Nucleic acid composition and reagent for detecting enterosporidium pichia and application of nucleic acid composition and reagent

Abstract

The invention relates to a nucleic acid composition and reagent for detecting enterosporidium pichia and application. The nucleic acid combination comprises an RPA (recombinase polymerase amplification) primer and crRNA (crRNA) The RPA primer comprises a primer pair of which the sequences are as shown in SEQ ID NO: 4 and SEQ ID NO: 5, and the crRNA comprises a crRNA of which the sequence is as shown in SEQ ID NO: 7. And the kit is high in sensitivity and good in specificity when being used for detecting the enterosporidia.

Description

Technical Field

[0001] The present application relates to the field of biotechnology, and in particular to a nucleic acid combination, reagent and application for detecting Enterosporidiosis. Background Art

[0002] Enterocyiozoon bieneusi is a new zoonotic intestinal protozoan that is transmitted through contaminated water and food. It can infect humans and a variety of animals, with diarrhea as the main clinical manifestation.

[0003] Among the nucleic acid detection methods for Enterosporidiosis, most of them use nested PCR after two rounds of amplification and then run on gel. The nested PCR method has high sensitivity and specificity, but the operation process is relatively cumbersome, takes about 4-5 hours, and is prone to contamination. This detection method takes a shorter time and can be completed within 1 hour. Summary of the invention

[0004] Based on this, an embodiment of the present application provides a nucleic acid combination, reagent and kit for detecting Enterosporidiosis with high sensitivity and good specificity;

[0005] One embodiment of the present application also provides a method for detecting Enterosporidiosis, which has high sensitivity and specificity, simple operation and short reaction time.

[0006] The technical solutions include the following:

[0007] A nucleic acid combination for detecting Enterobacteria bieneusi, the nucleic acid combination comprising RPA primers and crRNA; the RPA primers comprising a primer pair as shown in SEQ ID NO: 4 and SEQ ID NO: 5, and the crRNA comprising a crRNA as shown in SEQ ID NO: 7.

[0008] A reagent for detecting Enterosporidiosis, comprising the nucleic acid combination.

[0009] In one embodiment, the reagent further includes an RPA amplification reagent, and the RPA amplification reagent includes one or more of an RPA enzyme, a buffer and magnesium acetate.

[0010] In one embodiment, the reagent also includes a CRISPR / Cas12a detection reagent; the CRISPR / Cas12a detection reagent includes one or more of a Cas12a enzyme, a buffer, and a ssDNA fluorescent reporter probe.

[0011] Optionally, the Cas12a enzyme comprises LbCas12a.

[0012] The use of the nucleic acid combination or the reagent in preparing a kit for detecting Enterosporidium bieneusi.

[0013] A kit for detecting Enterosporidiosis includes the nucleic acid combination or the reagent.

[0014] The method for detecting Enterosporidiosis includes: using the kit to perform detection.

[0015] In one embodiment, the steps include:

[0016] Using the DNA of the sample to be tested as a template, performing RPA isothermal amplification using the RPA primers;

[0017] Using the obtained RPA amplification product as a template, adding the CRISPR / Cas12a detection reagent to perform a CRISPR reaction and detecting the fluorescent signal; and

[0018] Determine whether the sample to be tested contains Enterosporidiosis based on the test results.

[0019] Optionally, judging whether the sample to be tested contains Enterosporidiosis according to the test result includes:

[0020] When the fluorescence signal intensity of the sample to be tested is 4 times or more higher than that of the negative control, the sample contains Enterosporidae; and / or,

[0021] The fluorescence value of any one of the 1st to 5th cycles was selected as the starting fluorescence value, and the fluorescence value of any one of the 60th to 64th cycles was selected as the end fluorescence value. The ratio of the fluorescence value of the end point / starting point was calculated. When the ratio was greater than 4, it was determined to be a positive result.

[0022] In one embodiment, RPA isothermal amplification satisfies one or more of the following conditions:

[0023] (1) The reaction system of RPA isothermal amplification includes 25 μL~35 μL reaction buffer, 1 μL~3 μL of each 10 μM primer, RPA enzyme powder, 2 μL~6 μL DNA template and 2 μL~3 μL of 280 μmol / L magnesium acetate; and

[0024] (2) The reaction conditions of RPA isothermal amplification include a temperature of 37°C to 40°C and a time of 15 min to 30 min.

[0025] In one embodiment, the CRISPR reaction satisfies one or more of the following conditions:

[0026] (1) In the CRISPR reaction system, the concentrations of crRNA, Cas12a enzyme and ssDNA fluorescent reporter probe are 10nM~15nM, 0.2μM~1μM and 0.2μM~1μM respectively; and

[0027] (2) The conditions of the CRISPR reaction include a temperature of 36°C to 38°C and a reaction time of 10 min to 30 min.

