Nano-carrier for gene editing of aquatic animals and gene editing method

Abstract

The invention discloses a nano-carrier for gene editing of aquatic animals. The nano-carrier comprises a) TNP nano-particles and b) Cas9 mRNA and sgRNA. The invention also discloses an application of the TNP nano-particle as an mRNA delivery carrier and a gene editing method based on the nano-carrier, according to the method, the TNP nano-particle with good biocompatibility is used for packaging Cas9 mRNA and sgRNA, and an efficient and low-damage gene editing delivery mode is realized. The nano-carrier is delivered into an embryo of an aquatic animal in a non-invasive manner, so that the transfection efficiency and the specificity of gene editing are optimized. In addition, the method can improve the gene editing efficiency and precision and enhance the embryo survival rate, is simple, convenient and safe to operate and wide in applicability, can support customized gene editing, and is beneficial to promoting the application of gene editing in aquatic product germplasm genetic improvement.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and in particular relates to a nanocarrier for gene editing of aquatic animals and a gene editing method. Background Art

[0002] With the rapid development of the global aquaculture industry, the demand for genetic improvement of key traits such as disease resistance, growth rate and meat quality improvement is growing. At present, traditional breeding methods such as selective breeding can no longer fully meet the industry's needs for rapid and precise improvement. Especially in the face of new disease threats and environmental adaptability challenges, the market demand for high-quality aquatic products has driven the exploration of more advanced gene editing technologies. However, although traditional gene editing technologies, especially physical delivery methods such as microinjection, have achieved the purpose of gene editing to a certain extent, their application has been significantly limited due to their high technical complexity, strict operating requirements, great damage to embryos, and low survival rates. The high dependence and low adaptability of microinjection technology, especially in commercial aquaculture scenarios that require the processing of large numbers of samples, have become the main obstacles to its popularization.

[0003] Faced with these challenges, it is imperative to develop a new gene delivery technology that is both efficient and less damaging. The introduction of lipid nanoparticles (LNP) technology provides a feasible solution to this problem. LNP technology encapsulates gene editing tools such as Cas9 protein and single guide RNA (sgRNA) in nanoscale lipid particles, protects RNA from degradation by enzymes in the body, and effectively delivers it to the target cells. Compared with microinjection technology, the LNP delivery system is non-invasive, greatly reducing the damage to embryos caused by physical puncture, thereby improving the safety of the operation and the survival rate of the embryo.

[0004] In addition, the high delivery efficiency and excellent cell penetration of the LNP delivery system enable it to exhibit high specificity and efficiency in gene editing. By precisely controlling the size, surface charge and lipid composition of LNP particles, its delivery performance can be further optimized and its targeting in specific cell types can be enhanced. Another significant advantage of LNP technology is its scalability. It is suitable for large-scale production and application, and can meet the needs of rapid and large-scale gene editing in commercial farming. This feature makes the LNP delivery system particularly suitable for promotion and use in the aquaculture industry, which helps to quickly improve the production traits of aquatic animals without sacrificing genetic diversity, such as enhancing disease resistance, improving growth rate and meat quality, etc.

[0005] Although current gene editing technologies, including LNP and Cas9 tools, have demonstrated high gene editing efficiency in cells and some animal models, they face certain limitations when used in aquatic animals. First, traditional physical delivery methods (such as microinjection) are complex to operate and require high technical staff, especially when dealing with a large number of aquatic animal embryos, which are less efficient. In addition, this type of physical delivery method can easily cause mechanical damage to the embryos, resulting in a decrease in survival rate and increasing the risk of experimental failure. Secondly, although LNP technology can improve delivery efficiency, it has not yet been fully optimized in aquatic animals, especially in the application of different aquatic species. It may also be necessary to adjust the particle size, surface modification, etc. to ensure the accuracy and efficiency of delivery.

[0006] Therefore, although the direct use of LNP and Cas9 has improved the efficiency of gene editing to a certain extent, the existing delivery system cannot completely solve the problems of low efficiency and embryo survival rate in aquaculture environments.

[0007] The improvement of the present invention aims to optimize the design and delivery path of nanocarriers for the special biological environment and application requirements of aquatic animals, ensure that gene editing tools can reach target cells more efficiently, and reduce damage to embryos. In addition, the present invention also focuses on solving practical operational problems in large-scale applications, providing a gene editing solution that is easier to operate, highly adaptable, and feasible in a commercial environment. This can not only improve editing efficiency, but also significantly improve the survival rate of embryos, meeting the needs of rapid improvement in aquaculture. Summary of the invention

[0008] The present invention aims to provide a nanocarrier for gene editing of aquatic animals.

[0009] The present invention also aims to provide a method for editing the Cas9 gene in aquatic animals based on the above-mentioned nanocarrier.

[0010] The above-mentioned first object of the present invention can be achieved by the following technical scheme: a nanocarrier for gene editing of aquatic animals, comprising a) TNP nanoparticles and b) Cas9 mRNA and sgRNA.

