Colorectal cancer molecular marker as well as detection method and application thereof

Abstract

The invention belongs to the technical field of cell molecular biology, and particularly relates to a colorectal cancer molecular marker and a detection method and application thereof. The invention provides a colorectal cancer molecular marker circETFA (2, 3, 4), the nucleotide sequence of the colorectal cancer molecular marker circETFA (2, 3, 4) is as shown in SEQ ID NO: 1, the colorectal cancer molecular marker circETFA (2, 3, 4) can be used for detection and prognosis of colorectal cancer, primers for detecting the expression quantity of circETFA (2, 3, 4) are as shown in SEQ ID NO: 2 and 3, and the colorectal cancer molecular marker circETFA (2, 3, 4) is strong in specificity, high in sensitivity and stable in result. The invention further provides a shRNA sequence of circETFA (2, 3, 4), the positive and negative strand sequences of the shRNA sequence are shown as SEQ ID NO: 4 and 5, and the shRNA sequence can be used for knocking down expression of circETFA (2, 3, 4) in colorectal cancer cells, can inhibit malignant proliferation of the colorectal cancer cells and is used for preparing colorectal cancer drugs.

Description

Technical Field

[0001] The present invention belongs to the field of cell molecular biotechnology, and specifically relates to a colorectal cancer molecular marker and a detection method and application thereof. Background Art

[0002] As one of the most common malignant tumors in the world, colorectal cancer has a high morbidity and mortality rate, posing a serious threat to people's lives and health. Currently, the main treatments for colorectal cancer are surgery, radiotherapy and chemotherapy. Although significant progress has been made in the study of colorectal cancer in recent decades, its incidence rate still shows a clear upward trend, and recurrence accompanied by malignant proliferation is still one of the main factors leading to its poor prognosis, which has a great impact on the patient's survival rate and quality of life.

[0003] In recent years, with the continuous development of biological technology, more and more researchers have begun to explore the relationship between various biological small molecules and tumors. As a non-coding RNA, circRNA is widely present in the nucleus, cytoplasm and exosomes of various eukaryotic cells. Its expression is stable and not easy to degrade, and it can participate in the occurrence and development of various diseases. Therefore, screening out differentially expressed circRNA as a biomarker of the disease can better understand the pathogenesis of the disease and provide a strong basis for the diagnosis and prognosis of the disease. Short hairpin RNA (shRNA) is a hairpin structure composed of two short inverted repeat sequences and an intermediate stem-loop sequence. It can specifically degrade the target gene through the mediation of exogenous or endogenous double-stranded RNA, resulting in gene silencing. shRNA is a highly specific and efficient gene blocking technology. With the continuous development of technology, it has gradually become a powerful tool for cell biology, but if the design is unreasonable, it is easy to produce off-target effects.

[0004] In order to detect and verify the existence and expression of circRNA, the primer design of real-time fluorescence quantitative PCR is crucial. Improper primer design and low specificity will directly lead to inaccurate test results. Summary of the invention

[0005] In view of the current status of the above-mentioned technologies, a technical problem to be solved by the present invention is to provide a molecular marker for colorectal cancer, which can be used to diagnose colorectal cancer simply, quickly and efficiently.

[0006] Another technical problem to be solved by the present invention is to provide a method for quickly, accurately and efficiently detecting the expression level of the colorectal cancer molecular marker circETFA (2,3,4).

[0007] Another technical problem to be solved by the present invention is to provide a shRNA sequence of circETFA (2,3,4), which can simply and efficiently reduce the expression level of circETFA (2,3,4) in colorectal cancer cells, and prove through CCK-8 experiments that the shRNA of circETFA (2,3,4) in colorectal cancer cells can inhibit their malignant proliferation.

[0008] In order to achieve the above object, the present invention adopts the following technical solutions:

[0009] The present invention provides a colorectal cancer molecular marker circETFA (2,3,4), whose sequence is shown in SEQ ID NO: 1.

[0010] An application of the colorectal cancer molecular marker is used to prepare products for colorectal cancer detection and prognosis judgment.

[0011] Furthermore, the product is a colorectal cancer detection chip or a colorectal cancer auxiliary diagnosis kit.

[0012] The present invention also provides a method for detecting the expression level of the colorectal cancer molecular marker, comprising the following steps:

[0013] (1) Collect colorectal cancer samples;

[0014] (2) extracting RNA and performing reverse transcription;

[0015] (3) Real-time fluorescence quantitative PCR detection;

[0016] (4) The expression levels of colorectal cancer molecular markers were calculated using the 2-ΔΔCT method.

