. As an important food crop, the stability of corn yield is crucial to my country's food security and social stability. In recent years, the frequent occurrence of extreme weather has brought huge challenges to corn production. Plant height is one of the key traits of the ideal corn type, which is determined by the number of nodes and internode length. By appropriately reducing the internode length, the purpose of moderately reducing plant height can be achieved, thereby enhancing corn's lodging resistance and improving the mechanized harvesting index, which is conducive to the stability or improvement of the final yield.

[0003] Mining genes that regulate internode length in maize can provide genetic resources for dwarfing breeding. However, most of the plant height genes that have been cloned so far will lead to excessive dwarfing, affecting the normal growth and development of maize, and have low actual utilization value. In response to this problem, the present invention can provide technical support and application reference for moderate dwarfing maize breeding and production practice. Summary of the invention

[0004] In order to achieve the goal of moderate dwarfing breeding, enhance the lodging resistance of corn and improve the mechanized harvest index, the present invention provides a method for identifying and screening candidate genes for regulating corn internode length. In addition, the present invention also relates to the expression product, excellent haplotype and application of the corn internode length regulating gene ZmIL1 in corn breeding. The application method of the corn internode length regulating gene ZmIL1 in corn breeding practice can be extended to the application of other related genes.

[0005] To achieve the above object, the technical solution adopted by the present invention is:

[0006] The present invention provides a maize internode length regulating gene ZmIL1, and the nucleotide sequence of the gene ZmIL1 is shown as SEQ ID NO.1.

[0007] The present invention also provides an expression product of the maize internode length regulating gene ZmIL1. The expression product of the gene ZmIL1 is the protein encoded by the gene ZmIL1. The amino acid sequence of the protein is shown in SEQ ID NO.2.

[0008] The present invention also provides four haplotypes of the maize internode length regulatory gene ZmIL1, and the nucleotide sequences of the four haplotypes are shown as SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6, wherein SEQ ID NO.5 is an excellent haplotype.

[0009] The present invention also provides application of the corn internode length regulatory gene ZmIL1 in corn genetic breeding.

[0010] The present invention also provides application of the maize internode length regulating gene ZmIL1 in maize production in the Huanghuaihai region of China.

[0011] Furthermore, the excellent haplotype of the maize internode length regulatory gene ZmIL1 is used in maize production in the Huanghuaihai region of China.

[0012] Compared with the prior art, the present invention has the following beneficial effects:

[0013] 1. The localization method used in the present invention for identifying and screening candidate genes regulating maize internode length is rigorous and accurate, and can be extended to the identification and screening of genes regulating different traits of other crops.

[0014] 2. The excellent haplotype of the maize internode length regulatory gene ZmIL1 of the present invention is suitable for identifying and screening moderately dwarfed maize inbred lines, has high practical value, and provides excellent germplasm resources for breeding new dwarf maize varieties.

[0015] 3. ZmIL1 identified in the present invention was selected in the process of modern corn breeding in China, indicating that ZmIL1 has a high utilization value in breeding.

[0016] 3. The nucleotide sequence of the ZmIL1 gene screened by the present invention is shown in SEQ ID NO.1, and the protein sequence encoded by it is shown in SEQ ID NO.2. Based on the SNP markers in the ZmIL1 gene, it was found that the gene has been used in corn production in the Huanghuaihai region of China. These results show that the ZmIL1 gene can be used in corn genetic breeding, which has a positive significance for improving corn plant type and increasing yield, and is also conducive to the healthy development of the corn industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the prior art description. Obviously, the drawings described below are only some embodiments of the present invention, and for ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0018] Figure 1 Manhattan plot and QQ plot (Quantile-Quantile Plot) generated by genome-wide association study (GWAS) of maize internode length using Q+K model, where:

[0019] Panel A shows the Manhattan plot generated by genome-wide association analysis of 11 maize internode length-related traits;

[0020] Panel B shows the QQ plot generated by genome-wide association analysis of the length of the third internode on the ear.