[0028] Compared with the traditional technology, this application has the following beneficial effects:

[0029] The detection of Enterobacteria bieneusi using the nucleic acid combination of the present application has the advantages of high sensitivity and good specificity; the detection method of Enterobacteria bieneusi established based on the nucleic acid combination also has high sensitivity and high specificity, and the reaction time is short, and the test results can be obtained within 1 hour; in addition, compared with the real-time fluorescence PCR method, the reaction process can be completed in a constant temperature range of 37°C to 40°C, the requirements for the detection equipment are relatively low, and rapid detection can be achieved. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to more clearly illustrate the technical solutions in the embodiments of the present application and to more completely understand the present application and its beneficial effects, the following is a brief introduction to the drawings required for the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present application, and those skilled in the art can obtain other drawings based on these drawings without creative work.

[0031] Figure 1 Results of screening two candidate crRNAs using the CRISPR / Cas12a fluorescence method.

[0032] Figure 2 This is a comparison chart of the fluorescence values ​​of two crRNAs when CRISPR / Cas12a fluorescence method was used to detect the plasmid of Enterosporidae for 15 minutes.

[0033] Figure 3 This is a fluorescence graph of CRISPR / Cas12a fluorescence detection of plasmid samples with different dilutions containing E. bieneusi-crRNA02.

[0034] Figure 4 The figure is a comparison of the fluorescence values ​​of plasmid samples with different dilutions detected by CRISPR / Cas12a fluorescence method containing E. bieneusi-crRNA02 at 15 min.

[0035] Figure 5 The CRISPR / Cas12a fluorescence method containing E. bieneusi-crRNA02 showed no cross-reaction fluorescence when detecting other pathogens.

[0036] Figure 6 The figure is a comparison of the fluorescence values ​​of the CRISPR / Cas12a fluorescence method containing E. bieneusi-crRNA02 when detecting other pathogens at 15 min.

[0037] Figure 7 The figure is a comparison of the repeatability results of CRISPR / Cas12a fluorescence detection of E. bieneusi-crRNA02 containing different concentrations of plasmid at 15 minutes.

[0038] Figure 8 The fluorescence detection results of the primers of comparative example 1 and embodiment 1 at 15 min are compared.

[0039] Fig. 9 This is a graph showing the results of the target of Enterosporidae that could not be effectively detected by the F1 / R1 primer pair within 15 minutes after the start of the reaction. DETAILED DESCRIPTION

[0040] In order to make the above-mentioned purposes, features and advantages of the present application more obvious and easy to understand, the specific implementation methods of the present application are described in detail below. In the following description, many specific details are set forth to facilitate a full understanding of the present application. However, the present application can be implemented in many other ways different from those described herein, and those skilled in the art can make similar improvements without violating the connotation of the present application, so the present application is not limited by the specific embodiments disclosed below.

[0041] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art to which this application belongs. The terms used herein in the specification of this application are only for the purpose of describing specific embodiments and are not intended to limit this application.

[0042] As used herein, the term "and / or" includes any and all combinations of one or more of the associated listed items.

[0043] In this article, unless otherwise specified, "one or more" means any one of the listed items or any combination of the listed items. Similarly, "one or more" and the like, when used in other ways to mean "one or more", are also understood in the same way unless otherwise specified.

[0044] In this article, "optionally", "optional", and "optional" mean optional, that is, any one of the two parallel solutions of "yes" or "no". If there are multiple "optional" in a technical solution, unless otherwise specified and there is no contradiction or mutual restriction, each "optional" is independent. Unless otherwise specified, the descriptions of "optionally include", "optionally include", etc. in this application, taking "optionally include" as an example, mean "may include or not include".

[0045] Herein, when it comes to a numerical interval (i.e., a numerical range), unless otherwise specified, the distribution of the optional numerical values ​​in the numerical interval is considered to be continuous, and includes the two numerical endpoints (i.e., the minimum and maximum values) of the numerical interval, and each numerical value between the two numerical endpoints. Unless otherwise specified, when the numerical interval only refers to the integers in the numerical interval, including the two endpoint integers of the numerical range, and each integer between the two endpoints, is equivalent to directly listing each integer. When multiple numerical ranges are provided to describe features or characteristics, these numerical ranges can be merged. In other words, unless otherwise specified, the numerical ranges disclosed herein should be understood to include any and all sub-ranges included therein. The "numerical value" in the numerical interval can be any quantitative value, such as a number, a percentage, a ratio, etc. "Numerical interval" allows broadly including numerical interval types such as percentage intervals, ratio intervals, and ratio intervals.

[0046] One embodiment of the present application provides a nucleic acid combination for detecting Enterobacteria bieneusi, which includes RPA primers and crRNA; wherein the RPA primers include a primer pair with sequences as shown in SEQ ID NO: 4 and SEQ ID NO: 5, and the crRNA includes a crRNA with a sequence as shown in SEQ ID NO: 6 or SEQ ID NO: 7.

[0047] One embodiment of the present application also provides a reagent for detecting Enterosporidiosis, which comprises the above-mentioned nucleic acid combination.

[0048] In a specific example, the reagent also includes an RPA amplification reagent, and the RPA amplification reagent includes one or more of an RPA enzyme, a buffer, and magnesium acetate.

[0049] In a specific example, the reagent also includes a CRISPR / Cas12a detection reagent; the CRISPR / Cas12a detection reagent includes one or more of a Cas12a enzyme, a buffer, and a ssDNA fluorescent reporter probe.

