Aconitic acid isomerase TarA and application thereof

Abstract

The invention belongs to the technical field of biology, and particularly relates to aconitic acid isomerase TarA and application thereof. The amino acid sequence of the aconitic acid isomerase TarA is as shown in SEQ ID NO.1, the aconitic acid isomerase TarA has high catalytic activity and catalytic efficiency when mediating mutual transformation between trans-aconitic acid (TAA) and cis-aconitic acid (CAA), tends to synthesize TAA, can be used for microorganism and enzyme catalysis biosynthesis of TAA, can promote microorganisms to maintain growth and reproduction by using a TAA carbon source, and has good application prospects. In addition, the TarA protein is expressed in hosts such as plants and microorganisms, so that the content of TAA in host cells can be increased, and the nematode resistance and nematode killing activity of host organisms can be enhanced.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, in particular to aconitate isomerase TarA and applications thereof. Background Art

[0002] Aconitic acid (C6H6O6), also known as propylene-1,2,3-tricarboxylic acid, was first discovered in the plant Aconitum napellus. It is a low molecular weight unsaturated tricarboxylic acid. In nature, due to the structural difference that the double bond cannot rotate freely, cis-trans isomerism occurs. Its two isomers are cis-aconitic acid (CAA) and trans-aconitic acid (TAA). In the body, CAA is an intermediate product of citric acid isomerization to isocitrate under the action of aconitase, and plays an important role in cellular energy metabolism. TAA can be produced by plants and microorganisms. The mutual conversion between CAA and TAA mainly consists of two forms: enzyme-catalyzed conversion mediated by aconitate isomerase (AI) and self-conversion without enzyme catalysis.

[0003] TAA has good application prospects in many fields based on its unique chemical properties. TAA has long been used as an industrial chemical such as antioxidants and lubricants in industry, and because it contains unsaturated double bonds and abundant carboxyl groups, it can be used as a monomer compound or synthetic precursor of polymer materials. It has broad development space in the chemical field such as synthetic bio-based plasticizers such as trans-tributyl aconitate (TBA), and is expected to gradually replace traditional phthalate plasticizers, and help the high-quality, green and low-carbon development of packaging, construction, chemical and other industries. In addition, because TAA has a certain inhibitory effect on aconitase, a key enzyme in the tricarboxylic acid cycle (TCA), it can interfere with the tricarboxylic acid cycle and affect life activities. Therefore, it shows good application potential in the field of biological pesticides such as nematode control, inhibition of Leishmania growth and refusal to feed brown planthoppers; compared with traditional spraying pesticides, it is more environmentally friendly and can better avoid the problem of pathogenic microorganisms gradually developing resistance to pesticides.

[0004] At present, the production process of trans-aconitic acid includes plant extraction, chemical synthesis and microbial fermentation. The traditional plant extraction and chemical synthesis technology routes have problems such as complex production process, many by-products, high cost and low yield, which greatly restricts the development and application of trans-aconitic acid. Microbial fermentation is a new way to prepare trans-aconitic acid, which has the advantages of green environmental protection and low cost. Its principle is: knock out the aconitate decarboxylase gene in microbial cells such as Aspergillus terreus, block the biosynthesis of CAA to itaconic acid, and then accumulate CAA in large quantities in the cell. Then, in order to reduce the consumption of CAA entering the TCA cycle, CAA is converted into TAA by efficiently expressing aconitate isomerase, and a cell factory with high yield of TAA is obtained, realizing the microbial synthesis and green biomanufacturing of trans-aconitic acid. However, there is currently little research on aconitate isomerase. The aconitate isomerase gene TbrA was only cloned in Bacillus thuringiensis in recent years. The available biological resources for the efficient synthesis of TAA are still relatively scarce. Therefore, exploring new genetic resources related to TAA synthesis is of great significance for the biosynthesis of TAA. Summary of the invention

[0005] In view of the above-mentioned technical problems in the prior art, the present invention provides an aconitate isomerase TarA and its encoding gene. TarA has high catalytic activity and catalytic efficiency when mediating the mutual conversion between trans-aconitate (TAA) and cis-aconitate (CAA), and tends to synthesize TAA, which can be used for the microbial and enzyme-catalyzed biosynthesis of TAA, and it can promote microorganisms to use TAA carbon sources to maintain their growth and reproduction, and improve the soil colonization ability and stress resistance survival ability of microorganisms. In addition, by expressing TarA protein in hosts such as plants and microorganisms, it is beneficial to increase the intracellular TAA content of the host, which is beneficial to enhancing the host organism's ability to resist nematodes and nematicidal activity. Therefore, the present invention further provides the application of aconitate isomerase TarA and its encoding gene in the aforementioned fields. The present invention is specifically implemented through the following scheme:

[0006] The first aspect of the present invention provides an aconitate isomerase TarA, whose amino acid sequence is shown in SEQ ID NO.1.

[0007] The second aspect of the present invention provides a coding gene, wherein the gene encodes the aconitate isomerase TarA as described above.

[0008] Furthermore, the nucleotide sequence of the gene is shown in SEQ ID NO.2.

[0009] The third aspect of the present invention provides the use of the aconitate isomerase TarA or its encoding gene as described above in the biosynthesis of trans-aconitate.

[0010] Furthermore, the biosynthesis of trans-aconitate comprises the following steps: adding cis-aconitate and the aconitate isomerase TarA described above to a buffer solution, and reacting at pH 6.5-10.0. Furthermore, reacting at pH 6.5.

