Agricultural enzyme for degrading phoxim and application thereof

Abstract

The invention belongs to the technical field of soil pesticide residue degradation, and particularly relates to an agricultural enzyme for degrading phoxim and application thereof. The agricultural enzyme for degrading phoxim provided by the invention is prepared from the following raw materials: 400 to 600 parts of brown sugar, 4 to 6 parts of yeast powder and 250 to 1000 parts of radix scutellariae. The preparation method comprises the following steps: uniformly mixing scutellaria baicalensis with saccharomycetes, brown sugar, water and the like, and naturally fermenting at 20-30 DEG C until the pH value is 1t; when the time is 5.5, stopping fermentation, and collecting a fermentation product to obtain the agricultural enzyme, which can be flushed or splashed to a farmland, so that the agricultural enzyme is convenient to apply. The agricultural enzyme provided by the invention can realize efficient degradation of organophosphorus pesticide residues in soil, and can also enrich microbial communities and abundance of soil while improving the aggregate structure of the soil, thereby achieving the effects of improving the nutrient storage capacity of the soil and improving the microbial communities.

Description

Technical Field

[0001] The invention belongs to the technical field of soil pesticide residue degradation, and specifically relates to an agricultural enzyme for degrading phoxim and an application thereof. Background Art

[0002] As one of the important food and cash crops in agricultural production, potato has a pivotal position in terms of planting area and yield. With the continuous development of agricultural production, in order to ensure the yield of potato and improve the commercial rate, phoxim, an organophosphorus insecticide, has been widely used in the prevention and control of potato pests. Long-term excessive application of phoxim not only leads to continuous accumulation in the soil, but also aggravates the deterioration of soil microhabitats, reduces the abundance and community stability of soil microorganisms, and affects the soil health of sandy farmland ecosystems. Therefore, high amounts of phoxim residues have also become an important obstacle to the improvement of soil fertility in sandy farmlands in arid areas. Moreover, the high accumulation of phoxim in potato tubers directly affects the commerciality of potatoes, and excessive pesticide residues have become a problem that cannot be ignored. With the increasing awareness of food safety and environmental protection in society and the promotion of green and clean potato production models, the problem of organophosphorus pesticide residues has gradually become the focus of attention of society and growers. Therefore, how to ensure the efficient prevention and control of pests and diseases by phoxim in the early stage and significantly reduce its residues in the soil and potato tubers in the later stage has become an important problem that needs to be solved urgently.

[0003] At present, the degradation methods of phoxim in soil mainly include: photolysis, oxidative degradation, hydrolysis, enzyme degradation, and microbial degradation. The photolysis method has a wide range of degradation objects, stable degradation ability, and will not cause secondary pollution, but it fails to achieve spectral applicability of the product and is not suitable for the field. The oxidative degradation method accurately destroys the corresponding chemical bonds, but there are by-products, the degradation effect is not ideal, and secondary pollution is caused. The hydrolysis method can occur under acidic and alkaline conditions, but it is seriously affected by pH, and only has obvious degradation effects on pyrethroid pesticides. The enzyme degradation method is easy to use, safe and non-toxic, has no side effects, does not require high specificity for pesticides, has no residues and no secondary pollution, but the storage, production and application costs of the enzyme are high, and it is not easy to be used on a large scale in agricultural production. The microbial degradation method has a broad application prospect, is safe and non-toxic, and has no secondary pollution, but the biological treatment effect is still unstable, there are many influencing factors, and it is easy to be incompletely degraded.

[0004] There are many studies on agricultural enzymes in the field of agricultural production, but the current research focuses on agricultural enzymes to improve soil fertility and microbial diversity, and the relevant technologies for the degradation of phoxim pesticide residues are relatively lacking. There is less attention on whether agricultural enzymes can efficiently degrade organophosphorus pesticide residues such as phoxim in farmland soil, and the existing agricultural enzymes are not effective in degrading phoxim. Summary of the invention

[0005] The technical problem to be solved by the present invention is to overcome the defect that the agricultural enzyme in the prior art has a poor effect in degrading phoxim, and to provide an agricultural enzyme for degrading phoxim and its application.

