Tea tree CsGRF7 gene and application thereof

Abstract

The invention discloses a tea tree CsGRF7 gene and application thereof. The nucleotide sequence of the CDS sequence of the CsGRF7 gene is shown as SEQ ID NO. 1. According to the invention, a precursor sequence of the tea tree CsGRF7 gene or CsmiR396a gene is connected to a carrier and is transformed to arabidopsis thaliana through agrobacterium tumefaciens mediation, and a transgenic line is obtained through screening and culturing. The result shows that CsmiR396a and CsGRF7 in the tea tree both participate in the GA approach to regulate and control the development of flowers. The invention further discloses application of the precursor sequence of the tea tree CsmiR396a gene to interference of CsGRF7 gene expression in participation in regulation and control of plant flower development in a GA (Genetic Acid) way.

Description

Technical Field

[0001] The invention relates to the technical field of plant genetic engineering, and in particular to a tea tree CsGRF7 gene and an application thereof. Background Art

[0002] Tea trees are an important economic crop in my country. Tea products made from its leaves are popular among consumers because of their diverse appearance, rich taste, and rich ingredients that are beneficial to human health, such as catechins and theanine. Flowers are the organs for plants to reproduce offspring, and are also one of the main materials for plant breeding and improvement. The economic part of the tea tree is the leaves. When the flowers develop too vigorously, they will compete with the leaves for nutrients, which will have an adverse effect on the yield and quality of tea. Therefore, exploring the key genes that regulate the development of tea flowers and in-depth analysis of their related molecular regulatory mechanisms can provide important genetic resources for improving the quality of tea and lay a theoretical foundation for the directional variety breeding and molecular breeding of tea trees.

[0003] A large number of studies have shown that miRNA plays a very important role in all processes of plant growth and development. MiR396 is a relatively conservative miRNA family in plants, and has been shown to be involved in the regulation of organ growth and development in many plants, but the function of miR396a in tea plants is still unclear. GRF7 is a type of plant-specific transcription factor that plays a role in the development of leaves, stems, roots, the formation of flowers and seeds, and adversity resistance, but its function in tea plants is still unclear. Summary of the invention

[0004] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a tea plant CsGRF7 gene and application thereof.

[0005] To achieve the above purpose, the technical solution designed by the present invention is as follows:

[0006] The present invention provides a tea plant CsGRF7 gene, and the nucleotide sequence of the CDS sequence of the CsGRF7 gene is shown as SEQ ID NO.1.

[0007] The present invention also provides a recombinant plasmid pBinRed3-CsGRF7, wherein the CsGRF7 gene according to claim 1 is inserted into the vector pBinRed3.

[0008] The present invention also provides an Agrobacterium strain containing the recombinant plasmid pBinRed3-CsGRF7, wherein the Agrobacterium strain is GV3101.

[0009] The present invention also provides an application of the CsGRF7 gene described in claim 1 in regulating the development of tea tree flowers.

[0010] Use of any of the following in cultivating a new variety of Arabidopsis thaliana with sterile flowers, wherein:

[0011] (1) the above-mentioned CsGRF7 gene;

[0012] (2) the above-mentioned recombinant plasmid pBinRed3-CsGRF7;

[0013] (3) the above-mentioned Agrobacterium strains.

[0014] The application is to connect the tea tree CsGRF7 gene to a vector, transform it into Arabidopsis thaliana through Agrobacterium-mediated transformation, screen, culture and obtain transgenic strains.

[0015] The present invention also provides an application of a precursor sequence of the tea plant CsmiR396a gene to interfere with the expression of the CsGRF7 gene in regulating plant flower development through the GA pathway. The nucleotide sequence of the precursor sequence of the tea plant CsmiR396a gene is shown in SEQ ID NO.2.

[0016] Furthermore, the plant is tea tree, Arabidopsis thaliana or tobacco.

[0017] Furthermore, the interference is the cleavage of CsGRF7 by CsmiR396a gene. The present invention also provides a use of the precursor sequence of the tea plant CsmiR396a gene as claimed in claim 6 in cultivating a new variety of Arabidopsis thaliana that promotes flower sterility.

[0018] Furthermore, the application is to connect the precursor gene of the tea tree CsmiR396a gene to a vector, transform it into Arabidopsis thaliana through Agrobacterium-mediated transformation, and screen, culture and obtain transgenic strains.