[0011] Preferably, the TNP nanoparticles in a) are prepared by the following method: (1) Maleimidized polyethylene glycol Mal-PEG-OH, lactide D, L-LA and glycolide GA are added to a reaction vessel, a magnetic particle is added and the mixture is heated to 130-150°C in an oil bath, and stirring is continued until all the solids in the reaction vessel are dissolved. Subsequently, stannous isooctanoate Sn(Oct)2 is added dropwise under stirring and the reaction is continued for 2-5 h. After the reaction is completed, the concentrated product is precipitated in a methanol-ether mixture, and filtered and dried to obtain a light yellow Mal-PEG- b -PLGA; (2) Take Mal-PEG- b -PLGA was added to a round-bottom container, and a stirring magnet and dimethyl sulfoxide (DMSO) were added to dissolve Mal-PEG- b -PLGA, then ultrapure water was added under stirring conditions and continued to stir to prepare Mal-NP nanoparticles; (3) The Mal-NP nanoparticles were dialyzed in ultrapure water overnight to remove dimethyl sulfoxide (DMSO). The nanoparticle solution in the dialysis bag was collected and transferred to a round-bottom container. The cell-penetrating peptide TAT was added and stirred for reaction under nitrogen protection. After the reaction, the particle solution was collected and centrifuged. The particle precipitate in the lower layer was collected and freeze-dried to obtain TAT-modified TAT-Mal-NP material, referred to as TNP nanoparticles.

[0012] Preferably, in step (1), the molar ratio of maleimidized polyethylene glycol Mal-PEG-OH, lactide D, L-LA and glycolide GA is 0.2:10.8~11.5:5.0~5.2.

[0013] More preferably, in step (1), the molar ratio of maleimidized polyethylene glycol Mal-PEG-OH, lactide D, L-LA and glycolide GA is 0.2:11.111:5.173.

[0014] More preferably, in step (1), a magnetron is added and the mixture is heated to 130° C. in an oil bath.

[0015] More preferably, in step (1), Sn(Oct)2 is added dropwise under stirring and the stirring reaction is continued for 3 h.

[0016] Preferably, the volume ratio of methanol to ether in the methanol-ether mixture in step (1) is 1:9-11.

[0017] More preferably, the volume ratio of methanol to ether in the methanol-ether mixture in step (1) is 1:10.

[0018] Preferably, the Mal-PEG- b-The dosage relationship between PLGA and dimethyl sulfoxide DMSO is 145-155 mg: 15-25 mL.

[0019] More preferably, the Mal-PEG- b The dosage of PLGA and dimethyl sulfoxide (DMSO) is 150 mg:20 mL.

[0020] Preferably, in step (2), 80-120 mL of ultrapure water is slowly added under stirring and stirred continuously for 1.5-2.5 h to prepare Mal-NP nanoparticles.

[0021] More preferably, in step (2), 100 mL of ultrapure water is slowly added under stirring conditions and stirred continuously for 2 h to prepare Mal-NP nanoparticles.

[0022] Preferably, in step (3), the mass ratio of the Mal-NP nanoparticles to the cell-penetrating peptide TAT is 14-16:1.5-2.5.

[0023] More preferably, in step (3), the mass ratio of the Mal-NP nanoparticles to the cell-penetrating peptide TAT is 15:2.

[0024] The transmembrane peptide TAT is a targeting ligand that can be used to enhance the affinity between nanocarriers and aquatic animal embryonic cells, and to improve the accuracy of gene editing and the flexibility of operation through specific concentration control. It has a high affinity with the surface of the aquatic animal embryonic cell membrane and can fuse with or embed into the cell membrane of the aquatic animal embryonic cell membrane to enhance the interaction between the nanocarrier and the aquatic animal embryonic cells.

[0025] Preferably, the average particle size of the TNP nanoparticles in step (3) is in the range of 50 to 200 nanometers.

[0026] The core of the present invention is to use specially designed TNP nanoparticles, which have good biocompatibility and low immunogenicity, and can effectively reduce physical and chemical damage to the embryo. By precisely controlling the size, surface charge and chemical properties of the nanoparticles, the affinity with the embryo membrane is optimized, thereby improving the transfection efficiency and specificity.

[0027] The present invention also provides the use of the TNP nanoparticles as mRNA delivery carriers.

[0028] When used, the TNP material can be first dissolved in chloroform, and then a chloroform solution of (2,3-dioleoyl-propyl)-trimethylamine DOTAP and an ultrapure aqueous solution of mRNA are added to obtain a mixed material solution. The mixed material solution is subjected to a first ultrasound in an ice bath, and after the ultrasound, DEPC water is added and mixed. Subsequently, the centrifuge tube is placed in an ice bath and subjected to a second ultrasound. After the ultrasound, the obtained particle solution is TNP nanoparticles encapsulating mRNA substances, wherein the TNP nanoparticles are polymer nanocarriers for delivering genetic substances such as mRNA.

[0029] The nanocarrier for gene editing of aquatic animals provided by the present invention can solve the problems of low efficiency and low embryo survival rate in the current gene editing technology of aquatic animals. It utilizes TNP nanocarriers with good biocompatibility to effectively encapsulate Cas9 mRNA and sgRNA, and deliver them to the embryos of aquatic animals (such as zebrafish, giant tiger shrimp, etc.) in a non-invasive manner.

[0030] Preferably, the method for preparing a nanocarrier for gene editing of aquatic animals according to the present invention comprises the following steps: mixing an ultrapure aqueous solution of Cas9mRNA and sgRNA with TNP and DOTAP, and preparing a nanocarrier for gene editing of aquatic animals through two ultrasonic processes.

[0031] The above second object of the present invention can be achieved by the following technical scheme: A method for editing the Cas9 gene in aquatic animals based on the above nanocarrier comprises the following steps: 1) Preparation of TNP nanoparticles containing Cas9 mRNA and sgRNA; 2) delivering the nanoparticles into embryos of target aquatic animals; 3) Editing the target gene in the embryo.