[0011] Further, the buffer comprises 10-50 mM Mg 2+ and 10-200 mM NaCl. Further, the buffer comprises 20 mM Mg 2+ and 10 mM NaCl.

[0012] The fourth aspect of the present invention provides the use of the aconitate isomerase TarA or its encoding gene as described above in promoting the soil colonization ability of microorganisms.

[0013] Furthermore, the microorganism is a bacterium; furthermore, it is Bacillus velezensis.

[0014] The fifth aspect of the present invention provides the use of the aconitate isomerase TarA or its encoding gene as described above in biological control of nematodes.

[0015] The advantages and positive effects of the present invention are:

[0016] 1. The aconitate isomerase TarA provided by the present invention has high catalytic activity and catalytic efficiency when mediating the mutual conversion between trans-aconitate (TAA) and cis-aconitate (CAA), and tends to synthesize TAA, and can be used in the field of microbial and enzyme-catalyzed biosynthesis of TAA. It has the advantages of mild reaction conditions and a wide range of adaptability to temperature and pH, and provides a feasible biochemical synthesis pathway for efficient, green, environmentally friendly, and large-scale production of TAA, and has good application value.

[0017] 2. The aconitate isomerase TarA provided by the present invention can promote microorganisms to utilize TAA carbon source to maintain their growth and reproduction. By expressing the protein in heterologous microorganisms, it is beneficial to enhance their ability to synthesize, accumulate and assimilate TAA, thereby improving the soil colonization ability and stress resistance survival ability of microorganisms, providing a new idea for the development of more efficient and stable probiotic fertilizers.

[0018] 3. TAA has good nematicidal activity. By expressing the aconitate isomerase TarA of the present invention in plants, microorganisms, etc., it is beneficial to increase the TAA content in the host cell, enhance the host organism's ability to resist nematodes and nematicidal activity, and has certain application potential in the field of biological control of nematodes. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings used in describing the embodiments.

[0020] Figure 1 This is the SDS-PAGE gel electrophoresis diagram of the TarA protein purified in Example 1 of the present invention;

[0021] Figure 2 The relative enzyme activity curve of aconitate isomerase TarA at different pH values ​​in Example 2 of the present invention;

[0022] Figure 3 The relative enzyme activity bar graph of aconitate isomerase TarA under different metal ions in Example 2 of the present invention;

[0023] Figure 4 This is a relative enzyme activity curve of aconitate isomerase TarA at different magnesium ion concentrations in Example 2 of the present invention;

[0024] Figure 5 The relative enzyme activity curve of aconitate isomerase TarA under different NaCl concentrations in Example 2 of the present invention;

[0025] Figure 6 The enzymatic kinetic fitting curves of aconitate isomerase TarA under different substrates in Example 2 of the present invention, where the substrates from left to right are cis-aconitate and trans-aconitate;

[0026] Figure 7 Graphs showing the colonization ability of the wild strain FZB42 and mutant strain ΔtarA of Bacillus velezensis in the separate colonization experiment of Example 3 of the present invention, wherein graphs AB are growth curves in soil environments without TAA and with TAA carbon source, respectively;

[0027] Figure 8 These are colonization ability test graphs of the wild strain FZB42 and mutant strain ΔtarA of Bacillus velezensis in the mixed colonization experiment of Example 3 of the present invention, wherein Figures AB are growth curves in soil environments with and without TAA carbon sources, respectively, and Figure C is the ratio of the biomass of the wild strain FZB42 and the mutant strain ΔtarA. DETAILED DESCRIPTION

[0028] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments. The embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0029] Based on the information contained in the present invention, it is easy for those skilled in the art to make various changes to the precise description of the present invention without departing from the spirit and scope of the appended claims. It should be understood that the scope of the present invention is not limited to the defined processes, properties or components, because these embodiments and other descriptions are only for the purpose of illustrating specific aspects of the present invention. In fact, various changes that a person skilled in the art or related fields can obviously make to the embodiments of the present invention are covered within the scope of the appended claims.

[0030] In order to better understand the present invention but not to limit the scope of the present invention, all the numbers and other numerical values ​​used in the present invention to express the amount, percentage, etc. should be understood as modified by the word "approximately" in all cases. The term "approximately" has its usual meaning, which is used to indicate that a value includes the inherent variation of the error of the device or method used to determine the value, or contains a value close to the value, such as within 10% of the value (or range of values). Therefore, unless otherwise specified, the numerical parameters listed in the specification and the attached claims are approximate values, which may be changed according to the different ideal properties attempted to be obtained.

[0031] In addition, it should be noted that the meanings of the terms "include", "comprises", "contains", "has" and the like are non-restrictive, that is, other steps and other components that do not affect the results may be added. The term "and / or" should be regarded as a specific disclosure of each of the two specified features or components with or without the other. For example, "A and / or B" will be regarded as including the following situations: (i) A, (ii) B, and (iii) A and B.

[0032] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, specific embodiments of the present invention are described in detail below with reference to the accompanying drawings.

[0033] Trans-aconitic acid (TAA) is a small molecule widely distributed in nature and has multiple biological activities. Plants and microorganisms also produce and accumulate this cellular metabolite. However, there are few TAA synthesis-related genes reported at home and abroad. The first aconitate isomerase gene (TbrA) was discovered in Bacillus thuringiensis in recent years. Its encoded protein can mediate the catalytic isomerization of cis-aconitate to trans-aconitate, and has been applied to the biosynthesis technology of TAA. However, the enzyme has problems such as low activity and poor reaction efficiency.