[0021] Figure 2 The results of GO (Gene Ontology) enrichment analysis and KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway enrichment analysis of maize internode length-related genes located using the GWAS method, among which:

[0022] Figure A shows the results of GO enrichment analysis.

[0023] Figure B shows the results of KEGG pathway enrichment analysis.

[0024] Figure 3 The expression status of 15 candidate genes identified by GWAS in tissues related to maize internode development.

[0025] Figure 4 The metabolic pathways and co-expression networks of maize internode length-related genes screened by GWAS, including:

[0026] Panel A shows the metabolic pathway.

[0027] Panel B shows the co-expression network.

[0028] Figure 5 This is the linkage disequilibrium analysis of the maize internode length regulatory gene ZmIL1 and the difference analysis between different haplotypes, among which,

[0029] Panel A shows linkage disequilibrium analysis.

[0030] Figure B represents haplotype analysis, where Hap1, Hap2, Hap3, and Hap4 on the horizontal axis represent four different haplotypes, respectively.

[0031] Figure 6 These are plant height-related genes that have been selected during corn breeding over the past 60 years.

[0032] Figure 7The internode length comparison of commercial corn hybrids and their parents widely planted in the Huanghuaihai region and the sequence comparative analysis of ZmIL1 were carried out.

[0033] Figure A shows the comparison of differences in plant type-related traits between different hybrids and their parents.

[0034] Panel B shows the sequence comparison analysis of ZmIL1 between different hybrids and their parents. DETAILED DESCRIPTION

[0035] The specific embodiments of the present invention are described in detail below, but it should be understood that the protection scope of the present invention is not limited by the specific embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work belong to the scope of protection of the present invention. The experimental methods described in the embodiments of the present invention are conventional methods unless otherwise specified, and the materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0036] Example 1

[0037] Screening and identification of the maize internode length regulatory gene ZmIL1.

[0038] 1. Experimental Materials

[0039] 1. The maize-associated population used in this experiment was provided by Professor Yan Jianbing of Huazhong Agricultural University, which includes 288 maize inbred lines with rich genetic variation, of which 131 are from tropical / subtropical regions and 157 are from temperate regions.

[0040] 2. Experimental Methods

[0041] 1. Genetic population selection: an associated population constructed from 288 maize inbred lines.

[0042] 2. Acquisition of phenotypic data:

[0043] (1) The associated population was planted in Lianhuatang Cotton Seed Farm, Yongcheng City, Henan Province in 2018, and in the Modern Agricultural Science and Education Park of Henan Agricultural University, Yuanyang County, Henan Province in 2018 and 2020. Two biological replicates were set up in each environment, with a planting density of 60,000 plants / hectare. Conventional corn planting and management methods were used in the field.

[0044] (2) After the corn is fully mature, the whole stalk is harvested and the length of the internode where the first ear is located, the five internodes above and below the first ear (a total of 11 internodes) is measured. Five corn plants with uniform growth are selected from each inbred line for measurement. These traits are collectively referred to as internode length-related traits and are used for subsequent analysis.

[0045] (3) Combining the phenotypic data of 288 inbred lines from two years and three environments, the best linear unbiased prediction (BLUP) was calculated using the lem4 package in the R language software. The BLUP values ​​and the phenotypic data of internode length-related traits in each environment were used for genome-wide association analysis.

[0046] 3. Identification and analysis of candidate genes for internode length

[0047] (1) Using the BLUP values ​​of maize internode length-related traits to conduct GWAS and draw Manhattan and QQ plots ( Figure 1 ). The association population used in the present invention has previously used Illumina Maize SNP50 chips, simplified genome sequencing, Affymetrix chips, and RNA-seq to sequence the whole genome of each maize inbred line. According to the genotyping results, about 1.25 million high-quality SNP markers (abbreviated as 1.25M SNPs) with a minimum allele frequency ≥ 5% were finally obtained and mapped to the B73 RefGen_V2 reference genome. Considering the high linkage disequilibrium (LD) between some markers, the adjusted threshold P≤10 -5 As the basis for judging whether SNP-phenotype is significantly associated.