[0032] Preferably, the Cas9 mRNA and sgRNA described in step 1) are encapsulated in the TNP nanoparticles by physical adsorption, chemical binding or biocompatible encapsulation technology.

[0033] As a preferred embodiment of the present invention, the preparation of TNP nanoparticles containing Cas9 mRNA and sgRNA in step 1) comprises the following steps: first dissolving the TNP nanoparticles in chloroform, then adding a chloroform solution of (2,3-dioleoyl-propyl)-trimethylamine DOTAP and an ultrapure aqueous solution of Cas9 mRNA and sgRNA to obtain a mixed material solution, subjecting the obtained mixed material solution to a first ultrasound in an ice bath, adding ultrapure water after the ultrasound to mix, then subjecting the solution to a second ultrasound in an ice bath, and then concentrating the solution to obtain TNP nanoparticles containing Cas9 mRNA and sgRNA.

[0034] Preferably, during the first ultrasound treatment, the ultrasound is set to be on for 5 seconds, off for 2 seconds, the ultrasound time is 1 minute, and the power is 80 W.

[0035] Preferably, during the second ultrasound treatment, the ultrasound is set to be on for 10 seconds, off for 2 seconds, the ultrasound time is 1 minute, and the power is 80 W.

[0036] The delivery system of the present invention can further improve the accuracy of gene editing and the flexibility of operation by adjusting the concentration of nanocarriers.

[0037] Preferably, in step 2), the method for delivering the nanoparticles into the embryo of the target aquatic animal is immersion, injection or electroporation.

[0038] Preferably, the target aquatic animal in step 2) is zebrafish or giant tiger prawn.

[0039] Preferably, the editing of the target gene in step 3) is intended to improve the disease resistance, growth rate or meat quality of aquatic animals.

[0040] Preferably, the method further comprises step 4) verifying the effect of the gene editing, wherein verifying the effect of the gene editing comprises using PCR or sequencing.

[0041] Therefore, the present invention selects specific Cas9 mRNA and sgRNA for different aquatic animal species, as well as customizes the design of nanocarriers for each specific editing target (such as disease resistance, growth rate or pigmentation). A rapid screening method for evaluating the editing effect is also provided, allowing for rapid identification and optimization of successful gene editing events at an early stage.

[0042] The present invention has the following advantages: (1) Improving gene editing efficiency and accuracy: By using specially designed nanocarriers, the method of the present invention significantly improves the delivery efficiency of the CRISPR / Cas9 system and the targeting of gene editing. This method can reduce discrete gene editing events, thereby improving the overall success rate and accuracy of gene editing; (2) Enhanced embryo survival rate: Compared with traditional microinjection technology, TNP nanocarriers provide a milder gene delivery method, significantly reducing the risk of embryo damage, thereby improving the overall survival rate of the embryo; (3) Simplicity and safety of operation: The present invention simplifies the operation process of gene editing and reduces the reliance on highly skilled operators. At the same time, due to the biocompatibility and low immunogenicity of the nanocarrier, potential biosafety risks are reduced; (4) Wide applicability: This method can be widely applied to a variety of aquatic animals, including those small or sensitive species that are difficult to operate with traditional microinjection methods; (5) Support customized gene editing: By adjusting the properties of the nanocarrier, it can be tailored for specific gene editing targets and different aquatic animal species, providing a highly flexible gene editing solution. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] The present invention will be further described below in conjunction with embodiments with reference to the accompanying drawings.

[0044] Figure 1 A is a synthetic route of the Mal-PEG-b-PLGA polymer material of Example 1; B is a gel permeation chromatogram of the Mal-PEG-b-PLGA polymer material and the Mal-PEG-OH raw material of Example 1; C is a nuclear magnetic resonance hydrogen spectrum of the Mal-PEG-b-PLGA polymer material of Example 1; Figure 2 A is a schematic diagram of the process of preparing TNP nanoparticles encapsulating mRNA by double emulsion method in Example 1; B is a particle size diagram of TNP nanoparticles detected by dynamic light scattering in Example 1; C is a diagram of the encapsulation efficiency of TNP for mRNA detected by RiboGreen kit in Example 1; D is a particle size diagram of TNP nanoparticles in seawater for 24 h in Example 1; E is a dispersion monitoring diagram of Example 1; F is a diagram of the encapsulation efficiency of TNP nanocarriers with different mass ratios for plasmid systems detected by agarose gel in Example 1; Figure 3 The zebrafish eggs in Example 2 were incubated with the rhodamine red particles encapsulated by the TNP nanocarriers, and the red fluorescence of the zebrafish eggs was observed after incubation for 8 h, 24 h, and 48 h to test the fusion effect of the TNP nanoparticles with the zebrafish egg membrane; Figure 4 The zebrafish eggs in Example 2 were co-incubated with the EGFP-mRNA encapsulated by the TNP nanoparticles, and the green fluorescence of the zebrafish eggs was observed after incubation for 8 hours and 48 hours to test the expression effect of the TNP nanoparticles delivering the EGFP-mRNA in the zebrafish eggs; Figure 5 In Example 3, zebrafish eggs were co-incubated with Cas9mRNA and Tyr-sgRNA encapsulated by TNP nanocarriers. After incubation for 72 hours, genomic DNA was extracted for NGS second-generation sequencing, and the sequencing mutation results were displayed. DETAILED DESCRIPTION

[0045] The present invention is further described below in conjunction with specific examples. The following examples and drawings are only used for illustrative purposes and are not to be construed as limiting the present invention. Unless otherwise specified, the reagent raw materials used in the following examples are conventional commercially available or commercially available raw reagent raw materials, and unless otherwise specified, the methods and equipment used in the following examples are conventional methods and equipment used in the art.

