Rice OsSPL10 mutant gene and application of rice OsSPL10 mutant gene in improvement of ammonium phosphate resistance of rice straw

Abstract

The invention relates to a mutant gene of a rice OsSPL10 gene and application of the mutant gene. The nucleotide sequence of the mutant gene is shown as SEQ IN NO.1, and the mutant gene can endow rice with resistance to glufosinate-ammonium herbicide; according to the invention, a rice variety 'Yangxian 9B' is treated by an EMS chemical mutagenesis technology, mutation of the OsSPL10 gene is successfully induced, and the mutation causes that the 225th amino acid in the amino acid sequence of the encoded protein is changed into tyrosine from cysteine; the application also develops a KASP molecular marker for the variation site, molecular marker detection and field glufosinate-ammonium resistance screening and verification prove that rice with the mutant gene can improve the glufosinate-ammonium resistance, and the gene has significant application potential in agricultural production, and can reduce the use of herbicides and improve the crop yield and quality.

Description

Technical Field

[0001] The present invention belongs to the field of plant protein and plant resistance to herbicides. Specifically, the present invention relates to an OsSPL10 mutant protein, which can impart the property of herbicide resistance to plants, especially rice. The present invention discloses the gene sequence and the sequence of the mutant protein, as well as their application in the field of plant resistance, especially rice resistance to herbicides. Background Art

[0002] Glufosinate, as a highly effective non-selective herbicide, belongs to the class of glutamine synthetase inhibitors (GSI) and is widely used in agricultural production. It effectively controls weed growth by inhibiting glutamine synthetase in plants and blocking amino acid synthesis. Although glufosinate has the advantages of broad spectrum, low toxicity and good environmental compatibility, it is not very selective for crops, especially for sensitive crops such as rice. Improper use may lead to growth stunting or even death, affecting yield and quality.

[0003] As an important food crop in the world, rice's sensitivity to glufosinate limits its use in rice cultivation. Long-term reliance on chemical herbicides may also lead to weed resistance, increasing the difficulty of agricultural production. Therefore, improving rice's tolerance to glufosinate is of great significance for ensuring food security and improving agricultural production efficiency. However, traditional breeding methods face many challenges in improving rice's tolerance to glufosinate, such as long breeding cycles, low efficiency, and complex genetic traits. In addition, although transgenic technology has successfully cultivated glufosinate-resistant crops in some countries, its global promotion and application is limited by regulatory restrictions and public acceptance.

[0004] In view of this, the present invention aims to explore and develop new rice germplasms, especially glufosinate-resistant rice germplasms obtained by chemical mutagenesis technology. This method is not only simple to operate and efficient, but also can obtain glufosinate-resistant traits without introducing exogenous genes, which is more easily accepted by the public and is expected to be promoted and applied worldwide. Summary of the invention

[0005] In order to solve the above problems, the present invention provides a rice OsSPL10 mutant gene obtained by EMS (ethyl methanesulfonate) chemical mutagenesis, which has glufosinate resistance and can be used to create new seed resources with glufosinate resistance.

[0006] Specifically, the present application is implemented through the following technical solutions:

[0007] First, the present application provides a rice OsSPL10 mutant gene, the nucleotide sequence of the gene is shown in SEQ IN NO.1, and the amino acid sequence of the encoded protein is shown in SEQ IN NO.2.

[0008] Secondly, the present application provides an application of the above rice OsSPL10 mutant gene in rice breeding, that is, hybridizing rice containing the OsSPL10 mutant gene as the male parent and wild-type rice as the female parent to improve the glufosinate resistance of the offspring rice.

[0009] Third, the above-mentioned "rice containing the OsSPL10 mutant gene" means that PCR amplification is carried out using the upstream primer OsSPL10-F1, the upstream primer OsSPL10-F2, and the universal primer OsSPL10-R as primers, and the fluorescence signal of the amplification product is read. The rice sample that emits a blue fluorescence signal is the rice containing the OsSPL10 mutant gene; the nucleotide sequences of the above-mentioned upstream primer OsSPL10-F1, the upstream primer OsSPL10-F2, and the universal primer OsSPL10-R are shown in SEQ IN NO.5-SEQ IN NO.7 respectively.

[0010] The above-mentioned “improving the glufosinate resistance of offspring rice” means that the offspring rice can still grow normally when sprayed with a glufosinate solution with a concentration of 0.40g / L.