[0006] In order to solve the above technical problems, the present invention adopts the following technical solutions.

[0007] The first aspect of the present invention provides an agricultural enzyme for degrading phoxim, comprising the following raw materials in parts by weight: 400-600 parts of brown sugar, 4-6 parts of yeast powder and 250-1000 parts of scutellaria baicalensis.

[0008] In some embodiments of the present invention, the method for preparing the agricultural enzyme includes: uniformly mixing the scutellaria baicalensis, the yeast powder and the brown sugar with water, fermenting at 20°C to 30°C, measuring the pH value of the fermentation liquid during the fermentation process, stopping the fermentation when the pH value is <5.5, collecting the fermentation product, and obtaining the agricultural enzyme; the weight proportion of the water is 4000 to 6000 parts.

[0009] In some embodiments of the present invention, the radix scutellariae is crushed and then mixed with the brown sugar and water.

[0010] In some embodiments of the present invention, the particle size of the Scutellaria baicalensis residue is 50 mesh to 200 mesh.

[0011] In some embodiments of the present invention, the scutellaria baicalensis includes one of astragalus root, scutellaria stem and leaves, and scutellaria residue; the scutellaria residue is the scutellaria residue collected after extracting the scutellaria root or scutellaria stem and leaves using a reflux method, a decoction method, or an ultrasonic extraction method; in the reflux method, ethanol with a volume fraction of 50% to 65% is used as a solvent for extraction; the scutellaria root or scutellaria stem and leaves are mixed with 8 to 10 times the mass of the scutellaria root or scutellaria stem and leaves, and decocted for 1h to 2h; in the ultrasonic extraction method, ethanol with a volume fraction of 50% to 65% is used as a solvent to extract the scutellaria root or scutellaria stem and leaves, the ultrasonic power is 100W to 200W, and the ultrasonic time is 20 to 40min.

[0012] In some embodiments of the present invention, in the reflux method, the mass volume ratio of the scutellaria root or scutellaria stem and leaf to the ethanol is 15-30 g: 200-300 mL; the temperature of the reflux extraction is 50° C. to 70° C.; and the number of reflux extractions is 1 to 3 times.

[0013] In some embodiments of the present invention, in the decoction method, the number of decoctions is 1 to 3 times.

[0014] In some embodiments of the present invention, in the ultrasonic extraction method, the number of extractions is 1 to 3 times, and the mass volume ratio of the scutellaria root or scutellaria stem and leaf to the ethanol is 30 g:250 mL.

[0015] The second aspect of the present invention provides the use of the agricultural enzyme in degrading phoxim in soil.

[0016] The third aspect of the present invention provides a method for degrading phoxim in soil, comprising: applying the agricultural enzyme to the soil containing residual phoxim.

[0017] In some embodiments of the present invention, the agricultural enzyme is diluted 50 to 200 times and then applied to the soil containing residual phoxim.

[0018] In some embodiments of the present invention, the application amount of the agricultural enzyme is 10 to 14 kg / mu.

[0019] In some embodiments of the present invention, the application amount of the agricultural enzyme is 12 kg / mu.

[0020] Compared with the prior art, the present invention has the following beneficial effects: In the present invention, Scutellaria baicalenzyme is prepared with Scutellaria baicalenzyme residue as the base material and yeast, brown sugar and water as auxiliary materials, which has no toxic side effects and can efficiently degrade phoxim in farmland soil, and can significantly improve farmland soil fertility and microbial diversity and function.

