Watermelon seed vigor molecular marker and application

Abstract

The invention relates to a watermelon seed vigor molecular marker and application thereof, the marker is a Cla97C02G040900 gene, and the nucleotide sequence of the marker is as shown in SEQ ID NO: 1. By designing specific forward and reverse primers (SEQ ID NO: 2 and SEQ ID NO: 3), the expression level of the gene in watermelon seeds can be detected. The molecular marker is used for evaluating the vigor condition of watermelon seeds, the expression quantity of the gene is analyzed through real-time fluorescent quantitative PCR, the application comprises the step of identifying the vigor of the watermelon seeds through the watermelon seed vigor molecular marker, and the experimental process of the application comprises the steps of initiation treatment of seed vigor improvement, RNA (Ribonucleic Acid) extraction, cDNA (Complementary Deoxyribose Nucleic Acid) synthesis and PCR detection. Further standard curve making and expression quantity analysis results show that the high expression quantity of the Cla97C02G040900 gene is related to the seed germination rate and activity improvement. The invention provides an accurate and reliable molecular detection tool for watermelon seed vigor evaluation.

Description

Technical Field

[0001] The present invention relates to the technical field of seed vigor, and in particular to a watermelon seed vigor molecular marker and application thereof. Background Art

[0002] Watermelon (Citrullus lanatus) is an important economic crop worldwide, and its production benefits are directly affected by seed quality. Seed germination rate and vigor not only determine the growth potential of seedlings, but also affect the final yield and fruit quality. However, low seed vigor can lead to a series of agricultural problems, such as slow and uneven seed germination, low seedling emergence rate, poor seedling growth potential, and insufficient plant stress resistance. These problems not only increase sowing costs, but also lead to weakened field stress resistance and reduced yields, seriously affecting the economic benefits of farmers and the market competitiveness of agricultural enterprises. Therefore, the improvement of seed vigor and the research on effective evaluation methods have become technical issues that need to be urgently addressed in agricultural production. The limitations of existing seed vigor research and related technologies include:

[0003] Seed vigor is often influenced by genetic factors, environmental conditions, and storage conditions. During seed development, environmental conditions such as soil moisture, temperature, humidity, and light all affect germination performance. Furthermore, mechanical damage during harvesting, threshing, and storage, as well as poor storage conditions (such as high temperature and high humidity), can lead to a rapid decline in seed vigor. Despite this, existing seed vigor assessment methods mostly rely on traditional physical or chemical assays, such as germination rate tests and chromosome variation detection. These methods are often time-consuming and cannot accurately predict the actual physiological state of the seed. The rapid development of molecular biology techniques has provided new insights into seed vigor research. In recent years, seed vigor assessment techniques based on molecular markers have become a research hotspot. Molecular markers are specific genes whose expression changes significantly during seed germination and vigor changes. These genes can quickly and accurately reflect the vigor level of seeds under specific conditions. However, while research on molecular markers has progressed in other crops, research on molecular markers related to watermelon seed vigor is still in its early stages. At present, the molecular markers for watermelon seed vitality have not been fully identified, and there is a lack of a molecular tool that can effectively and quickly evaluate watermelon seed vitality, which limits the effective control of watermelon seed quality.

[0004] Furthermore, existing watermelon seed viability testing methods primarily rely on phenotypic characteristics of the seeds, such as germination rate and germination speed. While these methods can reflect the developmental status of the seeds to a certain extent, their results are often strongly influenced by external environmental conditions, making it difficult to accurately assess seed viability across batches. Furthermore, traditional germination testing processes are time-consuming and unsuitable for large-scale, efficient seed viability assessment.

[0005] Therefore, there is an urgent need for a molecular marker that can accurately, efficiently and quickly identify watermelon seed vitality and its corresponding watermelon seed vitality detection technology. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to provide a molecular marker for watermelon seed vitality to solve the defects of conventional methods in the existing technology that cannot accurately and quickly evaluate changes in seed vitality, and the problem that the detection of watermelon seed vitality takes a long time and is greatly affected by external conditions, and cannot accurately predict the changing trend of seed vitality.

[0007] In order to solve the above technical problems, the present invention provides a watermelon seed vitality molecular marker, the nucleotide sequences of the watermelon seed vitality molecular marker are Cla97C02G040900 and Cla97C06G125700, and their sequences are shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively. The Cla97C02G040900 is used to encode ATP-dependent DNA helicase, and the Cla97C06G125700 is used to encode expansin protein.