[0050] In a specific example, the Cas12a enzyme includes but is not limited to LbCas12a, AsCas12a, FnCas12a, HkCas12a, OsCas12a, TsCas12a, BbCas12a or BoCas12a.

[0051] CRISPR family enzymes include Cas9, Cas12, Cas13, etc. Among them, Cas12 protein not only has the function of nucleic acid cutting after recognizing the target area, but also has the ability to non-specifically cut all single-stranded DNA molecules in the system after activation.

[0052] One embodiment of the present application also provides the use of the nucleic acid combination or the reagent in preparing a kit for detecting Enterosporidiosis.

[0053] One embodiment of the present application also provides a kit for detecting Enterosporidiosis, which includes the nucleic acid combination or the reagent.

[0054] This kit is a detection kit for Enterobacteria pygione based on RPA-CRISPR / Cas12a. It amplifies the conserved sequence of the Enterobacteria pygione genome through recombinase-mediated strand displacement nucleic acid amplification (RPA), and then detects the amplified product using CRISPR-Cas12a technology. The basic principle is as follows: at room temperature, the recombinase first binds to the primer to form a complex, and then the complex finds a sequence complementary to the primer on the double-stranded DNA and promotes strand displacement. At this time, the single-strand binding protein will quickly bind to the unwound single-stranded DNA to prevent it from re-pairing. At the same time, the strand displacement DNA polymerase synthesizes a new DNA chain from the primer and displaces the original DNA chain, thereby realizing a continuous amplification process. Through this synergistic effect, the three proteins enable the target DNA to be rapidly amplified under conditions without thermal cycling. Further based on the specific DNA cleavage activity and non-specific single-stranded DNA cleavage activity of the Cas12a protein, a CRISPR RNA (crRNA) is designed to guide Cas12a to recognize and bind to the target DNA. If the target DNA is present, Cas12a will be activated, start cutting the target DNA and simultaneously start its non-specific single-stranded DNA enzyme activity. This non-specific cutting can degrade the fluorescent reporter probe added to the reaction mixture, resulting in the release of fluorescent signals, thereby indicating the presence of the target DNA.

[0055] The above-mentioned nucleic acid combination, reagent and kit are used to detect Enterosporidiosis with high specificity and high sensitivity, and the detection result is accurate, avoiding false positives and false negatives.

[0056] One embodiment of the present application also provides a method for detecting Enterosporidiosis, which includes: using the kit for detection. The method is simple to operate, has a short reaction time, can produce a test result within 1 hour, has low requirements for detection equipment, can achieve rapid on-site detection, and has high detection sensitivity and good specificity.

[0057] In a specific example, the following steps are included:

[0058] Using the DNA of the sample to be tested as a template, RPA isothermal amplification is performed using RPA primers;

[0059] Using the obtained RPA amplification product as a template, adding CRISPR / Cas12a detection reagent to perform CRISPR reaction and detecting the fluorescent signal; and

[0060] Determine whether the sample to be tested contains Enterosporidiosis based on the test results.

[0061] In a specific example, the sample to be detected includes one or more of water and food. It is understandable that in other examples, the sample to be detected can also be a sample in other environments.

[0062] In a specific example, the reaction system of RPA isothermal amplification, based on a reaction system with a volume of 50 μL, includes 25 μL~35 μL reaction buffer, 1 μL~3 μL of each 10 μM primer, RPA enzyme powder, 2 μL~6 μL DNA template, and 2 μL~3 μL of 280 μmol / L magnesium acetate, and the remainder is deionized water. In a specific example, in the reaction system of RPA isothermal amplification, based on a reaction system with a volume of 50 μL, the volume of the reaction buffer is 25 μL, 26 μL, 27 μL, 28 μL, 29 μL, 30 μL, or 35 μL. In a specific example, in the reaction system of RPA isothermal amplification, based on a reaction system with a volume of 50 μL, the volume of the 10 μM primer is 1 μL, 1.5 μL, 2 μL, 2.5 μL, or 3 μL. In a specific example, in the reaction system of RPA isothermal amplification, the volume of the DNA template is 2 μL, 3 μL, 4 μL, 5 μL or 6 μL based on the reaction system volume of 50 μL. In a specific example, in the reaction system of RPA isothermal amplification, the volume of 280 μmol / L magnesium acetate is 2 μL, 2.5 μL or 3 μL based on the reaction system volume of 50 μL.

[0063] In a specific example, the reaction conditions of RPA isothermal amplification include a temperature of 37°C to 40°C and a time of 15min to 30min. In a specific example, the temperature of the RPA isothermal amplification reaction is 37°C, 38°C, 39°C, 40°C, or a range between any two of the above values. In a specific example, the time of the RPA isothermal amplification reaction is 15min, 16min, 17min, 18min, 19min, 20min, 22min, 25min, 28min, 30min, or a range between any two of the above values.

[0064] In a specific example, in the CRISPR reaction system, the concentration of crRNA is 10nM to 15nM. In a specific example, the concentration of crRNA is 10nM, 11nM, 12nM, 12.5nM, 13nM, 14nM, 15nM, or a range between any two of the above values.