[0034] The present invention takes Bacillus velez FZB42, which can efficiently assimilate and utilize trans-aconitic acid (TAA), as the research object. A gene encoding aconitate isomerase is isolated from its genome, named tarA (TAA assimilation-related gene A), and its encoded protein is named TarA. The tarA gene from Bacillus velez was heterologously expressed in Escherichia coli and the TarA protein was obtained by affinity purification. The enzymatic properties of the TarA protein were then investigated to explore the effects of pH, ionic strength, etc. on the enzyme activity of the enzyme catalyzed reaction, and its kinetic parameters were determined; the results showed that the optimal pH of the TarA protein was related to Mg. 2+ The ionic strength and NaCl concentration were pH 6.5, 20 mM and 10 mM, respectively. Under the optimal conditions, the enzymatic kinetic parameter of the isomerization forward reaction to generate TAA with CAA as substrate was K m =27.08mM, v max =32.2μM / s, k cat =79.03s -1 and k cat / K m =2.92s -1 mM -1 , while the enzymatic reaction kinetic parameter K of the isomerization reverse reaction of CAA with TAA as substrate is m =171.45mM, v max =48.2μM / s, k cat =59.17s -1 and k cat / K m =0.345s -1 mM -1 The above results confirm that the aconitate isomerase TarA of the present invention can show high activity under mild physical and chemical conditions and is more inclined to synthesize TAA, which provides a preliminary reference for understanding the process of bacterial assimilation of TAA from the perspective of protein function, and also provides a theoretical basis for the application of aconitate isomerase in the biosynthesis of TAA.

[0035] Trans-aconitic acid (TAA) is a widely existing plant carbon source that can be used by microorganisms, and its metabolic pathway plays an important role in the colonization of probiotics. The present invention found in the study that Bacillus velez FZB42 can use TAA as the sole carbon source to maintain its growth and reproduction. Therefore, the present invention further explored the effect of the tarA gene on the growth of Bacillus velez in soil habitats at the molecular level. By comparing the ability of wild strain FZB42 and tarA gene deletion mutant strain ΔtarA to colonize alone and in mixed colonization in soil containing TAA and without TAA, it was found that whether it was colonized alone or in mixed colonization, when there was no TAA carbon source, there was no significant difference in the growth of FZB42 strain and ΔtarA strain; on the contrary, when there was a TAA carbon source, FZB42 strain had a more significant growth advantage than ΔtarA strain, and the maximum biomass of the two differed by 4.5 times. The present invention confirms that the presence of the tarA gene can endow bacteria with the ecological function of obtaining more energy and enhancing growth competitive advantage in a TAA carbon source environment, providing technical support for improving the soil colonization ability of probiotics and developing more efficient biofertilizers.

[0036] Based on this, one embodiment of the present invention provides an aconitate isomerase TarA, and the amino acid sequence of the aconitate isomerase TarA is shown in SEQ ID NO.1.

[0037] Another embodiment of the present invention provides a coding gene, wherein the gene encodes the aconitate isomerase TarA as described above.

[0038] Specifically, the nucleotide sequence of the gene is shown in SEQ ID NO.2.

[0039] The aconitate isomerase TarA provided by the present invention has high catalytic activity and catalytic efficiency. Compared with the aconitate isomerase TbrA of Bacillus thuringiensis that has been isolated and identified, the maximum enzymatic reaction rate of the conversion of CAA to TAA mediated by TarA of the present invention is v max , catalytic constant k cat and catalytic efficiency k cat / K m The results show that the aconitate isomerase TarA of the present invention is significantly improved, and has the advantages of higher enzyme catalytic efficiency and better catalytic activity, and has good application advantages in the field of TAA biosynthesis. Specifically, the aconitate isomerase TarA encoding gene of the present invention can be expressed in a heterologous microorganism, and the conversion of CAA to TAA can be promoted by microbial fermentation to enhance the accumulation of TAA in cells, or the aconitate isomerase TarA of the present invention can be directly used to synthesize TAA by enzyme catalysis in vitro. The present invention provides a feasible biochemical synthesis pathway for efficient, green, environmentally friendly, and large-scale production of trans-aconitate, and has good application value.

[0040] Therefore, another embodiment of the present invention provides the use of the aconitate isomerase TarA or its encoding gene as described above in the biosynthesis of trans-aconitate.

[0041] In a preferred embodiment, the biosynthesis of trans-aconitate comprises the following steps: adding cis-aconitate and the aconitate isomerase TarA described above to a buffer, and reacting at pH 6.5-10.0, preferably at pH 6.5.

[0042] The enzymatic reaction of aconitate isomerase TarA can be carried out at room temperature, which varies according to the ambient temperature in seasons and is not particularly limited in the present invention. Generally, TarA protein has good enzymatic activity within 20-40°C, preferably 25-37°C.

[0043] Preferably, the buffer comprises 10-50 mM Mg 2+ and 10-200 mM NaCl. The aforementioned metal ions have a promoting effect on enzyme activity, and the salt solution containing metal ions can be chloride, sulfate, nitrate or acetate. More preferably, the buffer includes 20 mM Mg 2+ and 10 mM NaCl.