[0008] Compared with the prior art, the watermelon seed vitality molecular marker of the present invention has the following advantages: by detecting the watermelon seed vitality molecular marker of the present invention, the gene of the molecular marker is used to encode ATP-dependent DNA helicase, which functions to unwind DNA by hydrolyzing ATP to provide energy. These enzymes often rely on the presence of single strands and can recognize the single-stranded structure of replication forks, which is crucial for maintaining genome stability; the molecular markers Cla97C02G040900 and Cla97C06G125700 of the present invention can reflect the vitality status of watermelon seeds early, quickly and accurately during the aging process of watermelon seeds. Compared with traditional methods that can only evaluate vitality when the external characteristics of the seeds change significantly, the watermelon seed vitality molecular marker of the present invention can be detected by detecting its gene expression level, wherein the Cla97C02G040900 gene is used to encode ATP-dependent DNA helicase, which functions to unwind DNA by hydrolyzing ATP to provide energy. The Cla97C06G125700 gene encodes the expansin protein, a component of the cell wall that controls cell wall relaxation. This gene can detect signs of vigor decline in the early stages of seed aging with far greater sensitivity and accuracy than traditional physical and morphological assessment methods, which are susceptible to environmental influences (such as temperature and humidity), leading to inaccurate assessment results. The present invention, based on molecular-level detection of gene expression, provides more stable and reliable results that are less affected by environmental changes. Overall, the watermelon seed vigor molecular markers of the present invention address the technical challenges of untimely and inaccurate vigor detection in watermelon seeds in the prior art by introducing molecular markers and genetic detection methods. This avoids the time-consuming and low-sensitivity issues of traditional methods, effectively addressing the potential risk of vigor decline during seed storage and transportation, and helping researchers better manage seed quality and lifespan.

[0009] In one possible embodiment, the forward primer and reverse primer of the Cla97C02G040900 are shown as SEQ ID NO: 3 and SEQ ID NO: 4, respectively, and the forward primer and reverse primer of the Cla97C06G125700 are shown as SEQ ID NO: 5 and SEQ ID NO: 6, respectively;

[0010] Wherein, the nucleotide sequences of SEQ ID NO: 3 and SEQ ID NO: 4 are as follows:

[0011] Cla97C02G040900-F: GCAGCTGCATCAAAGCAAGA;

[0012] Cla97C02G040900-R: TGCAGGCAGCTGGTAACATA;

[0013] Wherein, the nucleotide sequences of SEQ ID NO:5 and SEQ ID NO:6 are as follows:

[0014] Cla97C06G125700-F: CTCACGCCACATTCTACGGT;

[0015] Cla97C06G125700-R:GTACTCAGAGCTGCCGTGTT.

[0016] Compared with the existing technology, the forward primer and reverse primer of the above technical solution can accurately amplify and detect the marker gene Cla97C02G040900 by designing the above-mentioned specific primers, further providing a solution for rapid and accurate evaluation of watermelon seed vitality at the molecular level.

[0017] Another technical problem to be solved by the present invention is to provide an application of the watermelon seed vitality molecular marker to solve the problem that conventional detection methods in the prior art cannot quickly and accurately evaluate seed vitality, and to provide an efficient and accurate vitality detection method based on molecular markers, which can detect signs of seed aging early and provide more scientific guidance for seed storage and cultivation.

[0018] The present invention also provides an application of the watermelon seed vigor molecular marker, wherein the application comprises identifying watermelon seed vigor by using the watermelon seed vigor molecular marker, and the application comprises the following steps:

[0019] S1: Collect watermelon seed samples and perform priming treatment to improve seed vigor;

[0020] S2: extracting RNA from the watermelon seed sample collected in step S1 to obtain total RNA;

[0021] S3: synthesizing cDNA from the total RNA obtained in step S2 by reverse transcription;

[0022] S4: Using the cDNA obtained in step S3, the expression levels of the Cla97C02G040900 gene and the Cla97C06G125700 gene are detected by real-time fluorescence quantitative PCR;

[0023] S5: Evaluate the aging status of watermelon seeds based on the expression levels of the Cla97C02G040900 gene and the Cla97C06G125700 gene obtained in step S4.

[0024] The present invention provides a molecular marker for watermelon seed vigor, offering the following advantages over existing technologies: The present invention replaces the conventional germination test method with a method based on the expression level of the vigor molecular marker Cla97C02G040900 gene, effectively improving detection accuracy and efficiency. While the conventional germination test is a widely used seed vigor detection method, it suffers from long detection cycles, significant environmental influences, and difficulty in achieving early detection. The present invention, however, directly assesses seed aging status by detecting molecular marker genes closely associated with seed vigor and utilizing real-time fluorescence quantitative PCR technology, enabling early diagnosis before obvious physical changes occur. The expression level of the Cla97C02G040900 gene is highly correlated with the aging status of watermelon seeds: its expression level significantly increases when seeds begin to age. Therefore, detecting the expression of this gene through real-time quantitative PCR can accurately reflect the vigor level of the seeds. The traditional germination rate test indirectly evaluates seed vigor by whether the seeds germinate. Often, the decline in vigor can only be detected after the seeds have lost their vigor. Molecular marker detection can identify vigor decline earlier. Based on the application of the present invention, the seed vigor status can be evaluated more quickly and accurately. Compared with traditional detection methods, real-time fluorescence quantitative PCR technology can not only complete the experiment in a short time (usually a few hours), but also provide quantitative results of seed vigor, which provides a more scientific and accurate basis for decisions such as seed storage, sales and planting. The application of the present invention provides a more accurate, efficient and quantitative seed vigor assessment method through molecular biological means, which fundamentally solves this technical problem. By monitoring gene expression levels, the present invention overcomes the shortcomings of traditional methods, such as reliance on the external environment and lack of early detection capabilities, and provides a new technical path for seed quality control. The various technologies and technical features of each step in the application of a watermelon seed vigor molecular marker in the present invention (such as the design of specific primers for the Cla97C02G040900 gene, RNA extraction and reverse transcription steps, and the application of qPCR technology) are interrelated and jointly achieve early, efficient, and accurate seed vigor assessment. After combining the steps, the application of the present invention has at least the following technical advances:

[0025] 1. High sensitivity: Through molecular marker detection, it can detect subtle changes in gene expression, ensuring early detection of seed vitality decline;

[0026] 2. Strong specificity: The specific primer design for the Cla97C02G040900 gene ensures the accuracy of the test results and avoids interference from nonspecific amplification;

[0027] 3. Quantitative analysis: qPCR can quantitatively analyze seed viability levels, rather than the simple dichotomy of germination or not as used in conventional methods in existing technologies;

[0028] 4. Early prediction capability: Compared with traditional germination rate detection methods, it can identify seed aging status earlier, helping to take measures in advance and avoid unnecessary losses.

[0029] In a possible embodiment, in step S1, the initiation treatment includes: soaking the watermelon seed sample in water to allow it to swell for more than 6 hours and draining the water; placing it in an initiation environment at 25-30°C and 60-70% humidity for more than 20 hours to enhance its vitality; after the initiation is completed, placing it at a temperature of 40-50°C to dry for more than 6 hours and collecting samples.

[0030] Compared to existing technologies, the above-mentioned technical solution significantly improves the accuracy and efficiency of watermelon seed viability testing. The aforementioned treatments, including water immersion, priming, and drying, effectively activate seed metabolic activity and promote cell recovery. Immersing for more than six hours allows seed cells to absorb sufficient water, initiating enzymatic reactions and activating metabolic pathways. Subsequently, the seeds are placed in a priming environment at 25-30°C and 60-70% humidity for more than 20 hours, further promoting respiration and physiological activity, thereby accelerating seed viability recovery. The drying process, in which the seeds are placed at 40-50°C for more than six hours, removes excess water, bringing the seeds to a moisture content suitable for RNA extraction while maintaining their viability. Finally, the imbibition and germination processes ensure sufficient sample volume for RNA extraction and subsequent genetic testing.

[0031] In a possible embodiment, step S2 includes: freezing the watermelon seed sample treated in step S1 with liquid nitrogen, grinding the seeds into powder with a crusher, and then extracting the RNA using the Tiangen RNAprep Pure Polysaccharide Polyphenol Plant Total RNA Kit method, determining the concentration, and storing the RNA at -80°C.

[0032] Compared with existing technologies, the above technical solution can obtain high-purity and highly stable total RNA samples, laying the foundation for subsequent real-time fluorescence quantitative PCR detection of the expression level of the Cla97C02G040900 gene. This high-quality RNA extraction method can ensure the accuracy and reproducibility of gene expression detection, avoiding the unstable detection results caused by low RNA purity or degradation problems in the existing technology. Specifically: In the above possible implementation method, the seed sample can be quickly frozen through liquid nitrogen freezing treatment to prevent RNA degradation in the seed cells, and the seeds are quickly ground into powder using a crusher to increase the surface area of the sample and facilitate efficient RNA extraction. Subsequently, the Tiangen RNAprep Pure Polysaccharide and Polyphenol Plant Total RNA Kit can be used to effectively remove the abundant polysaccharides and polyphenols in watermelon seeds. These substances often interfere with RNA extraction and purification in plant samples, resulting in reduced RNA quality. By using this kit, a high-purity total RNA sample can be obtained, avoiding common RNA degradation and contamination problems.

[0033] In one possible embodiment, step S3 includes: adding 2 μg of the RNA synthesized in step S2, configuring the reaction system to be 12-x μl RNase-free ddH2O, 4 μl 4×gDNA wiper mix, and x μl template RNA, mixing and reacting at 42°C for 2 minutes to remove genomic DNA; then adding 4 μl 5×HiScript llqRTSu perMixll, mixing and reacting at 50°C for 15 minutes, and then reacting at 85°C for 5 seconds. The product is used for subsequent fluorescent quantitative PCR reaction or stored at -20°C.

[0034] Compared with the existing technology, the above technical solution removes genomic DNA and efficiently reverse transcribes, so the cDNA obtained is of high quality and good template purity, ensuring the specificity and sensitivity of subsequent fluorescent quantitative PCR.