[0065] In a specific example, in the CRISPR reaction system, the concentration of the Cas12a enzyme is 0.2 μM ~ 1 μM. In a specific example, the concentration of the Cas12a enzyme is 0.2 μM, 0.3 μM, 0.4 μM, 0.5 μM, 0.6 μM, 0.7 μM, 0.8 μM, 0.9 μM, 1 μM, or a range between any two of the above values.

[0066] In a specific example, in the CRISPR reaction system, the concentration of the ssDNA fluorescent reporter probe is 0.2 μM to 1 μM. In a specific example, the concentration of the ssDNA fluorescent reporter probe is 0.2 μM, 0.3 μM, 0.4 μM, 0.5 μM, 0.6 μM, 0.7 μM, 0.8 μM, 0.9 μM, 1 μM, or a range between any two of the above values.

[0067] In a specific example, the conditions of the CRISPR reaction include a temperature of 36°C to 38°C and a time of 10 min to 30 min. In a specific example, the temperature of the CRISPR reaction is 36°C, 36.5°C, 37°C, 37.5°C, 38°C, or a range between any two of the above values. In a specific example, the time of the CRISPR reaction is 10 min, 12 min, 15 min, 18 min, 20 min, 25 min, 30 min, or a range between any two of the above values.

[0068] Specifically, the nucleic acid DNA in the sample to be tested is extracted, and the target is amplified by RPA using a primer set consisting of single-stranded DNA molecules represented by E. bieneusi-RPA-F (GCGAACGGCTCAGTAATGTTGCGGTAATTT) and E. bieneusi-RPA-R (TGATTTCCCGTTACCCGTCATGGCCTTGGT) to obtain an RPA amplification product.

[0069] Two different crRNA sequences were synthesized for the E. bieneusi target nucleic acid sequence, and the Lbcas12a trans-cleavage reaction experiment was used for crRNA screening. The crRNA with short reaction time and large fluorescence signal value (UAAUUUCUACUAAGUGUAGAUCACUACCAACAAGCUGAUAG) was selected as the fixed component in the trans-cleavage reaction system.

[0070] Take 1 μL of RPA amplification product and add it to the LbCas12a trans-cleavage reaction system, which includes: LbCas12a protein, corresponding crRNA sequence, single-stranded ssDNA-FQ fluorescent reporter probe and 10×NEBuffer 3.1 reaction buffer. At the same time, the RPA amplification product without RNA target is used as a negative control. The mixed CRISPR-Cas12a detection reaction system is placed in a fluorescent quantitative PCR instrument and reacted at 37 °C for 15 minutes. The fluorescence intensity of the fluorescence curve is used to determine whether the sample to be tested contains Enterobacteria pygionema.

[0071] In a specific example, the result determination method includes satisfying at least one of the following conditions:

[0072] ① Within the same testing time, if the fluorescence intensity of the sample to be tested is 4 times or more higher than that of the negative control, the sample contains Enterosporidiosis, otherwise it does not contain it.

[0073] ② Select any fluorescence value in the 1st to 5th cycles as the starting point, and any fluorescence value in the 60th to 64th cycles as the end point, and calculate the fluorescence ratio of the end point / starting point. If the ratio is greater than 4, it is determined to be a positive result.

[0074] The embodiments of the present application will be described in detail below in conjunction with examples. It should be understood that these examples are only used to illustrate the present application and are not intended to limit the scope of the present application. The experimental methods for which specific conditions are not specified in the following examples are preferably referred to the guidance provided in the present application, and can also be based on the experimental manual or normal conditions in this area, can also be based on the conditions recommended by the manufacturer, or refer to experimental methods known in the art.

[0075] In the following specific embodiments, the measured parameters of raw material components may have slight deviations within the range of weighing accuracy unless otherwise specified. For temperature and time parameters, acceptable deviations caused by instrument test accuracy or operation accuracy are allowed.

[0076] The reagents and their sources involved in the following examples are as follows:

[0077] Fast Pure Plasmid Mini Kit (Vazyme, DC201-01), ampicillin (BioFROX, 1146GR005), Phanta Super-Fidelity DNA Polymerase (Vazyme, P501-d3-AA), 2×Phanta Max Buffer (Vazyme, P515-d3-AB), dNTP Mix (Vazyme, P515-d3-AC), agarose (Biomed, SH441-01), DNA loading buffer (Vazyme, P515-d3-AD), Gel Red nucleic acid dye (APExBIO, A8746), universal DNA purification and recovery kit (TIANGEN, DP214-03), RPA nucleic acid amplification reagent (TwistAmp @ Basic, TABAS03KIT), 10×NEBuffer3.1 (NEB, B7203S).

[0078] Single-stranded ssDNA-FQ fluorescent reporter probe: the sequence is 5'(6)-FAM-CCCCCCCC-3'-BHQ1, synthesized by Sangon Biotech (Shanghai) Co., Ltd. LbCas12a (Tolu Biotech);

[0079] The other parasites were Encephalitozoon hellem (GeneBank ID: L39108.1), Encephalitozoon intestinalis (GeneBank ID: L3911.1), and Encephalitozoon cuniculi (GeneBank ID: KF169729.1). The plasmids were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0080] Example 1

[0081] Nucleic acid detection kit and method for Enterosporidiosis based on CRISPR-Cas12a system.