[0046] The following examples are provided to further illustrate the present invention, rather than to limit the present invention.

[0047] Example 1 The present invention is further described below in conjunction with specific examples. It should be understood that the following examples are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0048] Example 1 Preparation of Nanocarriers and Embedding 1. Synthesis of polymer materials First, maleimidized polyethylene glycol-poly(lactide-co-glycolide) (Mal-PEG 5k - b -PLGA 10k ).

[0049] The specific synthesis steps are as follows: Maleimidized polyethylene glycol (Mal-PEG 5k (5k refers to the molecular weight of PEG) -OH) and the lactide (D, L-LA) and glycolide (GA) that were frozen and pumped overnight to remove water were transferred to a glove box (H2O < 0.1 ppm, O2 < 0.1 ppm). Weigh Mal-PEG 5k -OH (1 g, 0.2 mmol) and D, L-LA (1.6 g, 11.111mmol) and GA (0.6 g, 5.173 mmol) were added to a 50 mL round-bottom flask that had been pre-baked to remove moisture. A magnetic bar was added and the mixture was heated to 130 °C in an oil bath. Stirring was continued until all the solids in the flask were dissolved. Subsequently, 2 drops (20 mg, 0.049 mmol) of stannous isooctanoate (Sn(Oct)2) were added dropwise under stirring and the reaction was continued for 3 h. After the reaction was completed, the concentrated product was precipitated in a methanol / ether mixture (1 / 10, v / v), and filtered and dried to obtain a light yellow Mal-PEG 5k - b -PLGA 10k (10k refers to Mal-PEG 5k - b -PLGA molecular weight), the product was collected and weighed and 1 The chemical structure was determined by H NMR.

[0050] Further, 150 mg Mal-PEG was weighed 5k - b -PLGA 10k Add to a 250 mL round-bottom flask, add a stirring magnet, add 10 mL of dimethyl sulfoxide (DMSO) to dissolve the above polymer materials, and slowly add 100 mL of ultrapure water under stirring conditions and stir continuously for 2 h to prepare Mal-NP nanoparticles.

[0051] Mal-NP was dialyzed in ultrapure water overnight to remove DMSO, the nanoparticle solution in the dialysis bag was collected and transferred to a round-bottom flask, TAT (membrane-penetrating peptide, 20 mg, 0.016 mmol) was weighed and added to the round-bottom flask and stirred for 12 h under nitrogen protection. TAT was modified on the surface of Mal-NP by the click chemistry reaction between the thiol group in the cysteine ​​residue at the end of TAT and maleimide. After the reaction, the particle solution was collected and centrifuged at 30,000 g for 2 h, the lower particle precipitate was collected, and the TAT-PEG- b -PLGA material (abbreviated as TNP).

[0052] The supernatant was collected after high-speed centrifugation, and the DTNB in ​​the Ellman's kit (pH 8.0, 70 μg / mL, 100 mMPB buffer containing 1 mM ethylenediaminetetraacetic acid (EDTA)) was used to react with the unreacted free TAT terminal thiol in the supernatant for 15 min. The absorption value of the reaction solution at 412 nm was then detected to calculate the bonding efficiency of TAT and Mal group.

[0053] The synthetic route of the Mal-PEG-b-PLGA (TNP) polymer material in this embodiment is as follows: Figure 1 As shown in A in FIG. 1 , the gel permeation chromatograms of the Mal-PEG-b-PLGA polymer material and the Mal-PEG-OH raw material are shown in FIG. Figure 1 As shown in B, Mal-PEG- b The peak time of -PLGA was earlier than that of the raw material Mal-PEG-OH, indicating that Mal-PEG- b -PLGA block polymer material; further, according to Mal-PEG- b -NMR hydrogen spectrum of PLGA polymer material Figure 1 As shown in C, the synthesized Mal-PEG- b-The degree of polymerization of LA in the PLGA polymer is 111, while the degree of polymerization of GA is 40, resulting in a final PLGA segment molecular weight of 10,000 Daltons.

[0054] 2. Preparation of RhoB-labeled TNP nanoparticles: Weigh 25 mg TAT-PEG- b -PLGA (TNP) and 1 mg of rhodamine B-labeled PLGA (PLGA refers to poly (lactide-co-glycolide) homopolymer, the same below) (RhoB-PLGA) were co-dissolved in 400 μL of chloroform, and (2,3-dioleoyl-propyl)-trimethylamine (DOTAP, 2 mg, 100 μL, chloroform) was added thereto; DEPC water (400 μL, ultrapure water) was added to a 50 mL centrifuge tube; then the above mixed material solution was added to the bottom of the centrifuge tube. The centrifuge tube was placed in an ice bath for the first ultrasound, and the ultrasound probe was submerged in the liquid surface. The setting was 5s ultrasonic, 2s off, 1min ultrasonic time, and 80W power. After the ultrasonic was finished, 5mL DEPC water was added and mixed. Then the centrifuge tube was placed in an ice bath for a second ultrasonic treatment, which was set to 10s ultrasonic, 2s off, 1min ultrasonic time, and 80W power. After the ultrasonic was finished, the liquid was transferred to a round-bottom flask, connected to a rotary evaporator, the air inlet was closed, and the vacuum pump was turned on at a low speed. After the bubbles were exhausted and the solution became clear, the round-bottom flask was sunk into a water bath to concentrate the particle solution to 1-2 mL.