[0019] Beneficial effects of the present invention:

[0020] 1. The present invention selects tea varieties 'Fuding Da Baicha' and 'Fo Shou' with large differences in the number of flowers, and detects CsmiR396a, CsGRF7 and GA pathway-related genes. As a result, the expression trends of CsmiR396a and CsGRF7 modules in the two varieties are the same, that is, the expression of CsmiR396a increases with the development of flowers, and the expression of CsGRF7 decreases with the development of flowers. The expression trends of CsGA20ox1 and CsSLRL1, two genes related to the GA pathway, are opposite between the two varieties. Specifically, the expression of CsGA20ox1 in 'Fuding Da Baicha' increases with the development of flowers, and the expression of CsSLRL1 in 'Fo Shou' decreases with the development of flowers; the expression of CsSLRL1 in 'Fuding Da Baicha' decreases with the development of flowers, and the expression of CsGRF7 in 'Fo Shou' increases with the development of flowers; the results show that CsmiR396a and CsGRF7 in tea trees both regulate the development of flowers by participating in the GA pathway.

[0021] 2. The present invention discovered through degradation group data that the target gene of CsmiR396a in tea trees is CsGRF7. The fluorescence quantitative results show that the expression levels in 9 tissues of tea trees (buds, first leaves, third leaves, young stems, mature leaves, old leaves, lateral roots, flowers and fruits) showed opposite trends, which is consistent with the law of negative regulation of target genes by miRNA in plants; at the same time, by stably overexpressing CsmiR396a and CsGRF7 genes in Arabidopsis thaliana, it was found that after overexpressing CsmiR396a, the expression of CsGRF7 gene in Arabidopsis leaves significantly decreased, and the content of GA1 significantly increased; after overexpressing CsGRF7, the expression of CsGRF7 gene in Arabidopsis leaves significantly increased, and the content of GA1 significantly decreased.

[0022] The invention is helpful for the research on the functional differentiation of the tea tree CsGRF7 gene and the Arabidopsis thaliana GRF family, and provides resources for the breeding of new Arabidopsis thaliana varieties.

[0023] 3. The present invention confirmed that the splicing site of CsmiR396a on CsGRF7 is the 314th base based on 5'RLM-RACE experiment; the transient expression experiment in tobacco leaves also confirmed the splicing effect of CsmiR396a on CsGRF7. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The three stages of plant and flower development of tea varieties 'Fuding Dabaicha' and 'Buddha's Hand';

[0025] In the figure, S1, sepals are completely separated; S2, flower is half-opened; S3, flower is fully open;

[0026] Figure 2The expression levels of CsmiR396a, CsGRF7, CsGA20ox1 and CsSLRL1 in tea varieties ‘Fuding Dabaicha’ and ‘Foshou’;

[0027] Figure 3 This is the positive identification result of Arabidopsis thaliana CsmiR396a and CsGRF7 overexpression lines;

[0028] Figure 4 This is the expression level diagram of GA1 and related genes in Arabidopsis thaliana CsmiR396a and CsGRF7 overexpression lines;

[0029] Figure 5 The phenotypes of Arabidopsis thaliana CsmiR396a and CsGRF7 overexpression lines are shown;

[0030] Figure 6 This is the result of 5'RLM-RACE experiment;

[0031] In the figure, the red arrows indicate the degradation sites of CsGRF7, and the numbers represent the proportion of CsGRF7 broken at the CsmiR396a target site in the sequenced samples;

[0032] Figure 7 Validation of the interaction map between CsGRF7 and CsmiR396a in the tobacco transient system;

[0033] In the figure, A is the GFP fluorescence signal diagram of different combinations under strong light, ultraviolet light and in vivo imaging; B is the relative fluorescence intensity diagram of different combinations. DETAILED DESCRIPTION

[0034] The present invention is further described in detail below in conjunction with specific embodiments so that those skilled in the art can understand.

[0035] Example 1 Screening for genes involved in GA pathway regulation of flower development

[0036] 1. Extraction of tea plant genomic DNA

[0037] Genomic DNA was extracted from tea leaves using a plant DNA kit (Adele).

[0038] 2. Extraction of RNA from Tea Tree

[0039] RNA was extracted from tea leaves using a Plant RNA Kit (Adele).

[0040] 3. Functional identification of different genes in tea plants

[0041] Two varieties, 'Fuding Da Baicha' (FDDBC) with a large number of flowers and 'Foshou' (FS) with a small number of flowers, were selected. For each variety, three stages were selected as materials: sepals completely separated (S1), flowers half-opened (S2), and flowers fully opened (S3). Figure 1 ), the expression levels of CsmiR396a, CsGRF7, CsGA20ox1 and CsSLRL1 were detected, and the sequence information is shown in the following table.