[0021] In the present invention, Scutellaria baicalensis, as a major Chinese medicinal material, produces a large amount of residue after baicalin is extracted, and the residue is relatively rich in organic matter, flavonoids and the like, which are beneficial to controlling pathogens and improving the diversity of beneficial microbial communities in the rhizosphere. The Scutellaria baicalensis residue is used as a basic raw material, yeast and brown sugar are compounded to create a high-activity small-molecule organic liquid fertilizer rich in flavonoids, thereby achieving efficient degradation of organic phosphorus pesticide residues in the soil, and enriching the soil microbial community and abundance while improving the soil aggregate structure, thereby achieving the effect of improving the soil nutrient storage capacity and improving the microbial community.

[0022] The method for preparing the agricultural enzyme provided by the present invention is simple and does not require complicated material pretreatment. After the extracted Scutellaria residue is evenly mixed with yeast, brown sugar, water, etc., it is naturally fermented at room temperature above 20°C for more than 30 days, and then it can be flushed or sprinkled on the farmland for easy application.

[0023] In the present invention, in order to address the high residual and continuous accumulation problems of phoxim faced during long-term high-intensity intensive planting of potato farmlands in sandy farmlands in arid areas, the waste residues produced after the effective ingredients of Scutellaria baicalenzyme, a major Chinese medicinal material, were selected as materials to prepare Scutellaria baicalenzyme agricultural enzymes, and the effects of Scutellaria baicalenzyme agricultural enzymes on the reduction of phoxim in sandy potato farmlands were quantitatively evaluated, providing theoretical and scientific support for the reduction of phoxim in the soil of sandy potato farmlands in arid areas.

[0024] In the present invention, the scutellaria residue is applied to degrade soil organic phosphorus pesticide residues, which can improve soil fertilizer efficiency, inhibit the reproduction of harmful bacteria in the soil, produce more and better-quality agricultural products, and can also improve soil structure, reduce pollution, reduce the amount of fertilizers and pesticides used, and eliminate pesticide residues. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is a graph showing the results of the degradation potential of phoxim in soil by enzymes cultured for different times.

[0026] Figure 2 This is a graph showing the results of the determination of phoxim residues in soil and potato tubers by field agricultural enzymes; Figure 2 A in the figure represents the result of the residue determination in soil; Figure 2 B in the figure shows the result of determination of phoxim residue in potato tubers.

[0027] Figure 3 A graph showing the effect of phoxim-degrading enzymes provided in different embodiments on the diversity of bacterial communities in potato soil. DETAILED DESCRIPTION

[0028] The present invention is described in detail below in conjunction with specific examples, but it should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources.

[0029] At present, the degradation methods of phoxim in soil mainly include: photolysis, oxidative degradation, hydrolysis, enzyme degradation, and microbial degradation. The photolysis method has a wide range of degradation objects, stable degradation ability, and will not cause secondary pollution, but it fails to achieve spectral applicability of the product and is not suitable for the field. The oxidative degradation method accurately destroys the corresponding chemical bonds, but there are by-products, the degradation effect is not ideal, and secondary pollution is caused. The hydrolysis method can occur under acidic and alkaline conditions, but it is seriously affected by pH, and only has obvious degradation effects on pyrethroid pesticides. The enzyme degradation method is easy to use, safe and non-toxic, has no side effects, does not require high specificity for pesticides, has no residues and no secondary pollution, but the storage, production and application costs of the enzyme are high, and it is not easy to be used on a large scale in agricultural production. The microbial degradation method has a broad application prospect, is safe and non-toxic, and has no secondary pollution, but the biological treatment effect is still unstable, there are many influencing factors, and it is easy to be incompletely degraded.

[0030] There are many studies on agricultural enzymes in the field of agricultural production, but the current research focuses on agricultural enzymes to improve soil fertility and microbial diversity. There is a relative lack of technologies for the degradation of phoxim pesticide residues, and there is less attention on whether agricultural enzymes can efficiently degrade phoxim and other organophosphorus pesticide residues in farmland soil. Although there is a certain research foundation for the degradation technology of pesticide residues in farmland soil, there is still a lack of in-depth exploration of finding an economical, efficient and environmentally friendly agricultural enzyme to degrade phoxim in soil.