[0011] Fourth, the present application provides KASP primers for detecting the above-mentioned rice OsSPL10 mutant gene, which primers are composed of an upstream primer OsSPL10-F1 with a nucleotide sequence as shown in SEQ IN NO.5, an upstream primer OsSPL10-F2 with a nucleotide sequence as shown in SEQ IN NO.6, and a universal primer OsSPL10-R with a nucleotide sequence as shown in SEQ IN NO.7.

[0012] The above detection refers to the PCR reaction system: 5μl 2×PARMS master mix, 0.15μl upstream primer OsSPL10-F1, 0.15μl upstream primer OsSPL10-F2, 0.4μl universal primer OsSPL10-R, DNA template 10-100ng, ddH2O supplemented to 10μl.

[0013] PCR reaction program: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing at 65-57°C (-0.8°C / Cycle) for 1 min, 10 cycles; annealing at 94°C for 20 s, extension at 57°C for 1 min, 32 cycles, and the PCR amplification products were stored at 4°C.

[0014] The fluorescence signal of the PCR amplification product is then read. The rice sample that emits a blue fluorescence signal contains the OsSPL10 mutant gene, and its corresponding genotype is A.

[0015] Fifth, the present application provides a method for detecting glufosinate-ammonium resistance in rice, namely, performing PCR amplification using upstream primer OsSPL10-F1, upstream primer OsSPL10-F2, and universal primer OsSPL10-R as primers, reading the fluorescence signal of the amplification product, and a rice sample that emits a blue fluorescence signal has glufosinate-ammonium resistance; the nucleotide sequences of the upstream primer OsSPL10-F1, upstream primer OsSPL10-F2, and universal primer OsSPL10-R are shown in SEQ IN NO.5-SEQ IN NO.7 respectively.

[0016] In the present application, "glufosinate resistance" refers to rice that can still grow normally when sprayed with a glufosinate solution at a concentration of 0.40 g / L.

[0017] The present application used EMS chemical mutagenesis to treat the indica rice variety Yangxian 9B, and found that the 674th nucleotide of the CDS sequence of the OsSPL10 gene of rice mutated from guanine G to adenine A, causing the 225th amino acid of the protein sequence to change from cysteine ​​(Cys / C) to tyrosine (Tyr / T), which can make rice resistant to glufosinate herbicides. In the embodiments of the present application, the rice variety "Yangxian 9B" was treated with EMS chemical mutagenesis, combined with glufosinate tolerance screening, and successfully obtained glufosinate-resistant rice germplasm with mutations in the OsSPL10 gene. The germplasm showed high tolerance to glufosinate under field conditions, providing a new seed resource preparation method for agricultural production.

[0018] Rice varieties with the OsSPL10 mutant gene are expected to reduce the use of chemical herbicides while increasing crop yield and quality, which is of great significance to environmental protection and sustainable agricultural development. In addition, the method of the present invention can also be extended to the screening of herbicide-resistant mutants of other crops, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Schematic diagram of the screening process for M3 generation glufosinate-resistant rice germplasm.

[0020] Figure 2 Results of sequence difference analysis of OsSPL10 gene in mutants.

[0021] Figure 3 Schematic diagram of the G / A site of the OsSPL10 mutant gene.

[0022] Figure 4 KASP marker typing results.

[0023] Figure 5 This is a photo showing the resistance of the new germplasm Yuan 88S-OsSPL10T. DETAILED DESCRIPTION

[0024] The rice seeds involved in the following examples are all provided by Jiangsu Lixiahe Agricultural Science Research Institute. Example 1 Mining of rice Yangxian 9B glufosinate-resistant mutant materials

[0025] (1) Seed selection and pretreatment: The disease-resistant and high-temperature-resistant high-quality maintenance line "Yangxian 9B" (cultivated by the Lixiahe Regional Agricultural Science Research Institute in Jiangsu Province, as disclosed in patent CN 116716430 A) was selected as the mutagenesis object. The seeds were soaked in clean water overnight the day before the experiment to ensure that the seeds fully absorbed water and activated their growth potential.

[0026] (2) Chemical mutagenesis treatment: The next day, the healthy seeds were cleaned and selected, and then soaked in 1.2% ethyl methanesulfonate (EMS) solution for 10 h. During this process, the seeds were shaken several times to ensure that they were in full contact with the mutagen, thereby improving the mutagenesis efficiency.