[0017] Furthermore, in step (3), the upstream and downstream primers used in the real-time fluorescence quantitative PCR detection are shown as SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

[0018] The present invention also provides a shRNA of the colorectal cancer molecular marker, the sense strand and antisense strand of which are shown in SEQ ID NO: 4 and SEQ ID NO: 5, respectively.

[0019] An application of the shRNA is to prepare a product for knocking down the expression of circETFA (2,3,4) in colorectal cancer cells.

[0020] Furthermore, the shRNA can inhibit the malignant proliferation of colorectal cancer cells and can be used for the preparation of drugs for treating colorectal cancer.

[0021] The present invention also provides a drug for treating colorectal cancer, comprising the shRNA.

[0022] Compared with the prior art, the present invention has the following effects:

[0023] 1. The primers provided by the present invention for detecting the expression amount of circETFA (2,3,4) have high specificity, strong repeatability and stable results, which provide a basis for the biological research of hsa_circ_0003620.

[0024] 2. circETFA (2,3,4) provided by the present invention can be used as a marker for colorectal cancer detection, providing a basis for the detection and prognosis of colorectal cancer.

[0025] 3. The method of the present invention for detecting the molecular expression level of circETFA (2,3,4) adopts real-time fluorescence quantitative PCR detection, and can simultaneously detect the target circRNA and the internal reference gene without adding probes. The method is simple and efficient.

[0026] 4. The shRNA of circETFA (2,3,4) provided by the present invention has the characteristics of strong specificity, rapid action and high efficiency.

[0027] 5. The shRNA of circETFA (2,3,4) provided by the present invention can specifically inhibit the malignant proliferation of colorectal cancer cells and has broad application prospects in the preparation of drugs for colorectal cancer and the prognosis of colorectal cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 The melting curve of the real-time fluorescence quantitative PCR in the embodiment is used to detect that the primer has specificity;

[0029] Figure 2 The relative expression levels of circETFA (2, 3, 4) detected in normal colorectal tissues and cancer tissues in the examples;

[0030] Figure 3 This is the partial sequencing result of the amplified product in the example.

[0031] Figure 4 The expression level of circETFA (2, 3, 4) was detected by real-time fluorescence quantitative PCR in the embodiment;

[0032] Figure 5 This is the CCK-8 experiment used in the example to detect the proliferation activity of colorectal cancer cells. DETAILED DESCRIPTION

[0033] Example 1

[0034] A colorectal cancer molecular marker, the marker is circETFA (2,3,4), and its nucleotide sequence is shown in SEQ ID NO: 1.

[0035] The colorectal cancer molecular marker circETFA (2,3,4) can be applied to the detection and prognosis of colorectal cancer.

[0036] Furthermore, the method can be used in preparing a chip for colorectal cancer detection or a colorectal cancer auxiliary diagnosis kit.

[0037] A method for detecting the molecular expression of circETFA (2,3,4), a molecular marker for colorectal cancer, designs real-time fluorescence quantitative PCR primers for circETFA (2,3,4), and uses real-time fluorescence quantitative PCR detection to obtain the expression of circETFA (2,3,4). Specifically comprising the following steps:

[0038] (1) Collecting colorectal cancer samples:

[0039] The 30 pairs of colorectal cancer and colorectal normal tissues in this example were obtained from Shanghai Xinchao Biotechnology Co., Ltd. The samples were stored in liquid nitrogen for future use. All research subjects gave their informed consent to participate in this experiment, and the process was reviewed and approved by the hospital ethics committee.

[0040] (2) RNA extraction and reverse transcription:

[0041] (a) Grinding beads and an appropriate amount of trizol solution were added to the collected tissue samples and ground thoroughly using a grinder at low temperature;

[0042] (b) Add 100 μL of chloroform to every 500 μL of trizol solution, shake vigorously for 30 s, and let stand at room temperature for 5 min;

[0043] (c) Centrifuge at 12000 rpm for 15 min at 4°C, and transfer the upper aqueous phase to a new centrifuge tube;

[0044] (d) Add an equal volume of isopropanol, mix gently, and precipitate at -20°C for 20 min;

[0045] (e) Centrifuge at 12000 rpm for 15 min at 4°C and discard the supernatant;

[0046] (f) Add 700 μl of 75% ethanol, centrifuge at 7500 rpm for 5 min, discard the supernatant, and air-dry in a clean bench;

[0047] (g) adding an appropriate amount of enzyme-free water to dissolve RNA, and measuring the RNA concentration and purity using a nucleic acid micro-detector;

[0048] (h) reverse transcription to obtain cDNA, the specific steps are:

[0049] Add the following reagents to a non-enzyme PCR centrifuge tube:

[0050] 5x Evo M-MLV RT MasterMix: 4 μl, RNA: 1 μg, add RNase free ddH2O to 20 μl;

[0051] Reverse transcription was performed according to the following reaction schedule:

[0052] The following settings were set on the PCR instrument: first step, 37°C for 15 min; second step, 85°C for 5 s; third step, 4°C for 1 min;

[0053] The cDNA was diluted at a ratio of 1:5 and then stored in a -20 degree refrigerator.