[0031] The present invention provides an agricultural enzyme for degrading phoxim, comprising the following raw materials in parts by weight: 400-600 parts of brown sugar, 4-6 parts of yeast powder and 250-1000 parts of scutellaria baicalensis. As a major Chinese medicinal material, scutellaria baicalensis produces a large amount of residue after baicalin is extracted, and the organic matter and flavonoids in the residue are relatively rich, which are beneficial to controlling pathogens and improving the diversity of rhizosphere beneficial microbial communities; using the scutellaria baicalensis residue as the basic raw material, yeast and brown sugar are compounded to create a high-activity agricultural enzyme rich in flavonoids, thereby achieving efficient degradation of organic phosphorus pesticide residues in the soil, and enriching the soil microbial community and abundance while improving the soil aggregate structure, so as to achieve the effect of improving the soil nutrient storage capacity and improving the microbial community. The present invention also provides a method for preparing the agricultural enzyme. The preparation method is simple and does not require complicated material pretreatment. After the extracted Scutellaria residue is evenly mixed with yeast, brown sugar, water, etc., it is naturally fermented at room temperature above 20°C for more than 30 days, and then it can be flushed or sprayed on the farmland for easy application.

[0032] 1. Experimental materials:

[0033] The brown sugar was edible brown sugar produced according to food standards. The yeast was edible highly active dry yeast powder purchased from Angel Yeast Co., Ltd. with item number 80003180.

[0034] Example 1: An agricultural enzyme for degrading phoxim

[0035] An agricultural enzyme for degrading phoxim is specifically composed of the following components: 250g of scutellaria residue, 500g of brown sugar, 5g of yeast powder, and 5000g of water. The particle size of the scutellaria residue in the above raw materials ranges from 50 meshes to 200 meshes.

[0036] The preparation method of the agricultural enzyme for degrading phoxim specifically comprises the following steps: uniformly mixing the scutellaria residue with yeast, brown sugar, water, etc., fermenting at 20°C for more than 30 days, measuring the pH value of the fermentation liquid during the fermentation process, stopping the fermentation when the pH value of the agricultural enzyme liquid is lower than 5.5, recovering the fermentation product, and obtaining the agricultural enzyme for degrading phoxim.

[0037] Preparation method of scutellaria residue: The scutellaria residue is derived from the residue produced after baicalin in scutellaria is extracted by reflux method. The preparation method is as follows: Scutellaria root or stem and leaf are crushed to make the particle size of scutellaria granules between 50 mesh and 200 mesh. 15g to 30g of scutellaria granules are weighed, 200mL to 300mL of ethanol with a volume fraction of 50% to 65% is added, and reflux extraction is performed at 50℃ to 70℃ water bath for 1 to 3 times, each time for 1h to 2h. Afterwards, the filter residue is recovered to obtain scutellaria residue.

[0038] In the above method, any value within the parameter range can be selected to obtain the scutellaria residue. Specifically, the following method is used in this embodiment: the root of scutellaria is crushed to make the particle size of scutellaria baicalensis particles 50 mesh. Weigh 20g of scutellaria baicalensis particles, add 240mL of 60% ethanol by volume, and extract twice at 60°C in a water bath under reflux, each time for 2 hours. Then recover the filter residue to obtain the scutellaria residue used in this embodiment.

[0039] Example 2: An agricultural enzyme for degrading phoxim

[0040] An agricultural enzyme for degrading phoxim is specifically composed of the following components: 500g of scutellaria residue, 500g of brown sugar, 5g of yeast powder, and 5000g of water. The particle size of the scutellaria residue in the above raw materials ranges from 50 meshes to 200 meshes.

[0041] The preparation method of the agricultural enzyme for degrading phoxim specifically comprises the following steps: uniformly mixing the scutellaria residue with yeast, brown sugar, water, etc., and then naturally fermenting at room temperature above 20°C for more than 30 days to obtain the agricultural enzyme for degrading phoxim.