[0027] (3) Neutralization and cleaning: The treated seeds (M1 generation) were taken out and rinsed with running water overnight to remove the residual mutagen. During this process, 5% sodium thiosulfate was used as a terminator and antidote to neutralize the EMS residual liquid to prevent environmental pollution and further damage to the seeds.

[0028] (3) Cultivation of M2 generation seeds: Soak the treated M1 generation seeds for germination, then sparsely sow them to cultivate strong seedlings. Use a single-plant planting method and perform regular fertilizer and water management to ensure that they can grow healthily and produce seeds during the maturity period. After the M1 generation plants mature, self-pollinate to obtain M2 generation seeds.

[0029] (4) Screening of M2 generation seeds and rescreening of M3 generation: The following year, M2 generation seeds were sown in the field, and when the seedlings grew to the 3-4 leaf stage, a glufosinate solution with a concentration of 0.4 g / L was sprayed. After 10 days, the plant's reaction was observed, and the plants that still maintained normal green color and grew well were screened out, which were glufosinate-resistant mutant plants. The screened glufosinate-resistant plants were harvested individually to reduce the possibility of gene recombination, and rescreening was continued in the M3 generation to ensure the stability of the mutant trait. Finally, 5 stable glufosinate-resistant rice germplasms were obtained, named: CAL1-1, CAL1-2, CAL1-3, CAL1-4, and CAL1-5. Figure 1Schematic diagram of the screening process of M3 generation seeds, wherein A is a schematic diagram of the growth of rice seedlings before spraying with glufosinate ammonium solution, and B is a schematic diagram of the growth of rice seedlings after spraying with glufosinate ammonium solution. It can be seen that the CAL1-1 mutant plants have better glufosinate resistance, and other M3 generation plants are affected by the glufosinate ammonium solution and wither.

[0030] Example 2: Exploration of mutation loci in glufosinate-resistant germplasm and development of markers

[0031] (1) Exploration of mutation sites

[0032] ① Sequencing. The whole genome of 3 mutants among the 5 mutants obtained in Example 1 was sequenced using high-throughput sequencing technology (sequencing depth 30×);

[0033] ② Genome sequence comparison. Use bioinformatics tools to compare and analyze the genome sequence obtained by sequencing with the third-generation genome data of "Yangxian 9B" to identify mutation sites in the genome;

[0034] ③Comparison results. Compared with the wild type Yangxian 9B, the mutant plants CAL1-1, CAL1-2, and CAL1-3 had a mutation from guanine G to adenine A at position 674 in the CDS sequence of the OsSPL10 gene ( Figure 2 ), the nucleotide sequence after mutation is shown in SEQ IN NO.1 (the last three nucleotides tag are terminators and no protein is translated); the mutation causes the 225th amino acid of the protein encoded by the OsSPL10 gene to change from cysteine ​​to tyrosine, and the amino acid sequence of the mutant protein is shown in SEQ IN NO.2. The mutation site is as shown in Figure 3 As shown, (1) is the wild-type genome position, (2) is the mutant mutation site position, and the red box in the figure is the G / A mutation site. The sequence of the wild-type genome position is shown in SEQ IN NO.3, and the sequence of the mutant gene mutation site position is shown in SEQ IN NO.4.

[0035] (2) Molecular marker development

[0036] 2.1) KASP primer design. The online primer design website Primer3 (https: / / primer3.ut.ee / ) was used to design KASP markers based on the mutation site G / A for wild type and mutants. The upstream primer OsSPL10-F1 for Yangxian 9B was: GAAGGTGACCAAGTTCATGCTGAGCAGTAGCTTACCTGCTGC (SEQ IN NO. 5, where GAAGGTGACCAAGTTCATGCT is the FAM linker sequence), and the upstream primer OsSPL10-F2 for mutants was:

[0037] GAAGGTCGGAGTCAACGGATTGGAGCAGTAGCTTACCTGCTGT (SEQ IN NO. 6, wherein GAAGGTCGGAGTCAACGGATT is a HEX linker sequence) and common downstream primer OsSPL10-R: AGTACCACGCCAAGGCCT (SEQ IN NO. 7).

[0038] 2.2) Amplification and typing. Using rice plant leaf DNA as the target DNA, PCR amplification was performed using SEQ IN NO.5, SEQ IN NO.6 and SEQ IN NO.7 as primers. The amplified product was used to read the fluorescence signal using a TECAN infinite M1000 microplate reader, and then the online software snpdecoder (http: / / www.snpway.com / snpdecoder / ) was used to parse and convert the fluorescence signal to obtain a clear and intuitive typing diagram, and the genotype results were output according to different colors. The wild-type nucleotide "G" was assigned FAM, and the mutant nucleotide "A" was assigned HEX. The test results are as follows: Figure 4 As shown, the green dots are materials carrying "G", the blue dots are materials carrying "A", and the red dots are materials carrying heterozygous types, indicating that the KASP marker successfully types the OsSPL10 mutant gene.