[0055] 3. Preparation of TNP nanocarriers carrying genetic material: Weigh 25 mg TAT-PEG- b-PLGA (TNP) and rhodamine B labeled PLGA were dissolved in 400 μL chloroform, and (2,3-dioleoyl-propyl)-trimethylamine (DOTAP, 2 mg, 100 μL, chloroform) was added thereto; a 50 mL centrifuge tube was added with DEPC water (400 μL), and then EGFP-mRNA (50 μg) (this gene is derived from the jellyfish Aequoreavictoria, and it is an optimized green fluorescent protein. EGFP is often used to study gene expression efficiency and cell function because it can emit obvious green fluorescence in vivo and can be directly observed in living cells without adding exogenous substances. This makes EGFP one of the most commonly used reporter genes in cell biology and genetic engineering.); then the above mixed material solution was added to the bottom of the centrifuge tube. The centrifuge tube was placed in an ice bath for the first ultrasound, and the ultrasound probe was submerged in the liquid surface. The setting is 5s ultrasonic, 2s stop, 1min ultrasonic time, and 80W power; after the ultrasonic, add 5ml DEPC water and mix; then put the centrifuge tube in an ice bath for a second ultrasonic, set to 10s ultrasonic, 2s stop, 1min ultrasonic time, and 80W power; after the ultrasonic, transfer the liquid to a round-bottom flask, connect it to a rotary evaporator, close the air inlet, turn on the vacuum pump and rotate at a low speed. After the bubbles are exhausted and the solution becomes clear, sink the round-bottom flask into a water bath and concentrate the particle solution to 1-2 mL; finally, use the RiboGreen kit to detect the mRNA encapsulation efficiency, or use agarose gel to detect the plasmid or siRNA encapsulation efficiency. Further, transfer the TNP nanoparticle solution containing genetic material to an EP tube and store it at 4°C for later use.

[0056] The schematic diagram of preparing TNP nanoparticles encapsulating genetic material by double emulsion method in this embodiment is as follows Figure 2 As shown in A, the particle size of TNP nanoparticles is Figure 2 As shown in B, the RiboGreen kit detects the encapsulation efficiency of TNP on mRNA. Figure 2 As shown in C, the particle size and dispersion of TNP nanoparticles in seawater for 24 h were monitored. Figure 2 As shown in D and E; agarose gel detection of TNP nanocarriers with different mass ratios for plasmid system encapsulation efficiency as shown in Figure 2 As shown in F.

[0057] Figure 2 The results showed that TNP nanocarriers can effectively encapsulate genetic materials such as mRNA or plasmids, and have good particle stability in seawater, and have potential for application in gene editing of embryonic cells of aquatic species.

[0058] Example 2 Delivery expression verification and gene editing detailed description, 1. Verification process of zebrafish egg membrane fusion To verify the fusion effect of the TNP nanomaterial and the zebrafish embryo egg membrane in Example 1, the following steps can be taken: Delivery of nanoparticles: The TNP nanoparticles labeled with RhoB-PLGA in Example 1 were suspended in a suitable medium, and then zebrafish embryos were immersed in the solution containing the nanoparticles.

[0059] Fluorescence microscopic observation: After 8h, 24h, and 48h of immersion, the embryos were observed using a fluorescence microscope. The fluorescence signal of the rhodamine particles was used to check whether the nanoparticles had fused with the egg membrane and attached to the embryo surface.

[0060] Data analysis: The efficiency of egg membrane fusion was evaluated by comparing the fluorescence intensity of embryos in the treated and control groups. High fluorescence intensity indicates good membrane fusion effect.

[0061] The results of co-incubation of zebrafish eggs with TNP nanocarrier-encapsulated Rhodamine red particles are shown in Figure 2. Figure 3 As shown, the red fluorescence of zebrafish eggs was observed after incubation for 8 h, 24 h, and 48 h to test the fusion effect of TNP nanoparticles with the zebrafish egg membrane.

[0062] Figure 3 The experimental results in the study showed that the nanoparticles encapsulating rhodamine particles can effectively fuse with the zebrafish egg membrane, and this fusion is positively correlated with the concentration of the nanoparticles. As the concentration of the nanoparticles gradually increased, the red fluorescence intensity of the zebrafish egg membrane increased significantly, indicating that the higher the concentration of TNP nanoparticles, the better the fusion effect with the zebrafish egg membrane.

[0063] 2. Validation process of mRNA delivery To verify the effectiveness of TNP nanomaterials in delivering EGFP-mRNA to zebrafish and giant shrimp embryos, the following steps can be taken: Delivery and incubation: Nanoparticles encapsulated with EGFP-mRNA were suspended in enzyme-free water at a suspension dilution concentration of 0.5 μg / mL and 1 μg / mL of embedded mRNA, and then the embryos were placed in the solution for immersion incubation.

[0064] Fluorescence microscopy: 8 hours after hatching, green fluorescent protein expression in zebrafish embryos was observed using a fluorescence microscope. The presence and intensity of fluorescence can reflect the efficiency of mRNA delivery and expression level.

[0065] Expression analysis: The fluorescence intensity is quantified by image analysis software to evaluate the delivery effect and expression efficiency of EGFP-mRNA. At the same time, biochemical experiments such as RT-PCR or Western blot can be performed to verify the protein expressed by mRNA.

[0066] Fluorescence microscopic observation of zebrafish eggs co-incubated with EGFP-mRNA encapsulated by TNP nanocarriers Figure 4 As shown, the green fluorescence of zebrafish eggs was observed after incubation for 8 h and 48 h to test the expression effect of TNP nanoparticles delivering EGFP-mRNA in zebrafish eggs.