[0042] The scutellaria residue is derived from the residue produced after baicalin is extracted from scutellaria by decoction. The preparation method of the scutellaria residue is as follows: scutellaria baicalensis, scutellaria baicalensis root or scutellaria baicalensis stem and leaf are crushed to make the particle size of scutellaria baicalensis granules 100 mesh. 20g of scutellaria baicalensis granules are weighed, and 8 to 10 times the amount of water as that of scutellaria baicalensis, scutellaria baicalensis root or scutellaria baicalensis stem and leaf are added to boil, and decocted twice, each time for 1h to 2h, decocted 1 to 3 times, and the filter residue is recovered to obtain the scutellaria residue used in this embodiment.

[0043] In the above method, any value within the parameter range can be selected to obtain the scutellaria residue. Specifically, the following method is used in this embodiment: the root of scutellaria is crushed into 40 mesh particles to obtain scutellaria granules, and the particle size of the scutellaria granules is 200 mesh. Weigh 20g of scutellaria granules, add 10 times the amount of water of scutellaria baicalensis, scutellaria baicalensis roots or scutellaria baicalensis stems and leaves, boil, decoct twice, decoct for 1 hour each time, recover the filter residue, and obtain the scutellaria residue used in this embodiment.

[0044] Example 3: An agricultural enzyme for degrading phoxim

[0045] An agricultural enzyme for degrading phoxim is specifically composed of the following components: 1000g of scutellaria residue, 500g of brown sugar, 5g of yeast powder, and 5000g of water. The particle size of the scutellaria residue in the above raw materials ranges from 50 meshes to 200 meshes.

[0046] The preparation method of the agricultural enzyme for degrading phoxim specifically comprises the following steps: uniformly mixing the scutellaria residue with yeast, brown sugar, water, etc., and then naturally fermenting at room temperature above 20°C for more than 30 days to obtain the agricultural enzyme for degrading phoxim.

[0047] The scutellaria residue is derived from the residue produced after baicalin in scutellaria is extracted by ultrasonic extraction. The preparation method of the scutellaria residue is as follows: the scutellaria root or the scutellaria stem and leaf are crushed to make the particle size of the scutellaria granules between 50 mesh and 200 mesh. 15g to 30g of the scutellaria granules are weighed, 100mL to 200mL of ethanol with a volume fraction of 50% to 65% is added, and after soaking overnight, the scutellaria granules are ultrasonically treated at an ultrasonic power of 100W to 200W for 20min to 40min, filtered, and the residue is collected. Then, 100mL to 200mL of ethanol solution with a volume fraction of 60% is ultrasonically treated for 30min, filtered, and the residue is collected to obtain the scutellaria residue used in this embodiment.

[0048] In the above method, any value within the parameter range can be selected to obtain the scutellaria residue. Specifically, the following method is used in this embodiment: the root of scutellaria is crushed to make the particle size of the scutellaria granules 200 mesh. Weigh 20g of scutellaria granules, add 200mL of 60% ethanol by volume, soak overnight, ultrasonically treat at an ultrasonic power of 150W for 30min, filter, collect the residue, add 200mL of 60% ethanol solution by volume for 30min, filter, collect the residue, and obtain the scutellaria residue used in this embodiment.

[0049] Comparative Example 1: An agricultural enzyme for degrading phoxim

[0050] An agricultural enzyme for degrading phoxim is specifically composed of the following components: 500g of brown sugar, 5g of yeast powder and 5000g of water.

[0051] The preparation method of the agricultural enzyme for degrading phoxim specifically comprises the following steps: uniformly mixing yeast, brown sugar, water, etc., fermenting at 20°C for more than 30 days, measuring the pH value of the fermentation liquid during the fermentation process, stopping the fermentation when the pH value of the agricultural enzyme liquid is lower than 5.5, recovering the fermentation product, and obtaining the agricultural enzyme for degrading phoxim.