[0035] In a possible embodiment, in step S4, the operation of detecting the expression levels of the Cla97C02G040900 gene and the Cla97C06G125700 gene by the real-time fluorescence quantitative PCR method includes:

[0036] The fluorescent quantitative PCR reaction system is: 10 μl SYBR Mix, 4 μl ddH2O, 0.5 μl F Primer, 0.5 μl R Primer, 5 μl cDNA, and the cDNA is the product obtained by diluting 10 times the original template;

[0037] The fluorescence quantitative PCR reaction program was as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 10 s, annealing at 60°C for 30 s, 40 cycles, and the watermelon Actin gene ClACT was used as the internal reference gene for the reaction.

[0038] In a possible embodiment, the forward primer and reverse primer of the watermelon Actin gene ClACT are shown as SEQ ID N0:7 and SEQ ID N0:8, respectively, including: ClACT-F: CCATGTATGTTGCCATCCA G; ClACT-R: GGATAGCATGGGGTAGAGCA.

[0039] Compared with the existing technology, the real-time fluorescence quantitative PCR method using the above technical solution can quickly and sensitively detect the expression level of the Cla97C02G040900 gene, and correct the experimental errors between different samples through the internal reference gene ClACT, ensuring that the comparison between each sample is comparable and consistent. The reaction conditions after optimization of the PCR reaction system ensure that the target gene is specifically amplified in each cycle, and the fluorescence signal is stable and reliable; through the above detection method, the vitality state and aging degree of watermelon seeds can be accurately evaluated. Compared with the existing technology, the above possible implementation method improves the detection sensitivity and specificity in the quantitative detection of gene expression, reduces the interference of nonspecific amplification, and ensures the accuracy and repeatability of the results; at the same time, through the introduction of internal reference genes and the optimized PCR program, the detection accuracy and the stability of experimental data are further improved, making it more suitable for the detection and analysis of large-scale samples.

[0040] In one possible embodiment, after step S5 is completed, step S6 is further included: preparing a standard curve for the Cla97C02G040900 gene, which includes: extracting total RNA from the sample, obtaining a cDNA product by reverse transcription, amplifying the target gene fragment using a sequence containing a 5′-T7 promoter, performing in vitro transcription using T7 RNA polymerase to obtain positive chain mRNA, treating with DNase enzyme, measuring the concentration of the mRNA after purification, and performing continuous gradient dilution to obtain a series of samples with a 10-fold difference in concentration. The samples are used as templates for qRT-PCR amplification, and the Ct value of each standard concentration sample is plotted against the negative logarithm of the concentration of the target gene mRNA to draw a standard curve, the formula of which is: Ct = 0.9306x + 11.25.

[0041] In one possible embodiment, in step S6, when Ct≥31.47, that is, the expression level≤4.38*10 3 When the mRNA copy number is less than 3.62*10, the germination rate is not affected; when the expression level is Ct≤28.63, that is, the expression level is ≥3.62*10 4When the mRNA copy number increases, the germination rate increases, indicating an increase in vitality.

[0042] Compared with the existing technology, the above technical solution is adopted to prepare a standard curve, and the Ct value of real-time fluorescence quantitative PCR is linearly related to the negative logarithm of the target gene mRNA concentration. The standard curve can accurately convert the Ct value of the test sample into the specific copy number of the target gene mRNA; the above possible implementation method obtains a series of standard samples of known concentrations through in vitro transcription technology, ensuring the detection sensitivity and accuracy of the target gene. At the same time, the correlation between the Ct value and the seed germination rate further shows that the expression level of the target gene can effectively predict the germination rate and vitality status of the seed; through the introduction of the above standard curve, not only the accuracy of the qRT-PCR test results is improved, but also an objective numerical standard is established for the evaluation of seed vitality, which can accurately judge the germination status and vitality level of the seed; compared with the existing technology, it can better combine experimental data with actual seed performance, provide a reliable detection method for seed screening and germplasm improvement, and is suitable for the precise analysis and monitoring of large-scale samples. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 The relationship between the germination rate of the priming group and the control group over time is shown in the figure.

[0044] Figure 2 The graph is a comparison of the time required for the seeds of the priming group and the control group to reach 50% germination and the cumulative total amount of germination activity of watermelon seeds within 100 hours;

[0045] Figure 3 Schematic diagram of the relative expression of Cla97C02G040900 gene and the relative expression of Cla97C06G125700 gene;

[0046] Figure 4 Schematic diagram of the expression pattern of Cla97C02G040900 gene in different watermelon varieties;

[0047] Figure 5 This is the standard curve graph of the Cla97C02G040900 gene;

[0048] Figure 6 This is a comparison chart of the expression Cq values of the Cla97C02G040900 gene. DETAILED DESCRIPTION

[0049] First, those skilled in the art should understand that these embodiments are merely for explaining the technical principles of the embodiments of the present invention and are not intended to limit the scope of protection of the embodiments of the present invention. Those skilled in the art may make adjustments as needed to adapt to specific application scenarios.

[0050] The present invention provides a watermelon seed vigor molecular marker. The nucleotide sequences of the watermelon seed vigor molecular marker are Cla97C02G040900 and Cla97C06G125700, and the sequences are shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively. The Cla97C02G040900 is used to encode ATP-dependent DNA helicase, and the Cla97C06G125700 is used to encode expansin protein.