[0044] As is well known, the stronger the ability of microorganisms to utilize carbon sources in the environment, the more conducive to the colonization of microorganisms in the natural environment. The present invention analyzes the influence of aconitate isomerase TarA encoding gene tarA on the colonization of Bacillus Velez using TAA carbon source in nature, and the results show that the presence of tarA gene is conducive to its obtaining more energy by assimilation of TAA, which plays a very important role in occupying soil niche for Bacillus Velez. Therefore, the aconitate isomerase TarA of the present invention or its encoding gene can be applied to other strains by means of genetic engineering, and by expressing the TarA protein of the present invention in probiotics, it is conducive to enhancing its ability to synthesize, accumulate and assimilate TAA, thereby improving the soil colonization ability and stress resistance survival ability of probiotics, and providing a new idea for the development of more efficient and stable probiotic fertilizers.

[0045] Therefore, another embodiment of the present invention provides the use of the aconitate isomerase TarA or its encoding gene as described above in promoting the soil colonization ability of microorganisms.

[0046] Optionally, the microorganism or probiotic mentioned above is preferably a bacterium, such as Bacillus Velezii.

[0047] Existing studies have shown that TAA has good nematicidal activity, and the endogenous TAA content of plants is proportional to the resistance of plants to nematodes. By expressing the aconitate isomerase of the present invention in plants, microorganisms, etc., increasing their intracellular TAA content, it is beneficial to enhance the aforementioned host organisms' ability to resist nematodes and nematicidal activity, and has certain application potential in the field of biological control of nematodes.

[0048] Therefore, the embodiments of the present invention also provide the use of the aconitate isomerase TarA or its encoding gene as described above in biological control of nematodes. Specifically, the aconitate isomerase TarA enhances the nematicidal ability of organisms by promoting the accumulation of TAA in biological cells.

[0049] The present invention is further described below in conjunction with specific examples. The experimental methods in the following examples where specific conditions are not specified are usually carried out under conventional conditions, such as the conditions described in the Molecular Cloning Laboratory Guide (Fourth Edition) published by Cold Spring Harbor Laboratory, or the conditions recommended by the manufacturer.

[0050] Main reagents: Molecular biology enzyme reagents were purchased from Takara Biotechnology Co., Ltd. TAA standards were purchased from TCI (Shanghai). CAA standards were purchased from Sigma-Aldrich. Bacterial genomic DNA extraction kit (spin column type) was purchased from Tiangen Biochemical Technology Co., Ltd. DNA gel excision recovery kit, plasmid mini-extraction kit and PCR clean up kit were purchased from Beijing Biotech Biotechnology Co., Ltd. Protein concentration determination kit was purchased from Nanjing Jiancheng Bioengineering Institute.

[0051] Main culture media: (1) LB medium: NaCl 10g / L, yeast extract 5g / L and peptone 10g / L, pH 7.0-7.5; (2) ACO medium: 7.5g / L TAA, 2g / L (NH4)2SO4, 1g / L K2HPO4, 0.5g / L MgSO4 and 0.1g / L FeCl3·6H2O, pH 7.0. (3) SPI Medium includes: 0.19% (NH4)2SO4, 1.36% K2HPO4·3H2O, 0.58% KH2PO4, 0.10% Trisodium citrate dihydrate, 202μL 5% MgSO4·7H2O, 202μL 50% glucose and 202μL 1% CAYE. (4) SPII Medium includes: 19.60 mL SPI, 200 μL 50 mM CaCl2 and 200 μL 250 mM MgCl2, with the final concentration of CaCl2 in the medium being 0.5 mM and the final concentration of MgCl2 being 2.5 mM. The above percentages are weight-to-volume ratios (w / v) unless otherwise specified. 1.6%-1.8% agar powder is added to the solid medium.

[0052] Example 1 Expression and purification of TarA protein

[0053] The amino acid sequence of the TarA protein and the nucleotide sequence of the tarA gene are shown in Table 1.

[0054] Table 1 TarA protein and tarA gene sequence information of the present invention

[0055]

[0056] 1.1. Construction of TarA protein expression vector pET32a-TarA and host bacterial transformation

[0057] The genomic DNA was extracted from Bacillus velezensis (B. velezensis) FZB42 using a bacterial genomic DNA extraction kit. The FZB42 genome (see NCBI accession number NC_009725.2 for the genome sequence) was used as a template, and tarA-F and tarA-R primer pairs were used for PCR amplification to obtain the target gene expressing TarA protein. NcoI and XhoI restriction sites were introduced at both ends of the gene. The nucleotide sequences of tarA-F and tarA-R are shown below:

[0058] tarA-F: TGCACCATGGAAAAAGTTCCTGTAACCG (see SEQ ID NO.3);

[0059] tarA-R: GCCTCGAGACCAATGTGATTCAGCGTATT (see SEQ ID NO. 4).

[0060] The PCR configuration system is: 1 μL DNA template, 2 μL upstream primer, 2 μL downstream primer, 1 μL high-fidelity PCR polymerase, 20 μL 5× buffer, 2 μL dNTP, and ddH2O to 100 μL. PCR program: 94°C pre-denaturation for 5 min, 94°C denaturation for 30 s, 50°C annealing for 40 s, 72°C extension for 1 min, and 30 cycles. The PCR product was subjected to agarose gel electrophoresis, and the target fragment of TarA protein heterologous expression was recovered by gel cutting.

[0061] The target fragment and the pET32a vector were then treated with NcoI and XhoI double enzyme digestion, and after the double enzyme digestion, the double enzyme digestion product was recovered using a quick agarose gel DNA recovery kit, and then the recovered product was detected by electrophoresis. The digestion products were then connected using T4 DNA ligase, and the connection product was named pET32a-TarA.