[0052] Comparison of the degradation effects of the agricultural enzymes for degrading phoxim provided in Examples 1 to 3 and Comparative Example 1 on phoxim in soil: Soil from potato farmland in the Maowusu sandy land was collected, about 3 kg of farmland soil was weighed and put into flower pots, 30 ml of 40% phoxim emulsifiable concentrate was added to each pot, 3.5 ml of the agricultural enzymes provided in Examples 1 to 4 were taken, diluted 100 times, and added to each flower pot as the experimental group. In the control group, 350 ml of distilled water was added to the flower pots, and the flower pots were placed in an incubator at 26°C for 20 days. Soil in the flower pots was collected on the 1st, 5th, 10th, 15th and 20th days, and the residual amount of phoxim in the soil was detected.

[0053] The test results of phoxim residues are as follows: Figure 1 As shown, by comparison, it was found that compared with the control group, the agricultural enzymes for degrading phoxim provided in Examples 1 to 3 and Comparative Example 1 can all reduce phoxim in the soil, among which the enzyme provided in Example 3 has the most significant reduction effect.

[0054] Further, according to the enzyme provided in Example 3, in the potato-growing areas, first, 12 kg / mu of phoxim was applied to the farmland soil (the conventional application amount of phoxim is only 2 kg / mu, which is 6 times the conventional amount), and then the enzyme was flushed once after an interval of 5 days, with an amount of 200 L / mu, and potato and soil samples were collected on the 90th day to measure the content of phoxim in potato tubers and soil, respectively.

[0055] like Figure 2 As shown in A, the residual amount of phoxim in the soil samples of the treatment group of Example 3 was significantly reduced compared with that of the treatment group of CK during the sampling period, with a reduction of 42.35%. This shows that even if phoxim is applied at a high dose, the residual amount of phoxim in the potato farmland soil can still be significantly reduced by flushing the field with agricultural enzyme liquid fertilizer.

[0056] like Figure 2 As shown in B, the residual amount of phoxim in potatoes of the treatment group of Example 3 was significantly reduced by 77.22% compared with the treatment group of CK during the sampling period. This shows that even if phoxim is applied at a high dose, the residual amount of phoxim in potato tubers can still be significantly reduced by flushing agricultural enzyme liquid fertilizer in the field.

[0057] The diversity of bacterial communities in the soil after being treated with the agricultural enzymes for degrading phoxim provided in Examples 1 to 3 and Comparative Example 1 was determined as follows: soil samples were collected from the test area, 0.5 g of soil was taken, and the soil was subjected to a 30% saturation reaction using MP The total soil DNA was extracted using the SPIN Kit for Soil (MP Biomedicals, USA). The extracted DNA was finally dissolved with 80 μL DES Elution Solution and quality tested by an ELISA reader. Samples with an absorbance of 260 / 280 between 1.8 and 2.0 were retained and the DNA concentration of each sample was recorded. Unqualified samples were re-extracted. The qualified bacterial DNA needs to be amplified by PCR for library construction. Different primers can be selected for PCR amplification as shown in Table 1 for identification of bacterial community species and community structure. The product obtained by PCR amplification needs to be constructed into a library, and the DNA fragment is inserted into the library for sequencing. Library construction includes steps such as DNA fragment connection, PCR amplification, purification and quality testing. The importance of library construction lies in ensuring the quality of library construction while retaining the microbial community information to the maximum extent. After the library construction is completed, a suitable sequencing platform needs to be selected for sequencing. The available sequencing platforms include Illumina, PacBio and Nanopore. The data obtained after sequencing needs to undergo steps such as quality control, sequence splicing, OTU clustering and species annotation. Commonly used data analysis software includes QIIME, Mothur and UPARSE. The obtained data were quality filtered and de-chimerized, and clustered to generate ASV (100% similarity). Low-abundance ASVs were filtered by the method that the abundance was greater than 0 and existed in at least two sequences. The data were leveled according to the ASV with the lowest abundance in the sample, and the Shannon diversity index was calculated using Qiime software (Version 1.7.0).