[0067] like Figure 4 As shown, the experimental results show that zebrafish eggs transfected with EGFP-mRNA encapsulated by TNP nanocarriers showed green fluorescence signals after incubation for 8 hours and 48 hours, while no fluorescence expression was observed in the control group. This shows that EGFP-mRNA was successfully expressed in zebrafish eggs. At the same time, as the concentration of nanocarriers encapsulating EGFP-mRNA increased, the green fluorescence intensity of zebrafish eggs also gradually increased. The experimental results prove that TNP nanocarriers can effectively transfect EGFP-mRNA and successfully express it in zebrafish eggs, and its expression effect is closely related to the concentration of nanocarriers.

[0068] Example 3 1. Delivery verification of gene editing in zebrafish embryos 1.1 Zebrafish egg preparation Before implementing the method of the present invention, adult zebrafish were first prepared and obtained from the National Zebrafish Resource Center, using healthy, mature samples, which were about 120 days old. In order to enhance mating activity, male and female zebrafish were separated and raised one day before spawning.

[0069] Hatching was carried out in a dedicated aquarium with water temperature maintained between 28-30°C. The lighting cycle was set to 14 hours of light and 10 hours of darkness per day, simulating the day-night changes in the natural environment to promote the normal physiological rhythm and reproductive behavior of zebrafish.

[0070] Usually, zebrafish were mated by removing the baffle 30 minutes after lights were turned on. Fertilized eggs were collected within 40 minutes after mating and immediately rinsed three times with distilled water to remove surface contaminants.

[0071] 1.2 Tyr gene target design To achieve effective editing of the zebrafish Tyr gene, it is necessary to accurately design the targeted single guide RNA (sgRNA) of the CRISPR / Cas9 system. The following are the steps for designing the CRISPR / Cas9 target site of the Tyr gene: 1.2.1 Gene sequence acquisition: First, we need to obtain the complete sequence of the zebrafish Tyr gene, which can be obtained through the public database NCBI.

[0072] Zebrafish tyr gene (tyrosinase gene), the tyrosinase encoded by the tyr gene is a key enzyme involved in the synthesis of melanin. Its sequence and source sequence information are as follows: NCBI Reference Sequence: NM_131013.3.

[0073] (a) Sequence characteristics, * Length: 1955 base pairs; *Type: Nucleotide; *Chain type: double chain; *Topology: Linear; (b) Molecule type: nucleic acid; Sequence description: NM_131013.3.

[0074] 2.2 Target identification and selection: 2.2.1 Target location: In the Tyr gene sequence, select regions with typical PAM sequences (NGG) as potential CRISPR targets. Usually, targets located near functional domains or key coding regions are selected to increase the possibility of phenotypic changes after editing.

[0075] 2.2.2 Specificity analysis: Use the online tool Chopchop to perform target specificity analysis. These tools can evaluate the uniqueness of the selected target in the genome and reduce the risk of non-target editing.

[0076] 2.2.3 sgRNA design: Sequence design: sgRNA is designed according to the selected target sequence. sgRNA usually includes a 20-nucleotide targeting sequence, immediately adjacent to the PAM sequence.

[0077] Optimization: Optimization of the sgRNA sequence may include increasing the GC content to enhance stability and binding efficiency, or introducing modifications into the sequence to improve resistance to nuclease degradation.

[0078] The designed sequence is: ggactggaggacttctgggg (as shown in SEQ NO: 1).

[0079] 2.2.4sgRNA synthesis: According to the optimized design, sgRNA is synthesized. Chemical modification needs to be introduced when synthesizing mRNA. The introduction of N1-methyl pseudouridine specifically includes: During the synthesis of mRNA, specific uracil sites are selected for chemical modification, replacing uridine (U) with N1-methyl pseudouridine (m1Ψ). This modification helps reduce the chance of mRNA being recognized by the human endogenous immune system. The m1Ψ modification reduces the ability of mRNA to activate pattern recognition receptors such as RIG-I.

[0080] The m1Ψ was introduced during in vitro transcription using a transcriptase, ensuring uniformity and high efficiency of modification.

[0081] Synthetic sequence: mG*mG*mA*rCrUrGrGrArGrGrArCrUrUrCrUrGrGrGrGrGrUrUrUrUrArGrArGrCrUrArGrArArArUrArGrCrArArGrUrUrArArArUrA rArGrGrCrUrArGrUrCrCrGrUrUrArUrCrArArCrUrUrGrArArArArGrUrGrGrCrArCrCrGrArGrUrCrGrGrUrGrCrU*mU*mU*mU (as SEQ NO:2 shown).

[0082] 2.2.5 Synthesis of NLS-Cas9-NLS (nuclear localization) mRNA: The NLS sequence is a publicly known sequence.

[0083] (a) Sequence characteristics, * Length: 4272 base pairs; *Type: Nucleotide; *Chain type: single chain;

[0084] When synthesizing Cas9-mRNA, chemical modifications need to be introduced. The introduction of N1-methylpseudouridine specifically includes: During the synthesis of mRNA, specific uracil sites are selected for chemical modification, replacing uridine (U) with N1-methyl pseudouridine (m1Ψ). This modification helps reduce the chance of mRNA being recognized by the human endogenous immune system. The m1Ψ modification reduces the ability of mRNA to activate pattern recognition receptors such as RIG-I.