[0051] Likewise, other molecular markers designed through the genes involved in the present invention are also protected by this patent and are also within the scope of patent protection of the present invention.

[0052] As a preferred solution, the forward primer and reverse primer of the Cla97C02G040900 are shown as SEQ ID NO: 3 and SEQ ID NO: 4, respectively, and the forward primer and reverse primer of the Cla97C06G125700 are shown as SEQ ID NO: 5 and SEQ ID NO: 6, respectively;

[0053] Wherein, the nucleotide sequences of SEQ ID NO: 3 and SEQ ID NO: 4 are as follows:

[0054] Cla97C02G040900-F: GCAGCTGCATCAAAGCAAGA;

[0055] Cla97C02G040900-R: TGCAGGCAGCTGGTAACATA;

[0056] Wherein, the nucleotide sequences of SEQ ID NO:5 and SEQ ID NO:6 are as follows:

[0057] Cla97C06G125700-F: CTCACGCCACATTCTACGGT;

[0058] Cla97C06G125700-R:GTACTCAGAGCTGCCGTGTT.

[0059] The present invention also provides an application of the watermelon seed vigor molecular marker, wherein the application comprises identifying watermelon seed vigor by using the watermelon seed vigor molecular marker, and the application comprises the following steps:

[0060] S1: Collect watermelon seed samples and perform priming treatment to improve seed vigor;

[0061] S2: extracting RNA from the watermelon seed sample collected in step S1 to obtain total RNA;

[0062] S3: synthesizing cDNA from the total RNA obtained in step S2 by reverse transcription;

[0063] S4: Using the cDNA obtained in step S3, the expression levels of the Cla97C02G040900 gene and the Cla97C06G125700 gene are detected by real-time fluorescence quantitative PCR;

[0064] S5: Evaluate the aging status of watermelon seeds based on the expression levels of the Cla97C02G040900 gene and the Cla97C06G125700 gene obtained in step S4.

[0065] As a preferred solution, in step S1, the initiation treatment includes: soaking the watermelon seed sample in water to allow it to swell for more than 6 hours and draining the water; placing it in an initiation environment at 25-30°C and 60-70% humidity for more than 20 hours to enhance its vitality; after the initiation is completed, placing it at a temperature of 40-50°C to dry for more than 6 hours and collecting samples.

[0066] As a preferred solution, step S2 includes: freezing the watermelon seed sample treated in step S1 with liquid nitrogen, grinding the seeds into powder with a crusher, and then extracting its RNA using the Tiangen RNAprep Pure Polysaccharide Polyphenol Plant Total RNA Kit method, determining its concentration, and storing it at -80°C.

[0067] As a preferred solution, step S3 includes: adding 2 μg of the RNA synthesized in step S2, configuring the reaction system to be 12-x μl RNase-free ddH2O, 4 μl 4×gDNAwiper Mix, and x μl template RNA, mixing and reacting at 42°C for 2 minutes to remove genomic DNA; then adding 4 μl 5×HiScript llqRTSuperMi xll, mixing and reacting at 50°C for 15 minutes, and then reacting at 85°C for 5 seconds. The product is used for subsequent fluorescent quantitative PCR reaction or stored at -20°C.

[0068] As a preferred solution, in step S4, the operation of detecting the expression levels of the Cla97C02G040900 gene and the Cla97C06G125700 gene by the real-time fluorescence quantitative PCR method includes:

[0069] The fluorescent quantitative PCR reaction system is: 10 μl SYBR Mix, 4 μl ddH2O, 0.5 μl F Primer, 0.5 μl R Primer, 5 μl cDNA, and the cDNA is the product obtained by diluting 10 times the original template;

[0070] The fluorescence quantitative PCR reaction program was as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 10 s, annealing at 60°C for 30 s, 40 cycles, and the watermelon Actin gene ClACT was used as the internal reference gene for the reaction.

[0071] As a preferred solution, the forward primer and reverse primer of the watermelon Actin gene ClACT are shown as SEQ ID NO: 7 and SEQ ID NO: 8, respectively, including: ClACT-F: CCATGTATGTTGCCATCCAG; ClAC TR: GGATAGCATGGGGTAGAGCA.

[0072] As a preferred solution, after step S5, step S6 is further included: preparing a standard curve for the Cla97C02G040900 gene, which includes: extracting total RNA from the sample, obtaining a cDNA product by reverse transcription, amplifying the target gene fragment using a sequence containing a 5′-T7 promoter, performing in vitro transcription using T7 RNA polymerase to obtain positive chain mRNA, treating with DNase enzyme, measuring the mRNA concentration after purification, and performing continuous gradient dilution to obtain a series of samples with a 10-fold difference in concentration. The samples are used as templates for qRT-PCR amplification, and the Ct value of each standard concentration sample is plotted against the negative logarithm of the concentration of the target gene mRNA to draw a standard curve, the formula of which is: Ct = 0.9306x + 11.25.