[0082] 1. Preparation of DNA of Enterosporidium pyogenes

[0083] 1. Plasmid sequence

[0084] The nucleic acid sequence of Enterosporidae was searched in the Genebank database, and the 18S rRNA region was selected as the target sequence fragment of Enterosporidae (GeneBank: KF148056.1) and inserted into the pUC57 vector to construct a recombinant plasmid, which was synthesized by Sangon Biotech (Shanghai) Co., Ltd.;

[0085] The target nucleic acid sequence of Enterosporidae (SEQ ID NO: 1) is as follows:

[0086] CGGTGGAACGGCGAACGGCTCAGTAATGTTGCGGTAATTTGGTCTCTGTGTGTAAAACTAACCACGGTAACCTGTGGCTAAAAGCGGAGAATAAGGCGCAACCCTATCAGCTTGTTGGTAGTG TAAAGGACTACCAAGGCCATGACGGGTAACGGGAAATCAGGGTTTGATTCCGGAGAGGGAGCCTGAGAGATGGCTCCCACGTCCAAGGACGGCAGCAGGCGCGAAACTTGTCCACTCCTTACG GGGGAGACAGTCATGAGACGTGAGTATAAGACCTGAGTGTAAAGACCTTAGGGTGAAGCAATTGGAGGGCAAGCTTTGGTGCCAGCAGCCGCGGTAACTCCAACTCCAAGAGTGTCTATGGTG GATGCTGCAGTTAAAGGGTCCGTAGTCGTGAATGCAATTAAATGTCGTTGTTCAATAGCGATGAGTTTGCTAATGTTTGCGGAACGGATAGGGAGTGTAGTATAGACTGGCGAAGAATGAAA.

[0087] 2. Plasmid extraction

[0088] Take 5 μL of the glycerol bacteria containing the target plasmid obtained from the above company and spread it on the ampicillin-resistant plate, pick the monoclonal colony on the plate and inoculate it into 5 mL of LB culture medium containing ampicillin resistance, and culture it overnight at 37 ℃ and 220 rpm. The next day, divide the overnight culture into 2 mL centrifuge tubes, centrifuge at 13000 rpm for 2 minutes, discard the supernatant, and then turn the centrifuge tube upside down on absorbent paper to absorb the residual liquid. Next, add 250 μL of Buffer P1 containing RNase A to the centrifuge tube with bacterial sediment, mix it thoroughly with a pipette or vortex oscillator, add 250 μL of Buffer P2, and gently mix it upside down 10-15 times to fully lyse the bacteria. This step should be completed within 5 minutes. Then, add 350 μL Buffer P3 and mix gently by inverting up and down 10-15 times until a white flocculent precipitate appears, followed by centrifugation at 13,000 rpm for 10 minutes.

[0089] After centrifugation, place the FastPure DNA Mini Columns adsorption column in a 2 mL collection tube, carefully transfer the supernatant after centrifugation to the adsorption column, be careful not to aspirate the precipitate, centrifuge at 13000 rpm for 1 minute, pour out the waste liquid in the collection tube, and put the adsorption column back into the collection tube. Then add 500 μL of Buffer PW1 to the adsorption column, centrifuge at 13000 rpm for 1 minute, discard the waste liquid, and put the adsorption column back into the collection tube again. Then add 600 μL of Buffer PW2 diluted with anhydrous ethanol to the adsorption column, centrifuge at 13000 rpm for 1 minute, discard the waste liquid, and repeat this step once. Then put the adsorption column back into the collection tube and centrifuge at 13000 rpm for 5 minutes to dry the adsorption column. Finally, place the adsorption column in a new sterile 1.5 mL centrifuge tube, add 100 μL of sterile water to the center of the adsorption column membrane, let it stand at room temperature for 2 minutes, centrifuge at 13,000 rpm for 1 minute, use a UV spectrophotometer to measure the plasmid concentration, and store the obtained target plasmid pUC57-E. bieneusi at -20 °C.

[0090] 3. PCR Amplification

[0091] The above-mentioned plasmid pUC57-E. bieneusi was used as the target, and PCR-F (SEQ ID NO: 2: TGTAAAACGACGGCCAGT) and PCR-R (SEQ ID NO: 3: CAGGAAACAGCTATGACC) were used as the primer set for PCR amplification experiments. The PCR experimental reaction procedure was as follows: pre-denaturation at 95 °C for 3 min; denaturation at 95 °C for 20 s, annealing at 57 °C for 25 s, and extension at 72 °C for 30 s, for a total of 32 cycles; extension at 72 °C for another 2 min, and storage of the PCR product at 4 °C (as shown in Table 1).

[0092] Table 1 shows the PCR amplification system used to prepare the target nucleic acid sequence of Enterosporidae.