[0054] (3) Real-time fluorescence quantitative PCR detection:

[0055] Follow the following real-time PCR procedure:

[0056]

[0057] Add the following reagents to a non-enzyme PCR centrifuge tube:

[0058] SYBR Green MasterMix: 10 μL, upstream primer: 1 μL, downstream primer: 1 μL, cDNA: 2 μL, add ddH2O to 20 μL, the upstream primer is AAGGCCTACTTCCAGAGGAAC (SEQ ID NO: 2); the downstream primer is TGGGTGCTAGGGAATCATTTG (SEQ ID NO: 3);

[0059] (4) Calculate the expression of colorectal cancer molecular markers using the 2-ΔΔCT method;

[0060] (5) Result analysis:

[0061] First, the melting curve showed that the circETFA (2,3,4) primers had good specificity.

[0062] The primers were tested for specificity by melting curve, and the results showed that the melting curve presented a single peak, indicating that the primers of the present invention had good specificity and good stability and reliability in detecting the expression of circETFA (2, 3, 4) (e.g. Figure 1 shown).

[0063] Secondly, the expression level of circETFA(2,3,4) was calculated by the 2-ΔΔCT method, and the results showed that the expression level of circETFA(2,3,4) in most colorectal cancer tissues was higher than that in normal colorectal tissues (e.g. Figure 2 shown).

[0064] Finally, the amplified product was sequenced, and the sequencing results clearly showed the cyclization site AGGC, further proving the existence of circETFA (2,3,4) (e.g. Figure 3 shown).

[0065] In summary, the colorectal cancer molecular marker circETFA (2,3,4) can be used in colorectal cancer detection and prognosis judgment.

[0066] Example 2

[0067] In this example, the sequence characteristics of the colorectal cancer molecular marker circETFA (2,3,4) were used to synthesize shRNA of circETFA (2,3,4).

[0068] (1) Synthesis of shRNA for circETFA (2,3,4):

[0069] According to the design principle of shRNA, the synthetic sequence contains the cyclization site of circular RNA, the fragment length is 18 to 25 bp, and the GC content is about 40% to 50% as the candidate target sequence of shRNA, and is compared with the human genome sequence through the database to ensure that there is no overlap with other genes. The shRNA sequence designed by the present invention is as follows:

[0070] Sense strand (SEQ ID NO: 4):

[0071] 5'-CCGGTTCGGAAAGGCCTCATTGCTAGGATCCTAGCAATGAGGCCT TTCCGAATTTTTG-3'

[0072] Antisense strand (SEQ ID NO: 5):

[0073] 5'-AATTCAAAAATTCGGAAAGGCCTCATTGCTAGGATCCTAGCAATGA GGCCTTTCCGAA-3

[0074] The above shRNA sequence was sent to Nanjing Qingke Company for chemical synthesis, and then constructed into the pLKO.1 vector plasmid through annealing and ligation.

[0075] (2) shRNA transfection of colorectal cancer cells:

[0076] Colorectal cancer cells HCT116 were plated in a 6-well cell culture plate, and transfection was performed when the cell confluence density reached about 60%. shRNA and negative control (NC) plasmids were transfected into the colorectal cancer cells using lipo2000 transfection reagent, and the culture medium was replaced after 6 to 8 hours.

[0077] (3) Detection of circETFA (2, 3, 4) expression in colorectal cancer cells:

[0078] The method used is different from the method for detecting the expression level of the colorectal cancer molecular marker circETFA (2,3,4) in Example 1, except that:

[0079] This example is to collect transfected colorectal cancer cells, not to lyse the tissue, but to lyse the cells and extract the total RNA in the cells.

[0080] The expression levels of circETFA (2,3,4) were calculated by the 2-ΔΔCT method. Figure 4 As shown, it can be seen that the knockdown efficiency of circETFA (2,3,4) shRNA in colorectal cancer cells reaches 80%. Therefore, the shRNA sequence provided by the present invention can effectively inhibit the expression of circETFA (2,3,4) in colorectal cancer cells.