[0048] In Tassel 3.0 software, a mixed linear model (MLM) with Q+K (controlling population structure and kinship) was used to perform GWAS to obtain significant SNPs. LD analysis showed that the linkage disequilibrium decay distance of this set of markers was 30Kb, so the 60kb range of 30Kb upstream and downstream of the significant SNP was defined as a significant site, and all genes within the significant site were screened based on the B73RefGen_V2 genome information.

[0049] (2) Perform GO enrichment analysis and KEGG enrichment analysis on genes in significant sites ( Figure 2 ). Starting from the biological processes or metabolic pathways reported to be involved in regulating maize plant height / internode length, candidate genes that regulate internode length were screened.

[0050] (3) Based on the transcriptome (RNA-seq) data of the maize B73 reference genome, we screened for genes specifically expressed in internode tissues during maize vegetative growth and development ( Figure 3 ) and compared them with the candidate genes identified by enrichment analysis to further narrow the number of candidate genes.

[0051] (4) Metabolic pathways were summarized and expression networks were constructed for the internode length candidate gene ZmIL1 selected based on the above process ( Figure 4 ), to gain a deeper understanding of its molecular mechanism for regulating maize internode length.

[0052] The nucleotide sequence (Coding Sequence, CDS fragment) of the ZmIL1 gene is shown in SEQ ID NO.1, and the protein sequence encoded by the ZmIL1 gene is shown in SEQ ID NO.2.

[0053] SEQ ID NO.1:

[0054]

[0055] SEQ ID NO.2:

[0056] MetAlaThrAlaGlyLysValIleLysCysLysAlaAlaValAlaTrpGluAlaGlyLys

[0057] ProLeuSerIleGluGluValGluValAlaProProGlnAlaMetGluValArgValLys

[0058] IleLeuPheThrSerLeuCysHisThrAspValTyrPheTrpGluAlaLysGlyGlnThr

[0059] ProValPheProArgIlePheGlyHisGluAlaGlyGlyIleIleGluSerValGlyGlu

[0060] GlyValThrAspValAlaProGlyAspHisValLeuProValPheThrGlyGluCysLys

[0061] GluCysAlaHisCysLysSerAlaGluSerAsnMetCysAspLeuLeuArgIleAsnThr

[0062] AspArgGlyValMetIleAlaAspGlyLysSerArgPheSerIleAsnGlyLysProIle

[0063] TyrHisPheValGlyThrSerThrPheSerGluTyrThrValMetHisValGlyCysVal

[0064] AlaLysIleAsnProGlnAlaProLeuAspLysValCysValLeuSerCysGlyIleSer

[0065] ThrGlyLeuGlyAlaSerIleAsnValAlaLysProProLysGlySerThrValAlaVal

[0066] PheGlyLeuGlyAlaValGlyLeuAlaAlaAlaGluGlyAlaArgIleAlaGlyAlaSer

[0067] ArgIleIleGlyValAspLeuAsnProSerArgPheGluGluAlaArgLysPheGlyCys

[0068] ThrGluPheValAsnProLysAspHisAsnLysProValGlnGluValLeuAlaGluMet

[0069] ThrAsnGlyGlyValAspArgSerValGluCysThrGlyAsnIleAsnAlaMetIleGln

[0070] AlaPheGluCysValHisAspGlyTrpGlyValAlaValLeuValGlyValProHisLys

[0071] AspAlaGluPheLysThrHisProMetAsnPheLeuAsnGluArgThrLeuLysGlyThr

[0072] PhePheGlyAsnTyrLysProArgThrAspLeuProAsnValValGluLeuTyrMetLys

[0073] LysGluLeuGluValGluLysPheIleThrHisSerValProPheAlaGluIleAsnLys

[0074] AlaPheAspLeuMetAlaLysGlyGluGlyIleArgCysIleIleArgMetGluAsn

[0075] Example 2

[0076] Screening of superior haplotypes of maize internode length regulatory gene ZmIL1.