[0042]

[0043]

[0044] The results showed that the expression level of CsGA20ox1 increased with the development of camellia in 'Fuding Da Baicha' (FDDBC) with a large number of flowers, but decreased in 'Foshou' (FS) with a small number of flowers; the expression level of CsSLRL1 decreased with the development of camellia in 'Fuding Da Baicha' (FDDBC) with a large number of flowers, but increased in 'Foshou' (FS) with a small number of flowers; the expression level of CsmiR396a increased with the development of camellia, and the trend of CsGRF7 was the opposite ( Figure 2 ); Therefore, both CsmiR396a and CsGRF7 in tea plants regulate flower development by participating in the GA pathway.

[0045] Example 2 Cultivation and functional verification of CsmiR396a and CsGRF7 transgenic Arabidopsis lines

[0046] 1. Extraction of tea plant genomic DNA

[0047] Genomic DNA was extracted from tea leaves using a plant DNA kit (Adele).

[0048] 2. Extraction of RNA from Tea Tree

[0049] RNA was extracted from tea leaves using a Plant RNA Kit (Adele).

[0050] 3. Amplification of CsmiR396a and CsGRF7:

[0051] (1) Amplify the fragment containing the CsmiR396a precursor (SEQ ID NO.2), the mature sequence of CsmiR396a (SEQ ID NO.3) and the CDS of CsGRF7 (SEQ ID NO.1) respectively.

[0052]

[0053] A homologous recombination adapter (Tsingke) was added to the 5' end of the designed primer. The primer sequences are shown in the table below.

[0054] Primer name Primer sequence (5'-3') CsmiR396a-F GAGGACACGGAATTCTCTAGATCACAATGCAAGTATGTGAGAGATC CsmiR396a-R GGTGGACTCCTCTTAAAGCTTACCTGAGAAGATAAGAATTGACCC CsGRF7-F TTCTCTAGACCCGGGCTCGAGATGGCACCAGCAGCTTTG CsGRF7-R GGTGGACTCCTCTTAAAGCTTTCAGCTCAGCCATTGAAAAG

[0055] The amplified fragments were homologously recombined with the vector pBinRed3 that had been double-digested with XbaI and HindIII to obtain recombinant plasmids pBinRed3-CsmiR396a and pBinRed3-CsGRF7, respectively.

[0056] (2) The recombinant plasmid was transferred into the Agrobacterium strain GV3101 by chemical transformation, and the recombinant Agrobacterium strain containing the recombinant plasmid pBinRed3-CsmiR396a and the recombinant plasmid pBinRed3-CsGRF7 was screened.

[0057] (3) The inflorescence of healthy Arabidopsis thaliana grown for about one month and in good condition was infected with the recombinant Agrobacterium strains containing the recombinant plasmid pBinRed3-CsmiR396a and the recombinant plasmid pBinRed3-CsGRF7, respectively, once every four days, and the infection was repeated 4-5 times. The mature seeds were collected, dried in an oven at 28°C, and then screened by ultraviolet light to obtain T0 generation seeds with red fluorescence.

[0058] 4. Detection of the expression levels of CsmiR396a and CsGRF7 in overexpressed Arabidopsis strains by RT-PCR:

[0059] Total RNA from leaves of transgenic Arabidopsis thaliana and wild-type Arabidopsis thaliana was extracted using a plant RNA extraction kit and reverse transcribed using a reverse transcription kit (Simgen). The reverse transcription primers for CsGRF7 were random primers, and the reverse transcription primers for CsmiR396a were stem-loop primers designed based on the sequence. The internal reference gene for fluorescent quantitative CsGRF7 was GAPDH, and the internal reference gene for CsmiR396a was U6.

[0060] The analysis was performed using 2× Sybr Green qPCR mix (PC6102, Adler) on an AB StepOne Plus real-time PCR system according to the following program: denaturation at 94°C for 3 min; 94°C for 10 s, annealing at 60°C for 34 s (40 cycles); annealing at 95°C for 15 s, annealing at 65°C for 1 min; then reaching 95°C at a rate of 0.3°C / s, and then annealing at 95°C for 15 s. The relative fold change of gene expression was expressed as 2 −ΔΔCt Method. Each PCR reaction was repeated at least three times independently. The primer sequences are shown in the table in Example 1.