[0058] Table 1 Sequencing primers

[0059] name Sequence (5'-3') serial number 515F GTGCCAGCMGCCGCGGTAA SEQ ID NO:1 907R CCGTCAATTCCTTTGAGTTT SEQ ID NO:2

[0060] The results show that the enzymes for degrading phoxim provided in Examples 1 to 3 and Comparative Example 1 can all increase the diversity of bacterial communities in the soil (e.g. Figure 3 As shown), among which Example 2 and Example 3 have the most obvious effect on improving the diversity of soil bacterial communities.

[0061] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0062] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. An agricultural enzyme for degrading phoxim, characterized in that: It is composed of the following raw materials in parts by weight: 400-600 parts of brown sugar, 4-6 parts of yeast powder and 250-1000 parts of scutellaria baicalensis.

2. The agricultural enzyme according to claim 1, characterized in that The preparation method of the agricultural enzyme comprises: mixing the scutellaria baicalensis, the yeast powder and the brown sugar with water, and fermenting at 20°C to 30°C, measuring the pH value of the fermentation liquid during the fermentation process, and stopping the fermentation when the pH value is less than 5.5, collecting the fermentation product, and obtaining the agricultural enzyme; The weight proportion of the water is 4000 to 6000 parts.

3. The agricultural enzyme according to claim 2, characterized in that The scutellaria baicalensis root is crushed and mixed with the brown sugar and water.

4. The agricultural enzyme according to claim 3, characterized in that The particle size of the scutellaria baicalensis after crushing is 50 mesh to 200 mesh.

5. The agricultural enzyme according to claim 4, characterized in that The scutellaria baicalensis includes one of the following: astragalus root, scutellaria baicalensis stem and leaf, and scutellaria baicalensis residue; The scutellaria baicalensis residue is the scutellaria baicalensis residue collected after extracting the scutellaria baicalensis root or the scutellaria baicalensis stem and leaf by reflux method, decoction method or ultrasonic extraction method; In the reflux method, ethanol with a volume fraction of 50% to 65% is used as the solvent for extraction; In the decoction method, the root of Scutellaria baicalensis or the stem and leaf of Scutellaria baicalensis is mixed with water in an amount of 8 to 10 times the mass of the root of Scutellaria baicalensis or the stem and leaf of Scutellaria baicalensis and decocted for 1 to 2 hours; In the ultrasonic extraction method, 50% to 65% ethanol by volume is used as a solvent to extract the root or stem and leaf of Scutellaria baicalensis. The ultrasonic power is 100W to 200W and the ultrasonic time is 20 to 40 minutes.

6. The agricultural enzyme according to claim 5, characterized in that In the reflux method, the mass volume ratio of the scutellaria root or scutellaria stem and leaf to the ethanol is 15-30 g: 200-300 mL; the temperature of the reflux extraction is 50° C. to 70° C.; the number of reflux extractions is 1 to 3 times; In the decoction method, the number of decoctions is 1 to 3 times; In the ultrasonic extraction method, the extraction times are 1 to 3 times, and the mass volume ratio of the scutellaria root or scutellaria stem and leaf to the ethanol is 30g:250mL.

7. Use of the agricultural enzyme as claimed in claim 1 in degrading phoxim in soil.

8. A method for degrading phoxim in soil, characterized in that: include: The agricultural enzyme according to any one of claims 1 to 6 is applied to soil containing residual phoxim.

9. The method according to claim 8, characterized in that The agricultural enzyme is diluted 50 to 200 times and then applied to the soil with residual phoxim.

10. The method according to claim 8, characterized in that The application amount of the agricultural enzyme is 10kg / mu to 14kg / mu.

Images