[0093]

[0094] 4. PCR product gel recovery

[0095] After 50 μL of PCR product in each tube was mixed with 5 μL of 10× DNA loading buffer, agarose gel electrophoresis was performed. Prepare 1.5% agarose gel containing Gel Red nucleic acid dye, add the sample to be tested into the gel reaction well, and perform electrophoresis at 120 V voltage and 150 mA current for 30 minutes. After observing the electrophoresis band, the target nucleic acid band was cut and recovered. Next, the adsorption column CB2 was placed in the collection tube, 500 μL of balance solution BL was added, and centrifuged at 12000 rpm for 1 minute, and the waste liquid in the collection tube was discarded. Then, an equal volume of PC solution was added to the gel block (for example, 100 μL PC solution was added to 0.1 g of gel block), and the centrifuge tube was placed in a 55 ℃ water bath for about 10 minutes. During this process, the centrifuge tube was gently turned upside down until the gel block was completely dissolved.

[0096] The dissolved mixed liquid was added to the pre-treated adsorption column CB2, allowed to stand at room temperature for 2 minutes, and then centrifuged at 12000 rpm for 1 minute, and the waste liquid in the collection tube was discarded. Next, 600 μL of rinsing solution PW was added to the adsorption column CB2, centrifuged again at 12000 rpm for 1 minute, the waste liquid was discarded, and this step was repeated once. Subsequently, the adsorption column was placed in the collection tube, centrifuged at 13000 rpm for 5 minutes, and the adsorption column was dried. Finally, the adsorption column CB2 was moved to a new 1.5 mL centrifuge tube, 60 μL of sterilized water was added to the center of the column membrane, allowed to stand at room temperature for 2 minutes, and then centrifuged at 13000 rpm for 1 minute. The nucleic acid concentration was determined by UV spectrophotometer, and the recovered nucleic acid sample was stored at 4 °C.

[0097] 2. RPA amplification of Enterosporidium pyogenes nucleic acid target reaction

[0098] 1. Synthesis of RPA Primers

[0099] According to the target nucleic acid sequence of Enterosporidiosis (GeneBank: KF148056.1) and the RPA primer design principles, the RPA primer set sequence constructed and sent to Sangon Biotech (Shanghai) Co., Ltd. for synthesis is as follows:

[0100] E. bieneusi-RPA-F (GCGAACGGCTCAGTAATGTTGCGGTAATTT) (SEQ ID NO: 4);

[0101] E. bieneusi-RPA-R (TGATTTCCCGTTACCCGTCATGGCCTTGGT) (SEQ ID NO: 5).

[0102] 2. Preparation of RPA reaction system

[0103] The recovered Enterobacteria pygii samples were used as target templates for isothermal amplification and added to the RPA amplification reaction system (specific composition is shown in Table 2). First, 47.5 μL of the mixed solution was added to the centrifuge tube containing the lyophilized powder to ensure that the lyophilized powder was fully and evenly dissolved. Subsequently, 2.5 μL of Buffer B solution (i.e., magnesium acetate solution) was added to each centrifuge tube, and the tube cap was closed and centrifuged instantly and mixed evenly. The centrifuge tube was placed at 37 °C for reaction for 30 minutes. After the reaction was completed, the RPA amplification product was obtained and stored at 4 °C for subsequent experiments. As a negative control, in the RPA amplification reaction system listed in Table 2, the DNA sample was replaced with sterilized water, and the other components remained unchanged.

[0104] Table 2 shows the RPA amplification reaction system

[0105]

[0106] (III) CRISPR-LbCas12a trans-cleavage detection reaction

[0107] 1. Synthesis of crRNA Sequences

[0108] According to the selected target nucleic acid sequence of Enterobacteria bieneusi, two different crRNAs were designed, wherein positions 1-19 are anchor sequences binding to LbCas12a, and positions 20-42 are guide sequences targeting the target sequence of Enterobacteria bieneusi. The specific sequences are as follows:

[0109] bieneusi-crRNA01 (SEQ ID NO: 6): UAAUUUCUACUAAGUGUAGAUGUCUCUGUGUGUAAACUAAC;

[0110] E. bieneusi-crRNA02 (SEQ ID NO: 7):UAAUUUCUACUAAGUGUAGAUCACUACCAACAAGCUGAUAG.

[0111] 2. Preparation of LbCas12a trans-cleavage system

[0112] Take 1 μL of the RPA product after isothermal amplification and add it to the LbCas12a trans-cleavage system shown in Table 3, and add two different crRNAs to it respectively to screen out the crRNA with the shortest reaction time, the strongest fluorescence signal and the best sensitivity. In this process, sterile water was used instead of the RPA amplification product of the nucleic acid target as a negative control. After all components were mixed evenly, the reaction tube was placed in a real-time fluorescence quantitative PCR instrument, the excitation wavelength of the FAM channel was set to 490 nm, the emission wavelength was set to 520 nm, and the fluorescence signal was collected every 15 seconds. The reaction was carried out at 37 ° C for 90 minutes, during which the changes in the fluorescence signal intensity in the system were continuously monitored to determine the optimal crRNA conditions.