[0077] The BLUP values ​​of internode length phenotype data of 288 maize inbred lines were combined with the genotype data of these inbred lines in the ZmIL1 interval for LD analysis and haplotype analysis ( Figure 5), identify excellent haplotypes with shorter internode length and screen corresponding maize inbred lines (as shown in Table 2). The specific steps are as follows: First, based on the resequencing data of the associated population, with the significant SNP associated with ZmIL1 as the center, retrieve the SNP(s) within the range of 30kb upstream and downstream for LD analysis. Then, the haplotypes are divided by combining the internode length phenotype data with the genotypes of these inbred lines in the ZmIL1 interval. When the number of inbred lines containing a certain haplotype is less than 10, the haplotype is eliminated, and finally 4 haplotypes are obtained, including: Hap1 with a nucleotide sequence as shown in SEQ ID NO.3, Hap2 with a nucleotide sequence as shown in SEQ ID NO.4, Hap3 with a nucleotide sequence as shown in SEQ ID NO.5, and Hap4 with a nucleotide sequence as shown in SEQ ID NO.6, among which Hap3 is the optimal haplotype. The internode length of the maize inbred lines carrying the Hap3 haplotype (Table 2) is shorter, and these inbred lines can provide excellent germplasm resources for the breeding of new varieties of moderately dwarfed maize. The haplotypes carried by these inbred lines (containing the Hap3 haplotype) are called superior haplotypes.

[0078] The nucleotide sequence of the superior haplotype of the maize internode length regulatory gene ZmIL1 is shown in SEQ ID NO.5.

[0079] SEQ ID NO.3

[0080] CATGTATGATATTTTGTTACTTGATTCCGTAGAGGCGGGGAAGTCCTCCGAAAGCTTCA GTTTG

[0081] SEQ ID NO.4

[0082] CATGTATGGTATTTTGTTACTTGATTCCGTAGAGGCGGGGAAGTCCTCCGAAAGCTTCA GTTTG

[0083] SEQ ID NO.5

[0084] CATGCATGATATTTTGTTACTTGATTCCGTAGAGGCGGGGAAGTCCTCCGAAAGCTTCA GTTTG

[0085] SEQ ID NO.6

[0086] GCCGTTCGACGTTTTGTCCCGAAGCACAGCGTAGAGAGGAGTGTCTATCAAAAGTTCA GCCGCA

[0087] Example 3

[0088] Application of Maize Internode Length Regulatory Gene ZmIL1 in Breeding

[0089] The present invention also evaluates the application value of the internode length candidate gene ZmIL1 in the maize breeding process in China in the past 60 years. The results show that ZmIL1 has been selected in the breeding process, further verifying its importance in dwarf breeding. The steps are as follows:

[0090] The genotypes of parental inbred lines corresponding to maize varieties bred in China over the past 60 years were analyzed, with a focus on the distribution and selection of the ZmIL1 gene. Combined with breeding data, the frequency changes of ZmIL1 in maize inbred lines of different eras and regions were evaluated. Figure 6 As shown in Table 1, ZmIL1 was selected at multiple breeding stages. This selection trend shows that ZmIL1 plays an important role in the breeding process, helping to improve the lodging resistance of corn and adapt to the needs of mechanized harvesting, indicating that dwarfing is an important trend in corn breeding at present and in the future. The application of the ZmIL1 gene not only helps to breed new corn varieties with moderate dwarfing, but also provides valuable genetic resources and technical support for future breeding.