[0062] The ligation product pET32a-TarA was transformed into Escherichia coli Rostta (DE3) by heat shock transformation, cultured at 37°C, 200 rpm for 1 h, and then centrifuged at 6000 rpm for 1 min. 100 μL of the supernatant was taken and the resuspended bacteria were spread on an LB solid plate containing chloramphenicol (34 μg / mL) and ampicillin (100 μg / mL), and cultured overnight at 37°C. The transformants were verified by colony PCR, and the positive transformants verified by colony PCR were sent to Beijing Qingke Xinye Biotechnology Co., Ltd. for gene sequencing to check whether mutations occurred, and the TarA recombinant expression strain without mutations and correctly expressing TarA protein was selected.

[0063] 1.2. TarA protein induced expression

[0064] The TarA recombinant expression strain was inoculated into LB medium and cultured overnight at 37°C and 200 rpm for activation. The activated bacterial solution was transferred to new LB medium and cultured at 37°C and 200 rpm until OD 600= 0.8, add isopropyl-β-d-thiogalactoside (IPTG) with a final concentration of 0.2mM, and induce culture at 16°C, 200rpm for 20h. The induced bacterial solution was centrifuged at 4°C, 12000rpm for 5min to collect the bacteria, and then 30mL Binding Buffer (including 20mM Tris-HCl, 0.5M NaCl and 5mM imidazole, pH 8.0) was added to resuspend the bacteria, and the cells were broken by ultrasound (breaking time was 30min, working 1s, and stopping 1.5s), and then centrifuged at 4°C, 12000rpm for 10min to obtain the supernatant after breaking, which was used for the subsequent TarA protein purification experiment.

[0065] 1.3. TarA protein affinity purification

[0066] Ni-NTA affinity purification was used. The Ni column was washed with deionized H2O (to remove ethanol), and 10× column volumes of Charge Buffer (50mM NiSO4) and 10× column volumes of deionized H2O were added for charging and washing respectively. Finally, 10× column volumes of Binding Buffer (20mM Tris-HCl, 0.5M NaCl, 5mM imidazole, pH 8.0) were added to balance the Ni column. The above supernatant was added to the Ni column and incubated for 5-10 minutes to allow the target protein to bind to the Ni column. 2+ After sufficient binding, wash with 20× column volume Wash Buffer (20 mM Tris-HCl, 0.5 M NaCl, 60 mM imidazole, pH 8.0) until no impurity protein is detected, then add Elution Buffer (20 mM Tris-HCl, 0.5 M NaCl, 500 mM imidazole, pH 8.0) for elution, and collect the eluate to obtain TarA protein.

[0067] The TarA protein eluate was placed in a dialysis bag and dialyzed in 1L protein dialysis solution (20mM Tris-HCl, 10% (w / v) glycerol, 1mM EDTA, 0.1mM DTT) in an ice bath for 2 times, 3 hours each time. After the dialysis is completed, the protein was divided into 1.5mL centrifuge tubes and stored at -80℃.

[0068] The TarA protein purified by Ni column was analyzed by SDS-PAGE gel electrophoresis. Figure 1 As shown in FIG. 1 , lane M represents protein marker, and lane TarA represents purified TarA protein. 2+ The TarA protein obtained by column purification has high purity and can be used for subsequent enzymatic property research experiments.

[0069] Example 2 TarA enzyme catalyzed reaction conditions and kinetic characteristics

[0070] Generally, aconitate isomerase can catalyze the forward (from CAA to TAA) and reverse (from TAA to CAA) isomerization reactions. In this example, unless otherwise specified, the reverse reaction of biosynthesis of CAA was selected to determine the optimal conditions for TarA catalysis. The enzyme catalyzed reaction system includes: 100 μM substrate TAA, 100 mM 2-morpholineethanesulfonic acid (MES) buffer (pH 6.5), 20 mM Mg 2+ , 10 mM NaCl and 1 μM TarA in a total volume of 100 μL.

[0071] The reaction was carried out in a 37°C water bath for 0.5 h. After the reaction was terminated, 4 μL of 6M HCl was added. The sample was filtered with a 0.22 μm filter and then subjected to HPLC detection. HPLC detection conditions: The liquid chromatography model was UltiMate 3000; an Agilent 5TC-C18 (2) analytical column (4.6 mm × 250 mm, 5 μm) was used. The mobile phase was 89.9% (v / v) ddH2O + 10% (v / v) methanol + 0.1% (v / v) formic acid; the HPLC-UV parameters were set as follows: column oven 25°C, injection volume 10 μL, flow rate 1 mL / min, detection wavelength 260 nm, and analysis time 10 min.

[0072] 2.1 Effect of pH on the catalytic activity of TarA

[0073] 0.5M 2-morpholineethanesulfonic acid (MES) buffer (pH 5.5, 6.0, 6.5), 0.5M 4-hydroxyethylpiperazineethanesulfonic acid (HEPES) buffer (pH 7.0, 7.5, 8.0), and 0.5M 2-cyclohexylaminoethanesulfonic acid (CHES) buffer (pH 8.5, 9.0, 9.5, 10.0) were prepared respectively, and 10 pH gradients were set. For each group of reactions, a control group (self-reaction control, without TarA protein) and three experimental groups were set up. The reactions were carried out at 37°C for 0.5h. The control group was used to deduct the background value of the non-enzyme-catalyzed reaction to ensure that the CAA product detected in the reaction system was produced by enzyme catalysis.

[0074] Figure 2 The effect of pH on the catalytic activity of TarA protein is shown, where the horizontal axis is temperature and the vertical axis is relative enzyme activity, with pH 6.5 as 100% enzyme activity. It can be seen from the figure that the enzyme activity is the highest when the pH reaches 6.5, and then gradually decreases. It has good tolerance to alkaline pH, has relatively high enzyme activity between pH 6.5-10.0, and the optimal reaction pH is 6.5.