[0061] The results showed that the expression levels of CsmiR396a and CsGRF7 in transgenic Arabidopsis thaliana containing CsmiR396a and CsGRF7 were significantly increased ( Figure 3 ), indicating that the CsmiR396a and CsGRF7 genes of tea plant were successfully transferred into Arabidopsis and stably expressed.

[0062] 5. Detection of GA1 content in Arabidopsis strains overexpressing CsmiR396a and CsGRF7 using triple quadrupole liquid chromatography-mass spectrometry:

[0063] GA1 was extracted from leaves of WT, CsmiR396a and CsGRF7 overexpressing Arabidopsis lines and measured on a triple quadrupole LC-MS instrument ALTIS (Thermo Fisher). The method was as follows: 0.4‰ acetic acid water was used as mobile phase A, 100% acetonitrile was used as mobile phase B, and the chromatographic elution program was as follows: B: 5%, 0 to 1 min; 1 to 5 min, B phase linearly increased from 5% to 20%, then linearly increased to 98% at 10 min and maintained for 2 min; at 12 min, B phase was reduced to 5% and maintained for 4 min. The flow rate was 0.30 mL / min. The injection volume was 10 μL. Hypersil GOLD HPLC columns (Thermo scientific, 150 mm × 2.1 mm) were used to separate GA1 in wild-type, CsmiR396a and CsGRF7 overexpressing Arabidopsis lines. The GA1 in the sample was qualitatively analyzed based on the retention time and ion characteristics of the standard; the GA1 was quantitatively analyzed based on the peak area of ​​the control in each treatment and the sample preparation data.

[0064] The results showed that compared with WT, the content of GA1 was significantly increased in the CsmiR396a overexpression line and significantly decreased in the CsGRF7 overexpression line ( Figure 4 ).

[0065] 6. qRT-PCR was used to detect the phenotypes of Arabidopsis strains overexpressing CsmiR396a and CsGRF7 and the expression of hormone-related genes:

[0066] Compared with the wild type, the leaves of the CsGRF7 transgenic line are smaller and wrinkled, and the whole plant is stunted and short. In contrast, the leaves of the CsmiR396a transgenic line are larger, stretched and straight, and the plant develops normally. According to the statistical results of plant height of 15 wild-type, 12 CsmiR396a-OE and 9 CsGRF7-OE, there is no significant difference between CsmiR396a-OE and wild type, but CsGRF7-OE has extremely significant differences compared with both wild type and CsmiR396a-OE. In addition to the stunted leaf development, the flowers of the CsGRF7 transgenic line also show obvious sterility characteristics, and obvious abnormalities in development: the siliques are extremely short and seedless ( Figure 5 ).

[0067] AtGA3ox4, AtGAI, AtRGA, AtRGL1, and AtRGL2, which are related to Arabidopsis gibberellin metabolism, were found on the Arabidopsis database TAIR website, and the expression levels of these genes in the three groups of samples were measured. The primer sequences are shown in the table below.

[0068]

[0069]

[0070] Compared with WT, the expression characteristics of AtGAI, AtRGA, AtRGL1, and AtRGL2 in the three groups of samples were opposite to the content of GA1. The expression level was significantly decreased in the CsmiR396a overexpression strain, but significantly increased in the CsGRF7 overexpression strain. The GA1 biosynthesis-related gene AtGA3ox4 had the same characteristics as the GA1 content, which was higher in the CsmiR396a overexpression strain and lower in the CsGRF7 overexpression strain ( Figure 4 ).

[0071] Example 3 Effects of CsGRF7 cleavage by CsmiR396a on plants

[0072] 1. Verification of CsGRF7 cleavage by CsmiR396a in tea plants

[0073] The 5'RLM-RACE technique was used to verify the cleavage of CsGRF7 by CsmiR396a using the FirstChoice RLM-RACE kit (Invitrogen, Thermo Fisher Scientific); the details are as follows:

[0074] Under the action of T4 RNA ligase, the designed 5' end adapter was connected to the total RNA of tea tree (greater than 1000ng), and then reverse transcribed into cDNA using random primers; the obtained cDNA was amplified by two rounds of PCR using the 5' end adapter primer and the 3' end gene specific primer and analyzed on agarose gel. The obtained target band was purified using a DNA gel extraction kit (Code no.DR01, Aidlab, Beijing, China) and cloned into the pTOPO-TA vector (Code no.CV14, Aidlab, Beijing, China), transformed into DH5α chemical competent cells (Code no.G6016, Shanghai, China), and sequenced to determine whether the mRNA was the cleavage site of miRNAs.