[0085] The m1Ψ was introduced during in vitro transcription using a transcriptase, ensuring uniformity and high efficiency of modification.

[0086] Addition of poly(A) tail: A poly(A) tail is added to the 3' non-coding region of mRNA, which is generally 100-250 adenylate units in length. This structure not only protects mRNA from degradation by external enzymes, but also enhances its translation efficiency.

[0087] At the 5' end, a modified 5' cap structure (such as the m^7G cap) is added, which is achieved through a co-transcriptional mechanism, further improving the stability and efficiency of mRNA.

[0088] Purification and verification of modified mRNA, Purification process: RNA purification columns are used for chromatography to remove unreacted nucleotides, enzymes, and other impurities from the reaction mixture.

[0089] The modified mRNA is further purified by ion exchange columns or affinity chromatography columns to ensure high-purity products.

[0090] Verify the integrity and efficiency of the modification: The modified mRNA was analyzed using gel electrophoresis technology, and the success of the modification was preliminarily verified by comparing the difference in mobility before and after modification.

[0091] Mass spectrometry analysis is used to further confirm the presence and modification rate of various modifications on mRNA, ensuring the accuracy and consistency of each modification step.

[0092] Perform terminal sequencing analysis to accurately check the modified mRNA sequence to ensure there are no unexpected sequence changes or mismatches.

[0093] The above-mentioned synthesized and modified Cas9mRNA and Tyr-sgRNA were co-embedded, and through a double emulsification process similar to the above, DEPC water containing 50 µg Cas9mRNA + 30 µg Tyr-sgRNA and Mal-PEG-b-PLGA / DOTAP mixed material were prepared through two ultrasonic processes to obtain TNP / Cas9-mRNA&Tyr-sgRNA nanoparticles.

[0094] 4. Delivery Method and Verification Nanocarriers were delivered using the immersion method. The specific operation was to place zebrafish embryos into a nanocarrier containing a TAT-PEG- b -PLGA material) solution, allowing the nanoparticles to naturally contact the embryo and be taken up by the embryonic cells. During the delivery process, the concentration of the nanocarrier needs to be precisely controlled, usually in the range of 1 to 100 μg / mL, and the specific concentration depends on the embryo's receptive capacity and cell type. In addition, the immersion time is also a key parameter, generally lasting from 1-12h, adjusted according to different embryonic development rates.

[0095] To maximize transfection efficiency and reduce cytotoxicity, physical methods such as microfluidization or low-speed centrifugation can be used during delivery to help nanoparticles distribute and contact embryonic cells more evenly. The advantages of this method are its non-invasiveness and reproducibility, which is suitable for large-scale operations.

[0096] Implementation of gene editing, After the nanovector is delivered to the embryonic cells, the Cas9 protein and sgRNA will be released inside the cells. The Cas9 protein forms a complex with the sgRNA and binds to the target DNA through the sequence specificity guided by the sgRNA. The Cas9 enzyme then cuts the double-stranded DNA at the specified position and initiates the cell's DNA repair mechanism. In this process, mutations can be introduced or specific genetic errors can be corrected through homologous recombination (HDR) or non-homologous end joining (NHEJ)-mediated repair pathways.

[0097] 5. Detailed description of effect verification The effect verification of the method of the present invention is a key step to ensure the correctness and effectiveness of gene editing. The following is a detailed expansion of each step in 4: 5.1. Sample collection In gene-edited embryos of aquatic animals, samples are collected at specific time points after gene editing (usually more than 72 hours after editing, depending on the species and the development speed of the embryo). Using fine micromanipulation tools, a small amount of tissue samples are gently extracted from each edited embryo under a microscope, or the entire embryo is extracted without affecting embryonic development. To prevent sample contamination and DNA degradation, all operations should be performed in a sterile environment, and the samples should be quickly transferred to a suitable preservation solution or directly subjected to DNA extraction.

[0098] 5.2. Gene Editing Validation After extracting DNA from the collected samples, the target gene region is amplified by polymerase chain reaction (PCR) using specific primers. The amplified DNA fragment should include the site expected to be edited by CRISPR / Cas9. PCR amplification of the target editing region of the Tyr gene is performed using specifically designed primers. This step is to ensure that sequencing covers all potential editing sites, and the primer design needs to include the vicinity of the PAM sequence and possible editing regions.

[0099] Sequencing library preparation: Sequencing library construction is performed using PCR products. During this process, appropriate adapters and index tags are added to allow for multiplex sequencing on the Illumina platform.

[0100] Sequencing library preparation, Accurate library construction is critical to the success of high-throughput sequencing.

[0101] End modification and adapter ligation: PCR amplification products are first subjected to end modification, usually including A-tailing and adapter ligation. In this process, specific adapter sequences are ligated to both ends of the PCR product. These adapters contain sequences and index tags for Illumina sequencing, allowing multiple samples to be processed in parallel in the same sequencing reaction.

[0102] Library purification and validation: After the adapter is connected, gel electrophoresis or magnetic bead purification is used to remove unconnected adapters and PCR products that are too small. The purified library is analyzed for concentration and size distribution by qPCR and capillary electrophoresis to ensure that the library quality meets the requirements of high-throughput sequencing.

[0103] Data processing and analysis, The processing and analysis of high-throughput sequencing data is the core link in determining the effect of gene editing.

[0104] Data quality control: Use CASAVA and other software to process raw sequencing data and perform basic quality control, including removing low-quality reads and trimming adapter sequences to ensure the accuracy of data analysis.