[0073] As a preferred solution, in step S6, when Ct≥31.47, that is, the expression level≤4.38*10 3 When the mRNA copy number is less than 3.62*10, the germination rate is not affected; when the expression level is Ct≤28.63, that is, the expression level is ≥3.62*10 4 When the mRNA copy number increases, the germination rate increases, indicating an increase in vitality.

[0074] The following provides specific examples, combined with the examples and control groups, to further describe the above technical solutions of the present invention:

[0075] Example:

[0076] In the following examples, a comparison between a priming group and a control group is provided, wherein the priming group is an embodiment of the present invention, and is a test of watermelon seeds obtained after priming treatment in step S1 and its subsequent processing steps, while the control group is a test of watermelon seeds that have not been primed and its subsequent processing steps. In the corresponding figures of the specification, CK is the control group and Primed is the priming group.

[0077] This embodiment provides a method for efficiently detecting aging of watermelon seeds, comprising the following steps:

[0078] A molecular marker for identifying watermelon seed vitality comprises the following steps:

[0079] S1: Collecting high-vitality samples: First, soak watermelon seeds in water to absorb for 6 hours, drain the water, and place them in an induction environment at 25°C and 60-70% humidity for 20 hours to increase their vitality. After the induction, return them to dryness at 45°C for 6 hours before collecting samples;

[0080] S2: RNA extraction: Prepare the sample in advance, freeze the seeds that have been primed and activated in step S1 in liquid nitrogen for 5 minutes, grind the seeds into powder using a crusher, transfer the ground powder to a 2 ml centrifuge tube, and extract RNA using the Tiangen RNAprep Pure Polysaccharide and Polyphenol Plant Total RNA Kit. Measure the RNA concentration using Nanodrop, and store at -80°C.

[0081] S3: extracting total RNA from the high-vitality and control seed samples collected in step S2, synthesizing cDNA from the total RNA obtained in step S2 by reverse transcription; constructing a cDNA library, and sequencing the library using RNA sequencing to obtain a gene expression profile;

[0082] S4: Data analysis: Using the cDNA obtained in step S3, the expression level of the Cla97C02G040900 gene is detected by real-time fluorescence quantitative PCR; differential expression analysis is performed on the gene expression profile data obtained in step S3 to screen genes with significant expression changes during vitality enhancement;

[0083] cDNA synthesis involved a reaction system consisting of 12-μl RNase-free ddH2O, 4 μl 4×g DNA wiper mix, and x μl template RNA (total RNA added: 2 μg). Mix thoroughly by pipetting and incubate at 42°C for 2 min to remove genomic DNA. After the reaction, 4 μl 5× HiScript II qRT SuperMix II was added, gently flicked to mix, and incubated at 50°C for 15 min, followed by incubation at 85°C for 5 s. The product was then used for qPCR or stored at −20°C. The HiScript II Q RT SuperMix kit was purchased from Nanjing Novozymes Biotech Co., Ltd.

[0084] S4: Verify candidate genes: Perform qPCR detection on candidate genes to verify their expression changes in vitality improvement;

[0085] The steps of qPCR detection include:

[0086] Relative quantitative expression analysis of gene transcription markers: The fluorescence quantitative PCR reaction system consisted of 10 μl SYBR Mix, 4 μl ddH₂O, 0.5 μl F Primer, 0.5 μl R Primer, and 5 μl cDNA (a 10-fold dilution of the original template). The reaction procedure was 40 cycles of pre-denaturation at 95°C for 5 min, denaturation at 95°C for 10 s, and annealing at 60°C for 30 s. The watermelon Actin gene, ClACT, was used as the internal reference gene.

[0087] The forward primer and reverse primer of the watermelon Actin gene ClACT are respectively:

[0088] ClACT-F:CCATGTATGTTGCCATCCAG;

[0089] ClACT-R:GGATAGCATGGGGTAGAGCA.

[0090] S5 and S6: The expression levels of the Cla97C02G040900 gene and the Cla97C06G125700 gene obtained in step S4 are used to evaluate the aging status of watermelon seeds. A standard curve is prepared by amplifying the target gene fragment, obtaining the target gene mRNA using an in vitro transcription kit, using this as a template for gradient dilution, and amplifying by real-time qPCR to prepare a standard curve.

[0091] The detection process includes:

[0092] A Bio-Rad CFX96 fluorescence quantitative PCR instrument was used to monitor the changes in fluorescence signals. -ΔΔCt The expression changes of related genes were calculated using the formula. The results showed that the expression of the ATP-dependent DNA helicase Cla97C02G040900 gene showed a significant up-regulation trend after priming (P < 0.05). Similarly, the Cla97C06G125700 gene also showed a significant up-regulation trend like the Cla97C02G040900 gene. Figure 3 As shown, it can be seen that the relative expression level of the example after priming treatment is much higher than that of the control group.