[0039] PCR reaction system: 5 μl of 2×PARMS master mix, 0.15 μl of primer SEQ ID NO: 5, 0.15 μl of primer SEQ ID NO: 6, 0.4 μl of primer SEQ ID NO: 7, 10 ng of DNA template, and ddH2O to make up to 10 μl.

[0040] PCR reaction program: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing at 65-57°C (-0.8°C / Cycle) for 1 min, 10 cycles; annealing at 94°C for 20 s, extension at 57°C for 1 min, 32 cycles, and the PCR product was stored at 4°C.

[0041] Example 3: Creation of glufosinate-resistant germplasm using mutants and molecular markers

[0042] (1) Breeding of glufosinate-resistant germplasm.

[0043] ① Select Yuan 88S (variety right number: CNA20201003006) as the female parent and hybridize it with the homozygous mutant CAL1-1 obtained in Example 2 to obtain F1;

[0044] ②Use Yuan88S as the female parent and backcross with F1 plants to obtain BC1F1;

[0045] ③ Plant 40 BC1F1 plants, use the molecular marker primers (SEQ INNO.5-SEQ INNO.7) provided in Example 2 for detection, screen the plants carrying the mutant base "A" and with excellent agronomic traits, and backcross with Wushansi Miao to obtain BC2F1 plants;

[0046] ④ Plant 60 BC2F1 plants, perform molecular marker detection (same as in Example 2), select and harvest plants carrying the homozygous mutant base "A" and excellent agronomic traits to obtain BC2F2;

[0047] ⑤ Conduct molecular marker detection (same as in Example 2), and select 2 BC2F3 plants carrying the homozygous mutant base "A" and excellent agronomic traits from the BC2F2 self-pollinated progeny, one of which the applicant named Yuan88S-OsSPL10 T .

[0048] (2) Identification of glufosinate resistance in the created germplasm

[0049] Field planting of Yuan88S, Yuan88S-OsSPL10 T The plants were sprayed with glufosinate (at a concentration of 0.40 g / L, using a sprayer to ensure uniform coverage of the plant leaves). The 88S plant was set up as a control without glufosinate. The light, temperature and water conditions were kept the same for each group. The results on the 10th day were as follows: Figure 5 As shown, A is the edge 88S sprayed with glufosinate ammonium, and B is the edge 88S-OsSPL10 sprayed with glufosinate ammonium. T , C is the control group of Yuan88S without glufosinate. It can be seen that Yuan88S sprayed with glufosinate has completely died, while Yuan88S-OsSPL10 T It showed significant resistance to glufosinate-ammonium, with no mortality, just like the plant not sprayed with glufosinate-ammonium.

[0050] In this embodiment, glufosinate-resistant germplasm is obtained through backcrossing and molecular marker-assisted breeding, which can be used in agricultural production to reduce the use of herbicides and improve crop yield and quality.

Claims

1. A rice OsSPL10 mutant gene, the nucleotide sequence of which is shown in SEQ IN NO.

1.

2. Use of the mutant gene as claimed in claim 1 in rice breeding.

3. The use according to claim 2, characterized in that: The application refers to hybridization using rice containing the OsSPL10 mutant gene as the male parent and wild-type rice as the female parent to improve the glufosinate resistance of the offspring rice.

4. A set of primers for detecting the mutant gene according to claim 1, characterized in that: The primers consist of primers with nucleotide sequences as shown in SEQ IN NO.5-SEQ IN NO.

7.

5. A method for detecting glufosinate resistance in rice, characterized in that: The specific steps are as follows: using upstream primer OsSPL10-F1, upstream primer OsSPL10-F2, and universal primer OsSPL10-R as primers to perform PCR amplification, reading the fluorescence signal of the amplified product, and the rice sample that emits a blue fluorescence signal is resistant to glufosinate ammonium; The nucleotide sequences of the upstream primer OsSPL10-F1, the upstream primer OsSPL10-F2 and the universal primer OsSPL10-R are shown in SEQ IN NO.5 to SEQ IN NO.7 respectively.

Images