[0105] Sequence alignment: Use MAFFT or BWA software to align the cleaned reads with the reference genome to accurately identify sequence changes in the edited region. The alignment results help determine specific CRISPR / Cas9-mediated editing events, such as single nucleotide variations, insertions, or deletions.

[0106] Editing efficiency and specificity analysis: Calculate the variation frequency of editing sites through comparison results to evaluate editing efficiency. At the same time, check potential off-target sites to ensure the specificity and accuracy of editing.

[0107] Analysis of sequencing results includes comparing gene sequences before and after editing, with a particular focus on the gene region targeted by the sgRNA guided by the Cas9 enzyme. Analyze whether there are expected insertion, deletion, or substitution mutations (indels), as well as the type and frequency of these changes. The accuracy and effectiveness of gene editing can be evaluated by calculating the editing efficiency (i.e., the ratio of the number of successfully edited embryos to the total number of embryos) and verifying specific editing (i.e., checking whether non-target editing occurs).

[0108] Zebrafish eggs were incubated with Cas9mRNA and Tyr-sgRNA encapsulated by TNP nanocarriers. Figure 5 As shown, after incubation for 72 hours, genomic DNA was extracted for NGS second-generation sequencing, and the sequencing mutation results are shown.

[0109] By performing NGS (next generation sequencing) analysis on zebrafish larvae, the results further revealed that the zebrafish Tyr gene had undergone significant gene editing changes in the target region. Specifically, single base deletions and a large number of SNP (single nucleotide polymorphism) mutations were detected in the target region, indicating that the gene editing tool successfully triggered genetic variation. Analysis data showed that the editing efficiency of the Tyr gene reached 36%, which means that in the analyzed zebrafish larvae, about 36% of the gene sequences underwent the expected editing or mutation. Figure 5 These results indicate that the EGFP-mRNA encapsulated by the TNP nanocarrier not only successfully entered the zebrafish cells and was expressed within the cells, but also was able to effectively induce mutations and deletions at the targeted gene.

[0110] The above embodiments are only used to illustrate the present invention, and the protection scope of the present invention is not limited to the above embodiments. A person skilled in the art can achieve the purpose of the present invention based on the above disclosure of the present invention, and any improvement and deformation based on the concept of the present invention shall fall within the protection scope of the present invention, and the specific protection scope shall be subject to the claims.

Claims

1. A nanocarrier for gene editing of aquatic animals, characterized in that: Includes a) TNP nanoparticles and b) Cas9 mRNA and sgRNA.

2. The nanocarrier for gene editing of aquatic animals according to claim 1, characterized in that: The TNP nanoparticles in a) are prepared by the following method: (1) Maleimidized polyethylene glycol Mal-PEG-OH, lactide D, L-LA and glycolide GA are added to a reaction vessel, a magnetic particle is added and the mixture is heated to 130-150°C in an oil bath, and stirring is continued until all the solids in the reaction vessel are dissolved. Subsequently, stannous isooctanoate Sn(Oct)2 is added dropwise under stirring and the reaction is continued for 2-5 h. After the reaction is completed, the concentrated product is precipitated in a methanol-ether mixture, and filtered and dried to obtain a light yellow Mal-PEG- b -PLGA; (2) Take Mal-PEG- b -PLGA was added to a round-bottom container, and a stirring magnet and dimethyl sulfoxide (DMSO) were added to dissolve Mal-PEG- b -PLGA, then ultrapure water was added under stirring conditions and continued to stir to prepare Mal-NP nanoparticles; (3) The Mal-NP nanoparticles were dialyzed in ultrapure water overnight to remove dimethyl sulfoxide (DMSO). The nanoparticle solution in the dialysis bag was collected and transferred to a round-bottom container. The cell-penetrating peptide TAT was added and stirred for reaction under nitrogen protection. After the reaction, the particle solution was collected and centrifuged. The particle precipitate in the lower layer was collected and freeze-dried to obtain TAT-modified TAT-Mal-NP material, referred to as TNP nanoparticles.

3. The nanocarrier for gene editing of aquatic animals according to claim 2, characterized in that: The molar ratio of maleimidized polyethylene glycol Mal-PEG-OH, lactide D, L-LA and glycolide GA in step (1) is 0.2:10.8~11.5:5.0~5.

2.

4. The nanocarrier for gene editing of aquatic animals according to claim 2, characterized in that: In step (3), the mass ratio of the Mal-NP nanoparticles to the cell-penetrating peptide TAT is 14-16:1.5-2.

5.

5. The nanocarrier for gene editing of aquatic animals according to claim 2, characterized in that: The average particle size of the TNP nanoparticles in step (3) is in the range of 50 to 200 nanometers.

6. Use of the TNP nanoparticle according to any one of claims 1 to 5 as an mRNA delivery carrier.

7. A gene editing method based on the nanocarrier according to any one of claims 1 to 5, characterized in that: The following steps are involved: 1) Preparation of TNP nanoparticles containing Cas9 mRNA and sgRNA; 2) delivering the nanoparticles into embryos of target aquatic animals; 3) Editing the target gene in the embryo.

8. The method according to claim 7, characterized in that The Cas9 mRNA and sgRNA described in step 1) are encapsulated in the TNP nanoparticles by physical adsorption, chemical binding or biocompatible embedding technology.

9. The method according to claim 7, characterized in that: In step 2), the method for delivering the nanoparticles into the embryos of target aquatic animals is immersion, injection or electroporation.

10. The method according to claim 7, characterized in that The target aquatic animal in step 2) is zebrafish or giant tiger prawn.

Images