[0093] Verification of Cla97C02G040900 gene expression in different varieties of watermelon seeds: Four different varieties of watermelon seeds were priming treated separately, such as Figure 4As shown in the data, using unprimed seeds as a control, RNA was extracted for qPCR detection to detect the expression of Cla97C02G040900 gene when vitality was improved. The results showed that in the four varieties of watermelon seeds, the expression of Cla97C02G040900 gene showed a significant upward trend after priming treatment (P < 0.05), indicating that the expression pattern of this gene in watermelon remains relatively consistent and has universal characteristics.

[0094] Compare the control group and the priming group. The preparation of the standard curve includes:

[0095] A Bio-Rad CFX96 fluorescence quantitative PCR instrument was used to monitor the changes in fluorescence signals. -ΔΔCt The expression changes of related genes were calculated using the formula. The results showed that the expression of ATP-dependent DNA helicase Cla97C02G040900 gene showed a significant up-regulation trend after priming treatment (P < 0.05) (e.g. Figure 5 shown).

[0096] Taking the transcriptional marker Cla97C02G040900 as an example, the detection and evaluation of the vigor of Meidu watermelon seeds: the relationship between the expression of transcriptional markers and seed germination rate, when Cq ≥ 31.47 (expression ≤ 4.38*10 3 mRNA copies (copies)), the germination rate was not affected; when the expression level was Cq≤28.63 (expression level ≥3.62*10 4 mRNA copy number), the germination rate increased, indicating a significant improvement in vitality, such as Figure 6 As shown, this further proves that the vitality of watermelon seeds is improved after the initiation treatment of the present invention.

[0097] The germination activity test of the primed watermelon seeds and the unprimed seeds was conducted, including:

[0098] Germination Vitality Test: The high-vigor seed samples and the control seed samples collected after the treatment in step S1 were imbibed in clean water for 8 hours, placed in a germination box, and subjected to a seed germination experiment in a constant temperature incubator, with the control seeds used as a comparative example;

[0099] Taking normal seeds without priming treatment as control, the germination experiment results showed that Figure 1 、 Figure 2 As shown in the results, compared with the control group, the maximum germination rate of the priming treatment was not significantly different from that of the control group, while the germination rate and seed germination uniformity were significantly increased (P < 0.05), which also proves that the priming treatment adopted in step S1 of the present invention can improve the germination rate and seed germination uniformity of watermelon seeds.

[0100] The comparative experiments of the above embodiments and the control group further prove that the vitality up-regulation indicator gene Cla97C02G040900 obtained by screening in the present invention is used to encode ATP-dependent DNA helicase, which acts to unwind DNA by hydrolyzing ATP to provide energy. They often rely on the presence of single strands and can recognize the single-stranded structure of replication forks, which is crucial for maintaining genome stability; and the application in the present invention evaluates the seed vitality intensity by detecting the expression level of the gene. This method is relatively simple to operate, inexpensive, and requires less labor. It can help us quickly detect seed vitality, which is of great significance for ensuring high-quality seeds out of the warehouse, and also provides a more convenient means for subsequent breeding, solving the technical problems existing in the prior art.

[0101] The scope of protection of the present invention is not limited to the Cla97C02G040900 sequence and the Cla97C06G125700 sequence, but covers all genes involved in the present invention and other molecular markers designed from homologous genes, which are also protected by this patent. The technical solution we described provides an innovative molecular marker for watermelon seed vigor, which can effectively solve the defects of the existing technology that cannot accurately and quickly evaluate changes in seed vigor, especially the problem that the detection process is often affected by external conditions; the above is only a specific embodiment of the present invention, but the scope of protection of the present invention is not limited to this. "Any technician familiar with this technical field can easily think of changes or substitutions within the technical scope disclosed by the present invention, which should be covered by the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be based on the scope of protection of the claims to ensure that all relevant technical innovations and variants can obtain appropriate legal protection.

[0102] The nucleotide sequences of the molecular markers Cla97C02G040900 and Cla97C06G125700, as well as other molecular markers designed from the genes involved in this invention, can quickly and accurately reflect the vigor of watermelon seeds during their aging process. Compared to the limitations of traditional methods, the gene expression-based detection method of the present invention offers greater sensitivity and accuracy. Furthermore, using real-time fluorescence quantitative PCR to detect the expression levels of these genes not only enables quantitative analysis of seed vigor levels but also effectively avoids the limitations of traditional methods that are often affected by environmental changes.

[0103] In summary, the present invention provides a new technical approach for the detection of watermelon seed vigor by introducing molecular markers with high specificity and sensitivity, ensuring the effective management and control of seed quality.

Claims

1. A molecular marker for watermelon seed vitality, characterized in that: The nucleotide sequences of the watermelon seed vitality molecular markers are Cla97C02G040900 and Cla97C06G125700, and their sequences are shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively. The Cla97C02G040900 is used to encode ATP-dependent DNA helicase, and the Cla97C06G125700 is used to encode expansin protein.