[0113] Table 3 LbCas12a trans-cleavage system

[0114]

[0115] 3. Determination of fluorescence curve results

[0116] 1) When the detection time is 15 minutes, if the fluorescence intensity value of the experimental group is more than 4 times higher than that of the negative control, it is judged as a positive result, that is, the sample to be tested contains Enterosporidae; otherwise, it is a negative result, that is, the sample to be tested does not contain Enterosporidae.

[0117] 2) Select the fluorescence value of the first cycle as the starting fluorescence value and the fluorescence value of the 60th cycle as the end fluorescence value, and calculate the end / start fluorescence ratio. If it is greater than 4, it is considered a positive result.

[0118] If any of the above two conditions is met, it can be judged as a positive result.

[0119] The experimental results are as follows Figure 1 As shown in the figure, the fluorescence curve of the reaction group containing E. bieneusi-crRNA02 has a faster peak speed and a shorter reaction time, showing a higher sensitivity. Figure 2As shown, when the same concentration of the target nucleic acid of Enterobacteria bieneusi was used for detection, the fluorescence value detected by E. bieneusi-crRNA02 within 15 minutes was higher. Therefore, based on the experimental results, E. bieneusi-crRNA02 was determined to be the preferred crRNA for the method of the present application.

[0120] Example 2

[0121] The target DNA template of Enterobacteria bieneusi obtained in Example 1 was diluted in a gradient manner to obtain a DNA solution containing nucleic acid fragments of different concentrations, and E. bieneusi-crRNA02 was used as the selected crRNA in the trans-cleavage system to detect the sensitivity of the method of the present application. The specific steps are as follows:

[0122] ① The DNA template obtained in Example 1 (I) was diluted with sterile water to obtain DNA solutions containing nucleic acid fragments at different concentrations, with the concentrations being 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 copies / μL.

[0123] ② Perform RPA amplification according to step (ii) in Example 1 to obtain an RPA amplification product;

[0124] ③ Take 1 μL of the above RPA amplification product and perform Lbcas12a trans-cleavage reaction according to step (iii) in Example 1. At the same time, set the amplification product with sterile water as the template as a negative control, and the crRNA is E. bieneusi-crRNA02.

[0125] ④According to the experimental results Figure 3 As shown in the figure, when E. bieneusi-crRNA02 was used to detect the template of Enterobacteriaceae in the CRISPR / Cas12a detection system, it had a significant difference compared with the negative control group. Figure 4 As shown, the target of Enterobacteriaceae at a concentration of 1 copies / μL can be effectively detected within 15 minutes after the start of the reaction, and the sensitivity can reach single copy (1 copies / μL).

[0126] Example 3

[0127] Specific detection of Enterosporidiosis based on the CRISPR-Cas12a system.

[0128] ① Using genomic DNA of Encephalitozoon hellem (GeneBank ID: L39108.1), Encephalitozoon intestinalis (GeneBank ID: L3911.1), and Encephalitozoon cuniculi (GeneBank ID: KF169729.1) as detection templates, RPA amplification was performed according to step (ii) of Example 1 to obtain RPA amplification products of different parasites.

[0129] ② Take 1 μL of the RPA amplification products of the above different parasites and add them to the LbCas12a trans-cleavage system. Perform the LbCas12a trans-cleavage reaction according to step (iii) in Example 1. At the same time, set the amplification product with sterilized water instead of the template as a negative control, and the crRNA is E. bieneusi-crRNA02.

[0130] ③According to the experimental results Figure 5 As shown, the fluorescence signal of the experimental group containing the target nucleic acid of Enterobacteria pygionema increases rapidly after the reaction starts, while the fluorescence intensity of the negative control group and the experimental groups containing other parasite nucleic acids hardly increases over time. Figure 6 As shown in the figure, 15 minutes after the start of the reaction, the fluorescence intensity value of the experimental group containing the target nucleic acid of Enterosporidae was significantly higher than that of the negative control and other parasite experimental groups. This shows that the detection method of the present application has high specificity and there is no cross reaction during the detection process.

[0131] Example 4

[0132] Reproducible detection of Enterosporidiosis based on the CRISPR-Cas12a system.

[0133] ① 10 1 copies / μL, 10 5 The DNA of Enterosporidium pygii at a concentration of copies / μL was used as a detection template, and RPA amplification was performed according to step (ii) in Example 1, and each concentration was repeated 10 times;

[0134] ② Take 1 μL of the RPA amplification product of the above-mentioned different concentrations of Enterobacteria bieneusi and add it to the LbCas12a trans-cleavage system, and perform the LbCas12a trans-cleavage reaction according to step (iii) in Example 1. At the same time, set the amplification product with RNase-free nWater instead of the template as a negative control, and the crRNA is E. bieneusi-crRNA02.

[0135] ③According to the experimental results Figure 7 As shown in the figure, 15 min after the start of the reaction, the fluorescence values ​​of the 10 repeated experiments of the two different concentrations of the target nucleic acid of Enterobacteria pygii were relatively concentrated. 1 The fluorescence signal intensity of the experimental group with 0.1 copies / μL was significantly higher than that of the negative control group, which further verified the high sensitivity and accuracy of the method of the present application.