[0075] The 5' end adapter sequence and 3' end specific primer information of the gene used in the 5' RLM-RACE experiment are shown in the table below.

[0076]

[0077]

[0078] After sequencing the obtained gene fragments, 5 of the 10 sequencing results showed that the target bands were present, proving that in tea plants, CsmiR396a can degrade CsGRF7 by complementing the target site ( Figure 6 ).

[0079] 2. Verification of CsGRF7 cleavage by CsmiR396a in tobacco

[0080] The fragment containing the CsmiR396a precursor (SEQ ID NO.2) was inserted into the pBI121 vector after double restriction digestion with XbaI and SacI by homologous recombination, thus obtaining pBI121-CsmiR396a. Two complementary target site sequences (21nt) were synthesized respectively, and the double-stranded DNA formed by annealing the two oligonucleotide DNAs was inserted between the two restriction sites XhoⅠ and XbaⅠ of the pMS4 vector by homologous recombination, thus obtaining pMS4-CsGRF7. The two recombinant plasmids were transferred into the Agrobacterium strain GV3101 by chemical transformation, and the recombinant Agrobacterium strains containing the recombinant plasmid pBI121-CsmiR396a and the recombinant plasmid pMS4-CsGRF7 were screened respectively. Agrobacterium was combined in pairs and infiltrated into tobacco leaves from the back through a disposable needle. Under normal culture conditions, the expression of GFP fluorescence was observed after 3 days using a handheld UV analyzer (ZF-5) and a live imager (NightSHADE L985, Berthold). The primers used to construct the fragment containing the CsmiR396a precursor and the CsGRF7 target site are shown in the table below.

[0081] Primer name Primer sequence (5'-3') CsmiR396a-HR-F GAGAACACGGGGGACTCTAGATCACAATGCAAGTATGTGAGAGATC CsmiR396a-HR-R GGGGAAATTCGGAGCTCACCTGAGAAGATAAGAATTGACCC CsGRF7-HR-F TCCTCGGCCGAATTCCTCGAGCCGTTCAAGAAAGCCTGTGGA CsGRF7-HR-R TTCTTCTCCTTTACTTCTAGATCCACAGGCTTCTTGAACGG

[0082] The results showed that only when the bacterial solutions of CsmiR396a and CsGRF7 were mixed, CsmiR396a bound to the target site of CsGRF7 and degraded it, thereby inhibiting the expression of the GFP gene, resulting in a decrease in the green fluorescence signal on tobacco leaves ( Figure 7 ).

[0083] Although the above embodiments have been described in detail, they are only a part of the embodiments of the present invention, not all of them. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all belong to the protection scope of the present invention.

Claims

1. A tea plant CsGRF7 gene, characterized in that: The nucleotide sequence of the CDS sequence of the CsGRF7 gene is shown in SEQ ID NO.

1.

2. A recombinant plasmid pBinRed3-CsGRF7, characterized in that: The recombinant plasmid pBinRed3-CsGRF7 is obtained by inserting the CsGRF7 gene according to claim 1 into the vector pBinRed3.

3. An Agrobacterium strain containing the recombinant plasmid pBinRed3-CsGRF7 according to claim 2, characterized in that: The Agrobacterium strain is GV3101.

4. Use of the CsGRF7 gene according to claim 1 in regulating the development of tea plant flowers.

5. Use of any one of the following in cultivating a new variety of Arabidopsis thaliana with sterile flowers, characterized in that: include (1) The CsGRF7 gene according to claim 1; (2) the recombinant plasmid pBinRed3-CsGRF7 according to claim 2; (3) The Agrobacterium strain according to claim 3.

6. An application of a precursor sequence of the tea plant CsmiR396a gene to interfere with the expression of the CsGRF7 gene in regulating plant flower development through the GA pathway, characterized in that: The nucleotide sequence of the precursor sequence of the tea plant CsmiR396a gene is shown in SEQ ID NO.

2.

7. The use according to claim 6, characterized in that: The plant is tea tree, Arabidopsis thaliana or tobacco.

8. The use according to claim 6 or 7, characterized in that: The interference is the shearing of CsGRF7 by the CsmiR396a gene.

9. Use of the precursor sequence of the tea plant CsmiR396a gene according to claim 6 in cultivating a new variety of Arabidopsis thaliana that promotes floral sterility.

10. The use according to claim 9, characterized in that: The application is to connect the precursor gene of the tea tree CsmiR396a gene to a vector, transform it into Arabidopsis thaliana through Agrobacterium-mediated transformation, and screen, culture and obtain transgenic strains.

Images