[0075] 2.2 Effects of metal ions on the catalytic activity of TarA

[0076] Prepare 10 mM Mg 2+ 、10mM Mn 2+ , 10 mM Ca 2+ 、10mM Zn 2+ , 10mM Fe 2+ , 10mM Cu 2+ A total of 6 groups of chloride salt solutions with different ions were prepared, and one experimental group without any metal ions was set up. Each reaction group was set up with a control group (self-reaction control, without TarA protein) and three experimental groups, and the reaction was carried out at 37°C for 0.5h.

[0077] TarA protein was treated with different metal ions at the same concentration. Figure 3 It can be seen that (with 10mM Mg 2+ 100% enzyme activity), Mg 2+ The most significant effect on promoting enzyme activity is Ca 2+ , and Cu 2+ 、Zn 2+ has a significant inhibitory effect, so Mg 2+ It is the best metal ion.

[0078] Further detection of Mg 2+ Effect of ion concentrations of 0-100 mM on TarA enzyme activity. 2+ The optimum concentration is as follows Figure 4 As indicated, 20 mM Mg 2+ The enzyme activity is 100%. It can be seen that the enzyme activity is relatively high at 10-50mM. 2+ The enzyme activity was highest when the concentration reached 20 mM.

[0079] 2.3 Effect of ionic strength on TarA protein activity

[0080] NaCl solutions with concentrations of 0mM, 10mM, 20mM, 50mM, 100mM, 200mM, 300mM, 400mM, and 500mM were prepared respectively. A total of 36 samples were subjected to 9 groups of reactions. Each group of reactions had a control group (self-reaction control, without TarA protein) and three experimental groups, and the reactions were carried out at 37°C for 0.5h.

[0081] Figure 5The figure shows the effect of NaCl concentration on the catalytic activity of TarA protein. It can be seen that the enzyme activity reaches the maximum when the NaCl ion concentration is 20mM. When it exceeds 20mM, the enzyme activity weakens with the increase of ionic strength. The ionic strength within the appropriate range (10-200mM) is conducive to the TarA catalytic reaction.

[0082] 2.4 Kinetic parameter K m 、v max , k cat Value determination

[0083] At 37°C, pH 6.5, 20 mM Mg 2+ The product formation rate of TarA protein at different substrate concentrations (1-500 mM) was measured by changing the concentrations of TAA and CAA in MES buffer containing 10 mM NaCl, and K was calculated by double reciprocal plotting. m and the maximum reaction speed v max , k is calculated based on the enzyme concentration cat , and finally calculate k cat With K m The ratio of , thus knowing the catalytic efficiency of TarA enzyme for the two substrates. Figure 6 It can be seen that the forward and reverse reactions mediated by aconitate isomerase are well distributed in a linear relationship, and the kinetic parameters with cis-aconitate (CAA) and trans-aconitate (TAA) as substrates are shown in Table 2.

[0084] Table 2 Kinetic parameters of the TarA protein with CAA and TAA as substrates

[0085]

[0086] According to the above results, it can be seen that the enzymatic parameter K of the isomerization forward reaction catalyzed by the aconitate isomerase of the present invention with CAA as the substrate is m =27.08mM, v max =32.2μM·s -1 , k cat =79.03s -1 , k cat / K m =2.92s -1 mM -1 , while the enzymatic parameter for the isomerization reverse reaction with TAA as substrate is K m =171.45mM, v max =48.2μM·s -1 , k cat =59.17s -1 , k cat / K m =0.345s-1 mM -1 , indicating that the aconitate isomerase protein TarA is more inclined to synthesize TAA. And compared with the isolated TbrA protein, its positive reaction K of isomerizing CAA to TAA is m 、v max , k cat , k cat / K m The values ​​were 6.25mM and 1.39μM·s -1 , 4.08s -1 , 0.65s -1 mM -1 The newly obtained isomerase protein TarA of the present invention has higher catalytic activity and enzyme catalytic efficiency.

[0087] Example 3 Analysis of the ability of tarA gene to promote soil colonization of Bacillus velezinii

[0088] From the above results, it can be seen that aconitate isomerase mediates the mutual conversion between CAA and TAA, so it can isomerize trans-aconitate to cis-aconitate, which enters the cellular energy metabolism pathway as an intermediate metabolite of the tricarboxylic acid cycle. Therefore, this example aims to explore the effect of the tarA gene on the growth of Bacillus velez in soil habitats, and whether it can use trans-aconitate as a carbon source to promote the soil colonization ability of Bacillus velez, so that it has a growth advantage in the natural environment.

[0089] 3.1. Construction of the tarA gene deletion mutant of Bacillus velezinis ΔtarA

[0090] Using the genome of Bacillus velez FZB42 and the chloramphenicol resistance gene (artificially synthesized using the chloramphenicol resistance gene information on the cloning vector pAgR-gCBE4, the GenBank accession number of the cloning vector is MW344269.1) as templates, PCR technology was used to obtain the tarA gene upstream homology arm fragment, the tarA gene downstream homology arm fragment and the chloramphenicol resistance gene fragment, respectively.

[0091] The two primers for the upstream homology arm of the tarA gene are tarA-UF and tarA-UR, and the nucleotide sequences are as follows:

[0092] tarA-UF:TATGGATCCGTCCTCACTGTTGATTTCAG (see SEQ ID NO.5);

[0093] tarA-UR: TCAATTTTATTAAAGTTCATGCTGTCTCATCCTTACATCA (see SEQ ID NO. 6).