[0136] Comparative Example 1

[0137] The target DNA template of Enterosporidium pyogenes obtained in Example 1 was diluted to 10 2 copies / μL, using F1 (CGGTGGAACGGCGAACGGCTCAGTAATGTT, SEQ ID NO: 8) / R1 (TGATTTCCCGTTACCCGTCATGGCCTTGGT, SEQ ID NO: 9), F2 / R2 (same as the E. bieneusi-RPA-F / R sequence in Example 1) as primers, and using E. bieneusi-crRNA02 as the selected crRNA in the trans-cleavage system. The specific steps are as follows:

[0138] ① Dilute the DNA template obtained in Example 1 (I) with sterile water, 10 2 copies / μL.

[0139] ② Perform RPA amplification according to step (ii) in Example 1, using primers F1 / R1 and F2 / R2 to obtain an RPA amplification product;

[0140] ③ Take 1 μL of the above RPA amplification product and perform Lbcas12a trans-cleavage reaction according to step (iii) in Example 1. At the same time, set the amplification product with sterile water as the template as a negative control, and the crRNA is E. bieneusi-crRNA02.

[0141] ④According to the experimental results Figure 8As shown, when using E. bieneusi-crRNA02 to detect the template of Enterobacteria bieneusi in the CRISPR-Cas12a detection system, the RPA primer pair F2 / R2 was significantly different from the RPA primer pair F1 / R1. Fig. 9 As shown, the F1 / R1 primer pair could not effectively detect the target of Enterosporidae within 15 minutes of the start of the reaction.

[0142] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0143] The above-mentioned embodiments only express several implementation methods of the present application, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for a person of ordinary skill in the art, several variations and improvements can be made without departing from the concept of the present application, and these all belong to the protection scope of the present application. Therefore, the protection scope of the patent of the present application shall be subject to the attached claims, and the description may be used to interpret the content of the claims.

Claims

1. A nucleic acid combination for detecting Enterosporidiosis, characterized in that: The nucleic acid combination includes RPA primers and crRNA; The RPA primers include a primer pair whose sequences are shown in SEQ ID NO: 4 and SEQ ID NO: 5, and the crRNA includes a crRNA whose sequence is shown in SEQ ID NO:

7.

2. A reagent for detecting Enterosporidiosis, characterized in that: The reagent comprises the nucleic acid combination according to claim 1.

3. The reagent according to claim 2, characterized in that The reagents also include an RPA amplification reagent, which includes one or more of an RPA enzyme, a buffer and magnesium acetate.

4. The reagent according to claim 2 or 3, characterized in that The reagent also includes a CRISPR / Cas12a detection reagent; the CRISPR / Cas12a detection reagent includes one or more of a Cas12a enzyme, a buffer, and a ssDNA fluorescent reporter probe; Optionally, the Cas12a enzyme comprises LbCas12a.

5. Use of the nucleic acid combination according to claim 1 or the reagent according to any one of claims 2 to 4 in preparing a kit for detecting Enterosporidium bieneusi.

6. A kit for detecting Enterosporidiosis, characterized in that: The method comprises the nucleic acid combination according to claim 1 or the reagent according to any one of claims 2 to 4.

7. A method for detecting Enterosporidiosis, characterized in that: include: The detection is performed using the kit described in claim 6.

8. The detection method according to claim 7, characterized in that: The steps include: Using the DNA of the sample to be tested as a template, performing RPA isothermal amplification using the RPA primers; Using the obtained RPA amplification product as a template, adding the CRISPR / Cas12a detection reagent to perform CRISPR reaction and detecting the fluorescence signal; as well as Determine whether the sample to be tested contains Enterosporidiosis according to the test results; Optionally, judging whether the sample to be tested contains Enterosporidiosis according to the test result includes: When the fluorescence signal intensity of the sample to be tested is 4 times or more higher than that of the negative control, the sample contains Enterosporidae; and / or, The fluorescence value of any one of the 1st to 5th cycles was selected as the starting fluorescence value, and the fluorescence value of any one of the 60th to 64th cycles was selected as the end fluorescence value. The ratio of the fluorescence value of the end point / starting point was calculated. When the ratio was greater than 4, it was determined to be a positive result.

9. The detection method according to claim 8, characterized in that: RPA isothermal amplification meets one or more of the following conditions: (1) The reaction system of RPA isothermal amplification includes 25 μL~35 μL reaction buffer, 1 μL~3 μL of each 10 μM primer, RPA enzyme powder, 2 μL~6 μL of DNA template, and 2 μL~3 μL of 280 μmol / L magnesium acetate; and (2) The reaction conditions of RPA isothermal amplification include a temperature of 37°C to 40°C and a time of 15 min to 30 min.

10. The detection method according to claim 8 or 9, characterized in that: The CRISPR reaction meets one or more of the following conditions: (1) In the CRISPR reaction system, the concentrations of crRNA, Cas12a enzyme and ssDNA fluorescent reporter probe are 10nM~15nM, 0.2μM~1μM and 0.2μM~1μM respectively; and (2) The conditions of the CRISPR reaction include a temperature of 36°C to 38°C and a reaction time of 10 min to 30 min.

Images