[0081] (4) CCK-8 experiment:

[0082] CCK-8 experiments have shown that shRNA of circETFA (2,3,4) can inhibit the malignant proliferation of colorectal cancer cells and can be used to prepare colorectal cancer drugs. The specific process is as follows:

[0083] (a) Colorectal cancer cells transfected with shRNA and negative control (NC) plasmid were digested with trypsin, centrifuged at 1000 rpm for 3 min, and mixed with DMEM complete medium to make a single cell suspension. The cells were counted and 1000 cells / 100 μl of cell suspension were prepared. 100 μl of cell suspension per well was plated in a 96-well cell culture plate with 3 replicates per group. Cell viability was detected at 0 h, 24 h, 48 h, 72 h, and 96 h, respectively.

[0084] (b) 10 μl of CCK-8 reagent was added to each well and incubated at 37°C for 1.5 h. The plate was read using an ELISA reader and the absorbance at 450 nm was detected.

[0085] (c) Calculation:

[0086] (1) Cell viability (%) = (absorbance value of treated group - blank value) / (absorbance value of untreated group - blank value) × 100%

[0087] (2) Growth curve = (absorbance value at a specified time point - blank value) / (absorbance value when cells were just inoculated - blank value), and the growth curve of cells at different times was made based on this. The CCK-8 experiment showed that after colorectal cancer cells were transfected with the shRNA plasmid, the number of cells in the shRNA group was 0.49 times that of the control group at 48 hours. Figure 5 Therefore, the shRNA of circETFA (2,3,4) provided by the present invention can inhibit the proliferation of cells in colorectal cancer cells, and can provide theoretical guidance for its application in colorectal cancer.

[0088] In summary, shRNA of circETFA(2,3,4) can be used for the preparation of colorectal cancer drugs.

[0089] Sequence Listing

[0090] SEQ ID NO: 1

[0091] GCCTCATTGCTACGATTTCAGAGTACCCTGGTAATAGCTGAGCATGCAAATGATTCCCTAGCACCCATTACTTTAAATACCATTACTGCAGCCACACGCCTTGGAGGTGAAGTGTCCTGCTTAGTAGCTGGAACCAAATGTGACAAGGTGGCACAA GATCTCTGTAAAGTAGCAGGCATAGCAAAAGTTCTGGTGGCTCAGCATGATGTGTACAAAGGCCTACTTCCAGAGGAACTGACACCATTGATTTTGGCAACTCAGAAGCAGTTCAATTACACACACATCTGTGCTGGAGCATCTGCCTTCGGAAAG

[0092] SEQ ID NO: 2

[0093] AAGGCCTACTTCCAGAGGAAC

[0094] SEQ ID NO: 3

[0095] TGGGTGCTAGGGAATCATTTG

[0096] SEQ ID NO: 4

[0097] CCGGTTCGGAAAGGCCTCATTGCTAGGATCCTAGCAATGAGGCCTTTCCGAATTTTTG

[0098] SEQ ID NO:5

[0099] AATTCAAAAATTCGGAAAGGCCTCATTGCTAGGATCCTAGCAATGAGGCCTTTCCGAA。

Claims

1. A colorectal cancer molecular marker, characterized in that: The colorectal cancer molecular marker is circETFA (2,3,4), and its sequence is shown in SEQ ID NO:

1.

2. An application of the colorectal cancer molecular marker according to claim 1, characterized in that: Used in the preparation of products for colorectal cancer detection and prognosis judgment.

3. The use according to claim 2, characterized in that: The product is a colorectal cancer detection chip or a colorectal cancer auxiliary diagnosis kit.

4. A method for detecting the expression of the colorectal cancer molecular marker according to claim 1, characterized in that: The following steps are involved: (1) Collect colorectal cancer samples; (2) extracting RNA and performing reverse transcription; (3) Real-time fluorescence quantitative PCR detection; (4) The expression levels of colorectal cancer molecular markers were calculated using the 2-ΔΔCT method.

5. A method for detecting the expression of colorectal cancer molecular markers according to claim 4, characterized in that: In the step (3), the upstream and downstream primers used in the real-time fluorescence quantitative PCR detection are shown in SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

6. A shRNA for a colorectal cancer molecular marker according to claim 1, characterized in that: The sense strand and antisense strand of the shRNA are shown in SEQ ID NO: 4 and SEQ ID NO: 5, respectively.

7. The use of shRNA according to claim 6, characterized in that: Used to prepare products for knocking down circETFA (2,3,4) expression in colorectal cancer cells.

8. The use according to claim 7, characterized in that: The shRNA can inhibit the malignant proliferation of colorectal cancer cells and can be used for the preparation of drugs for treating colorectal cancer.

9. A drug for treating colorectal cancer, characterized in that: Comprising the shRNA according to claim 6.

Images