[0094] The two primers for the downstream homology arm of the tarA gene are tarA-DF and tarA-DR, and the nucleotide sequences are as follows:

[0095] tarA-DF: CTAATGACTGGCTTTTAATACCAGTCTTCAGACAAGTC (see SEQ ID NO.7);

[0096] tarA-DR: GCCGAGCTCGCTGGTTCAGGCAGTTCACC (see SEQ ID NO. 8).

[0097] The two primers for amplifying the chloramphenicol resistance gene fragment are Cm-F and Cm-R, and the nucleotide sequences are as follows:

[0098] Cm-F: TGATGTAAGGATGAGACAGCATGAACTTTAATAAAATTGA (see SEQ ID NO. 9);

[0099] Cm-R: GACTTGTCTGAAGACTGGTATTATAAAAGCCAGTCATTAG (see SEQ ID NO. 10).

[0100] The PCR configuration system is: 1 μL DNA template, 2 μL upstream primer and 2 μL downstream primer, 1 μL high-fidelity PCR polymerase, 20 μL 5× buffer, 2 μL dNTP, and ddH2O supplemented to 100 μL. PCR program: 94°C pre-denaturation for 5 min, 94°C denaturation for 30 s, 50°C annealing for 40 s, 72°C extension for 1 min, and 30 cycles. The PCR product was subjected to agarose gel electrophoresis, and the target band was cut and recovered to obtain the upstream homology arm fragment tarA-U of the tarA gene, the downstream homology arm fragment tarA-D of the tarA gene, and the chloramphenicol resistance gene fragment Cm.

[0101] The upstream homology arm fragment tarA-U of the tarA gene and the chloramphenicol resistance gene fragment Cm were fused by cross-over PCR to obtain the tarA-U-Cm fragment. The PCR configuration system was: upstream homology arm fragment tarA-U 0.5μL, chloramphenicol resistance gene fragment Cm 0.5μL, primer tarA-UF 2μL, primer Cm-R 2μL, high-fidelity PCR polymerase 1μL, 5×buffer 20μL, dNTP 2μL, supplemented with ddH2O to 100μL. PCR program: 94℃ pre-denaturation 5min, 94℃ denaturation 30s, 50℃ annealing 40s, 72℃ extension 1.5min, 30 cycles. The PCR product was subjected to agarose gel electrophoresis and the gel was cut and recovered to purify the tarA-U-Cm fusion fragment.

[0102] Next, the tarA-U-Cm fragment and the downstream homology arm fragment of the tarA gene, tarA-D, were fused by cross-over PCR to obtain the tarA-U-Cm-tarA-D fragment. The PCR configuration system was: 0.5 μL of the tarA-U-Cm fragment, 0.5 μL of the downstream homology arm fragment of the tarA gene, 2 μL of the primer tarA-UF, 2 μL of the primer tarA-DR, 1 μL of high-fidelity PCR polymerase, 20 μL of 5× buffer, 2 μL of dNTP, and ddH2O was added to 100 μL. PCR program: 94°C pre-denaturation for 5 min, 94°C denaturation for 30 s, 50°C annealing for 40 s, 72°C extension for 2.5 min, and 30 cycles. The PCR product was subjected to agarose gel electrophoresis and the gel was cut and recovered to obtain the tarA-U-Cm-tarA-D fusion fragment.

[0103] The tarA-U-Cm-tarA-D fusion fragment was connected to the T vector by TA cloning technology. After the successful construction of the vector was verified by sequencing, the linearized recombinant plasmid was obtained by BamHI digestion. The linearized recombinant plasmid was then transformed into Bacillus velezensis FZB42.

[0104] Use an inoculation loop to inoculate Bacillus velezensis FZB42 into 20 mL LB liquid medium, and culture overnight at 200 rpm and 37°C; take 500 μL of the overnight culture solution and inoculate it into 20 mL SPI Medium, and culture at 200 rpm and 37°C. When the OD 600When the cell density reaches 1.4-1.5, take 2.5mL of culture solution and inoculate it into 20mL SPII Medium, shake and culture at 37℃, 100rpm for 1.5h; add 250μL 10mM EGTA (pH 8.0) solution, continue to culture at 37℃, 100rpm for 10min, and divide into 500μL per tube with 1.5mL centrifuge tube; add 15μL of linearized recombinant plasmid to each tube, mix well, and culture at 37℃, 100rpm for 50min; add 800μL LB medium to each tube, continue to shake and culture at 200rpm, 37℃ for 2h; spread on LB plate containing chloramphenicol, and culture at 37℃ for 24h. The transformed cell is the tarA gene deletion mutant strain ΔtarA.

[0105] 3.2 Analysis of soil colonization ability of wild strain FZB42 and mutant strain ΔtarA of Bacillus velezini

[0106] Experimental soil samples were taken from the vegetable fields of Hubei Engineering College in Xiaonan District, Xiaogan City, Hubei Province, with a sampling depth of 5-10 cm. After the samples were collected, they were placed in sterile plastic bags and centrifuge tubes and stored at 4°C for later use. Soil physiological and biochemical indicators are as follows: pH range is 7.23±0.03, organic matter content is 17.90±0.32g / kg, total nitrogen content is 1.15±0.05g / kg, total phosphorus content is 0.81±0.01g / kg, total potassium content is 11.98±0.27g / kg, available nitrogen content is 88.65±1.74mg / kg, available phosphorus content is 54.31±1.14mg / kg, and available potassium content is 213.36±5.19mg / kg.