2. The watermelon seed vitality molecular marker according to claim 1, characterized in that: The forward primer and reverse primer of the Cla97C02G040900 are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively; the forward primer and reverse primer of the Cla97C06G125700 are shown in SEQ ID NO: 5 and SEQ ID NO: 6, respectively; Wherein, the nucleotide sequences of SEQ ID NO:3 and SEQ ID NO:4 are as follows: Cla97C02G040900-F: GCAGCTGCATCAAAGCAAGA; Cla97C02G040900-R: TGCAGGCAGCTGGTAACATA; Wherein, the nucleotide sequences of SEQ ID NO:5 and SEQ ID NO:6 are as follows: Cla97C06G125700-F: CTCACGCCACATTCTACGGT; Cla97C06G125700-R:GTACTCAGAGCTGCCGTGTT.

3. An application of the watermelon seed vitality molecular marker according to any one of claims 1 to 2, characterized in that: The application includes identifying the vitality of watermelon seeds by using the watermelon seed vitality molecular marker, which includes the following steps: S1: Collect watermelon seed samples and perform priming treatment to improve seed vigor; S2: extracting RNA from the watermelon seed sample collected in step S1 to obtain total RNA; S3: synthesizing cDNA by reverse transcription of the total RNA obtained in step S2; S4: using the cDNA obtained in step S3, detecting the expression levels of the Cla97C02G040900 gene and the Cla97C06G125700 gene by real-time fluorescence quantitative PCR method; S5: Evaluate the aging state of watermelon seeds by the expression levels of the Cla97C02G040900 gene and the Cla97C06G125700 gene obtained in step S4.

4. The use of the watermelon seed vitality molecular marker according to claim 3, characterized in that: In step S1, the initiation treatment includes: soaking the watermelon seed sample in water for more than 6 hours and draining the water; placing it in an initiation environment at 25-30°C and 60-70% humidity for more than 20 hours to enhance its vitality; after the initiation is completed, placing it at a temperature of 40-50°C for more than 6 hours to dry it and collect the sample.

5. The use of the watermelon seed vitality molecular marker according to claim 3, characterized in that: The step S2 comprises: freezing the watermelon seed sample processed in the step S1 with liquid nitrogen, grinding the seeds into powder with a crusher, and then extracting RNA with the Tiangen RNAprep Pure Polysaccharide Polyphenol Plant Total RNA Kit method, determining its concentration, and storing it at -80°C.

6. The use of the watermelon seed vitality molecular marker according to claim 3, characterized in that: The step S3 comprises: adding 2 μg of the RNA synthesized in the step S2, configuring the reaction system to be 12-x μl RNase free ddH2O, 4 μl 4×gDNA wiper Mix, and x μl template RNA, mixing and reacting at 42°C for 2 minutes to remove genomic DNA; then adding 4 μl 5×HiScript llqRTSuperMixll, mixing and reacting at 50°C for 15 minutes, and then reacting at 85°C for 5 seconds. The product is used for subsequent fluorescent quantitative PCR reaction or stored at -20°C.

7. The use of the watermelon seed vitality molecular marker according to claim 3, characterized in that: In step S4, the operation of detecting the expression levels of the Cla97C02G040900 gene and the Cla97C06G125700 gene by the real-time fluorescence quantitative PCR method includes: The fluorescence quantitative PCR reaction system is: 10 μl SYBR Mix, 4 μl ddH2O, 0.5 μl F Primer, 0.5 μl RPrimer, 5 μl cDNA, and the cDNA is the product obtained by diluting 10 times the original template; The fluorescence quantitative PCR reaction program was: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 10 s, annealing at 60°C for 30 s, 40 cycles, and the watermelon Actin gene ClACT was used as the internal reference gene for the reaction.

8. The use of the watermelon seed vitality molecular marker according to claim 7, characterized in that: The forward primer and reverse primer of the watermelon Actin gene ClACT are shown in SEQ ID NO: 7 and SEQ ID NO: 8, respectively, including: ClACT-F: CCATGTATGTTGCCATCCAG; ClACT-R: GGATAGCATGGGGTAGAGCA.

9. The use of the watermelon seed vitality molecular marker according to claim 7, characterized in that: After step S5 is completed, step S6 is also included: preparation of a Cla97C02G040900 gene standard curve, which includes: extracting total RNA from the sample, obtaining cDNA products by reverse transcription, amplifying the target gene fragment using a sequence containing a 5′-T7 promoter, performing in vitro transcription using T7 RNA polymerase to obtain positive chain mRNA, treating with DNase enzyme, determining the concentration of mRNA after purification, performing continuous gradient dilution to obtain a series of samples with a 10-fold difference in concentration, using the samples as templates for qRT-PCR amplification, and drawing a standard curve with the negative logarithm of the Ct value of each standard concentration sample relative to the concentration of the target gene mRNA, and the formula is: Ct=0.9306x+11.

25.

10. The use of the watermelon seed vitality molecular marker according to claim 9, characterized in that: In step S6, when Ct≥31.47, that is, the expression level≤4.38*10 3 When the mRNA copy number is Ct≤28.63, that is, the expression amount is ≥3.62*10 4 When the mRNA copy number increases, the germination rate increases, indicating an increase in vitality.

Images