[0091] Table 1 Plant height-related genes selected during maize breeding

[0092]

[0093] Example 4

[0094] Application of Maize Internode Length Regulatory Gene ZmIL1 in Maize Production in China

[0095] In order to verify the application value of the maize internode length regulatory gene ZmIL1 in actual production, SNPs located in the ZmIL1 gene were screened based on the resequencing data of the associated population. Based on the SNPs in the ZmIL1 gene, 288 maize inbred lines were divided into 4 haplotypes, among which the haplotype Hap3 containing the SEQ ID NO.5 sequence was the optimal haplotype. The maize inbred lines carrying the optimal haplotype are shown in Table 2. These excellent maize inbred lines can provide excellent germplasm resources for the breeding of new moderately dwarfed maize varieties.

[0096] Table 2 Moderately dwarfing high-quality maize germplasms carrying the optimal haplotype Hap3

[0097]

[0098]

[0099] In addition, the present invention also uses commercial corn hybrids MY73 (approval number: Guoshenyu 20206190, approval year: 2020) and ZhengDan 958 (ZhengDan958 approval number: Guoshenyu 20000009, approval year: 2000) widely planted in the Huanghuaihai region of China and their parental materials, and investigates the plant type-related traits (plant height, ear height and internode length) of these materials. Figure 7 As shown in the figure, the plant height and ear height of MY73 and its parents were significantly lower than those of ZhengDan958 and its parents. At the same time, the ZmIL1 coding region sequences of the above materials were amplified and sequenced, and the results showed that MY73 and its parents had sequence variations in ZmIL1. These results show that ZmIL1 has been used in my country's current corn production and has a high application value. The above conclusions further prove the importance of ZmIL1 in improving plant type and increasing yield. Maize inbred lines carrying the optimal haplotype can provide valuable genetic resources for the breeding of new moderately dwarfed maize varieties.

[0100] The primer sequences for amplifying the coding region of the maize internode length regulating gene ZmIL1 are shown in SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO.12.

[0101] SEQ ID NO.7:

[0102] CACCAGTCCACCACCTCC

[0103] SEQ ID NO.8:

[0104] AACAGTAAACAAAGACCACCAAC

[0105] SEQ ID NO.9:

[0106] TCAGCCATCCCATTTGTGATCT

[0107] SEQ ID NO.10:

[0108] GATGAACTACTGACTTGTCAAAATAACG

[0109] SEQ ID NO.11:

[0110] ATGTATCCCTTCGATCGAAGGC

[0111] SEQ ID NO.12:

[0112] CAAACAAACACATGAATACTGATACAG

[0113] In summary, the nucleotide sequence (CDS fragment) of the ZmIL1 gene screened by the present invention is shown in SEQ ID NO.1, and the protein sequence encoded by it is shown in SEQ ID NO.2. Through haplotype analysis of ZmIL1, a batch of moderately dwarfed excellent corn inbred line germplasm was screened, and it was found that the gene has been applied in corn production in my country. The present invention has important significance in the selection and production application of dwarf corn varieties.

[0114] Although the preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0115] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. A gene regulating internode length in maize ZmIL1 , characterized in that, The gene ZmIL1 The nucleotide sequence is shown in SEQ ID NO.

1.

2. The maize internode length regulating gene according to claim 1 ZmIL1 , characterized in that, Maize internode length regulatory gene ZmIL1 The expression product of the gene ZmIL1 The expression product is the gene ZmIL1 The encoded protein, the amino acid sequence of which is shown in SEQ ID NO.

2.

3. The maize internode length regulating gene according to claim 1 ZmIL1 , characterized in that, Maize internode length regulatory gene ZmIL1 The four haplotypes, the nucleotide sequences of the four haplotypes are shown as SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6, among which SEQ ID NO.5 is an excellent haplotype.

4. A gene regulating internode length in maize ZmIL1 Application in corn genetics and breeding.

5. The use according to claim 4, characterized in that: Maize internode length regulatory gene ZmIL1 Application in corn production in the Huang-Huai-Hai region of China.

Images