[0107] (1) Single colonization experiment

[0108] The soil sample was thoroughly crushed in a mortar and passed through a 40-mesh sieve. The crushed soil sample was then sterilized at 121°C for 1 hour in a high-pressure steam autoclave. 20 g of sterile soil was weighed using an electronic balance and added to a sterile culture medium. 0.1 mg of TAA was added (the pH value was adjusted to 7.0 with NaOH) to ensure that the TAA concentration was 100 mg / kg. This was used as the experimental group, while the soil without TAA was used as the control group. FZB42 or ΔtarA was inoculated in LB culture medium and cultured at 37°C for 9 hours. After centrifugation, the bacteria were washed and resuspended with sterile water to control the cell density of the FZB42 and ΔtarA bacterial suspensions to be equal. 10 were inoculated in the experimental group and the control group, respectively. 7cfu / g of FZB42 and ΔtarA strains. All components of each soil were mixed thoroughly and cultured at 25°C with a relative humidity of 40% during the culture period. Next, 1 gram of soil sample was taken every 1-5 days and shaken in 9 mL of sterile water at 25°C and 200 rpm for 20 minutes to separate bacterial cells from soil particles. The bacterial supernatant was diluted 10 times in a gradient, spread on LB agar plates, cultured at 30°C, and finally counted.

[0109] (2) Mixed colonization experiment

[0110] The culture fluid of FZB42 or ΔtarA strain was measured by turbidity, and the cell density was 10 7 cfu / mL, and the two culture solutions were mixed in equal amounts, and then the mixed bacteria were inoculated into 20g of sterile soil mixed with 100mg / kg TAA (as the test group) and another 20g of sterile soil without TAA (as the control group), and the two soils were controlled at 25°C and 40% relative humidity. The steps of soil sampling, gradient dilution and colony culture on LB medium are the same as above. The total colony count is determined by counting the colonies on the LB plate in the first round, and then the number of colonies with chloramphenicol resistance is verified and determined on the chloramphenicol resistance plate (5μg / mL), that is, the number of ΔtarA individuals, and the number of FZB42 individuals is equal to the difference between the total population and the number of ΔtarA individuals.

[0111] Figure 7 The growth of wild strain FZB42 and mutant strain ΔtarA in separate colonization experiments is shown, where Figure A is a soil environment without TAA and Figure B is a soil environment with TAA. The results showed that when TAA was not added to the soil, the growth curves of the FZB42 strain and the ΔtarA strain were basically the same; after TAA was added, the FZB42 strain had more biomass, confirming that the tarA gene can promote Bacillus Velezii to use TAA as a carbon source, giving it a greater growth advantage.

[0112] Figure 8The growth of wild strain FZB42 and mutant strain ΔtarA in the mixed colonization experiment is shown, where Figure A is a soil environment without TAA, Figure B is a soil environment with TAA, Figure C is the ratio of FZB42 biomass to ΔtarA biomass, testgroup represents a soil environment with TAA, and control group represents a soil environment without TAA. The mixed colonization experiment showed the same conclusion as the single colonization experiment. In the absence of TAA, the growth curves of FZB42 strain and ΔtarA strain were basically the same; with TAA, FZB42 strain grew faster; it was confirmed that the tarA gene can promote Bacillus Velez to use TAA as a carbon source to maintain its growth, and the biomass is significantly higher than that of the tarA gene-deficient mutant strain ΔtarA, which has more growth advantages, confirming that the tarA gene has the ability to give Bacillus Velez to use TAA carbon sources in nature, so as to obtain more energy, promote its colonization ability in the soil environment, and have stronger adaptability and stress resistance in habitats containing TAA carbon sources.

[0113] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. An aconitate isomerase TarA, characterized in that Its amino acid sequence is shown in SEQ ID NO.

1.

2. A coding gene, characterized in that The gene encodes the aconitate isomerase TarA as described in claim 1.

3. The coding gene according to claim 2, characterized in that The nucleotide sequence of the gene is shown in SEQ ID NO.

2.

4. Use of the aconitate isomerase TarA or its encoding gene as claimed in claim 1 in the biosynthesis of trans-aconitate.

5. The use of aconitate isomerase TarA or its encoding gene in biosynthesis of trans-aconitate according to claim 4, characterized in that: The biosynthesis of trans-aconitic acid comprises the following steps: Cis-aconitate and the aconitate isomerase TarA described above are added to a buffer and reacted at pH 6.5-10.

0.

6. The use of aconitate isomerase TarA or its encoding gene in biosynthesis of trans-aconitate according to claim 5, characterized in that: The buffer contains 10-50 mM Mg 2+ and 10-200 mM NaCl.

7. Use of aconitate isomerase TarA or its encoding gene in biosynthesis of trans-aconitate according to claim 6, characterized in that: The buffer included 20 mM Mg 2+ and 10 mM NaCl at 37°C, pH 6.

5.

8. Use of the aconitate isomerase TarA or its encoding gene as claimed in claim 1 in promoting the colonization ability of microorganisms in soil.

9. The use of aconitate isomerase TarA or its encoding gene in promoting the colonization ability of microorganisms in soil according to claim 8, characterized in that: The microorganism is a bacterium, and the bacterium is Bacillus Velezii.

10. Use of the aconitate isomerase TarA or its encoding gene as claimed in claim 1 in biological control of nematodes.

Images