Preparation method and application of single-chain binding protein

Abstract

The invention provides a preparation method and application of a single-chain binding protein, and relates to the field of protein purification, the preparation method comprises the following steps: (1) affinity chromatography of the single-chain binding protein: using Ni-FF as a filler of a chromatographic column; (2) ion exchange chromatography: using DEAE Sepharose FF as a filler of a chromatographic column; (3) hydrophobic chromatography: using Phenyl-FF as a filler of a chromatographic column; (4) affinity chromatography: using Ni-FF as a filler of a chromatographic column; (5) ion exchange chromatography: using QHP as a filler of a chromatographic column; and (6) molecular sieve chromatography: using Sephadex G-25 as a filler of a chromatographic column. The method can effectively remove nuclease and nucleic acid residues of host cells, and is simple in purification process, low in cost and high in protein purity.

Description

Technical Field

[0001] The invention belongs to the field of protein purification, and specifically relates to a preparation method and application of a single-chain binding protein. Background Art

[0002] Single-stranded DNA-binding protein (SSB), also known as DNA-binding protein, is essential for DNA replication. SSB has multiple functions in DNA replication, including enhancing spiral instability by interacting with DNA helicase, preventing single-strand re-annealing and preventing nuclease digestion; organizing and stabilizing replication origins; primary body assembly; initiation specificity; enhancing replication fidelity; enhancing the continuous synthesis ability of polymerase; and promoting the binding of polymerase to template. Therefore, it is widely used in molecular biology experiments.

[0003] In molecular biology experiments, recombinase polymerase amplification (RPA) technology has gradually made it possible to perform isothermal nucleic acid amplification without the aid of a precision temperature circulation system. Recombinase polymerase amplification technology produces target fragments under isothermal conditions by simulating DNA amplification in vivo. This technology mainly relies on the recombinase UvsX, the single-strand binding protein Gp32, and the strand displacement DNA polymerase Bsu. The recombinase UvsX can unwind double-stranded DNA without heating. At the beginning of the recombinase polymerase amplification reaction, the recombinase UvsX binds to the primer with the participation of ATP to form a nucleic acid protein complex, which can scan the target double-stranded DNA complementary to the primer sequence. Then, the nucleic acid protein complex invades the 5' end site to form a D-shaped loop. The single-strand binding protein Gp32 binds to the displaced single strand to stabilize it. At the same time, the recombinase UvsX leaves the 3' end of the oligonucleotide and is used by the DNA polymerase after degradation. Afterwards, the strand displacement DNA polymerase Bsu binds to the free 3' end of the nucleic acid protein complex to extend the chain and form a new complementary chain. During the chain extension process, the newly synthesized single strand pairs with the original complementary strand. The above steps are repeated to achieve exponential growth of DNA. Recombinase polymerase amplification technology is a new technology that involves multiple enzymes and proteins to achieve exponential amplification of nucleic acids under constant temperature conditions. It is characterized by sensitive response, high efficiency and high cost performance.

[0004] However, nucleic acid residues in single-stranded binding proteins, especially host DNA residues, will interfere with the function of single-stranded binding proteins because they will affect the stability of single-stranded binding proteins and their ability to label single-stranded DNA. Therefore, the level of host DNA residues needs to be extremely low. Nuclease residues may degrade the single-stranded DNA bound by single-stranded binding proteins. For example, in nucleic acid sequence-based amplification (NASBA), an important application of single-stranded binding proteins is to stabilize single-stranded DNA and reduce the reliance on thermal annealing steps in NASBA. If nuclease residues are present, they may degrade single-stranded DNA and affect the stability of GP32, thereby affecting the effectiveness of NASBA or other molecular biology experiments that rely on the stability of single-stranded DNA.

[0005] The existing technology is mainly devoted to increasing the expression amount of single-stranded binding protein in Escherichia coli and improving its purity for wider application. For example, Chinese patent CN108913700A optimizes the coding gene of GP32 according to codon preference, so that GP32 protein can be expressed in large quantities in Escherichia coli, and the purity of the expressed GP32 protein is greater than 95%; Chinese patent CN108559756A provides a preparation method, expression gene and recombinant expression vector of recombinase UvsX, which achieves the technical effect of realizing large-scale soluble expression of recombinase uvsX gene in Escherichia coli, and the purity of the expressed recombinant enzyme UvsX is greater than 95%.

[0006] However, the prior art does not provide any experiments or data related to nucleic acid and nuclease residues. Therefore, it is urgent to develop a method for preparing a single-stranded binding protein without nucleic acid and / or nuclease residues and a corresponding method for detecting nucleic acid and / or nuclease residues. Summary of the invention

[0007] In order to solve the above problems, the present invention provides a method for preparing and using a single-stranded binding protein for efficiently removing residual genomes of host cells.

[0008] In one aspect, the present invention provides a method for preparing a single-chain binding protein.

[0009] Specifically, the purification of the single-stranded binding protein comprises the following steps: (1) Affinity chromatography: using Ni-FF as the filler of the chromatography column; (2) Ion exchange chromatography: DEAE Sepharose FF is used as the filler of the chromatography column; (3) Hydrophobic chromatography: Phenyl-FF is used as the filler of the chromatography column; (4) Affinity chromatography: using Ni-FF as the filler of the chromatography column; (5) Ion exchange chromatography: using QHP as the filler of the chromatography column; (6) Molecular sieve chromatography: Sephadex G-25 is used as the filler of the chromatography column.

[0010] More specifically, the buffer used in the affinity chromatography includes: Ni-binding buffer: 25-75 mM Tris, 0.1-0.5 M NaCl, 5-15 mM imidazole, and 3%-8% glycerol, pH 7.8-8.2; Ni-wash buffer: 25-75 mM Tris, 0.1-0.5 M NaCl, 5-15 mM imidazole, 0.5%-1.5% Triton-X100 and 3%-8% glycerol, pH 7.8-8.2; Ni-elution buffer: 25-75 mM Tris, 0.1-0.5 M NaCl, 400-600 mM imidazole and 3%-8% glycerol, pH 7.8-8.2.

[0011] More specifically, in step (2) and step (5), the buffer used in the ion exchange chromatography includes: IEX-binding buffer: 25-75 mM Tris, 25-75 mM NaCl, 5-15 mM dithiothreitol, and 3%-8% glycerol, pH 6.8-7.2; IEX-elution buffer: 25-75 mM Tris, 400-600 mM NaCl, 5-15 mM dithiothreitol and 3%-8% glycerol, pH 6.8-7.2.

[0012] More specifically, the volume of the filler DEAE Sepharose FF used in the ion exchange chromatography described in step (2) is 100-120 mL.

[0013] More specifically, the volume of the filler material QHP used in the ion exchange chromatography in step (5) is 40-60 mL.

[0014] More specifically, the buffer used in the hydrophobic chromatography in step (3) includes: HIC binding buffer: 25-75 mM Tris and 1.0-1.5 mM ammonium sulfate, pH 7.3-7.7; HIC elution buffer: 25-75 mM Tris, pH 7.3-7.7; HIC wash buffer: 25-75 mM Tris and 40%-60% ethylene glycol, pH 7.3-7.7.

[0015] More specifically, the volume of the Sephadex G-25 filler used in the molecular chromatography described in step (6) is 300-350 mL.

[0016] More specifically, the buffer used in the molecular chromatography in step (6) includes: 1× Storage Buffer: 25-75 mM Tris, 400-600 mM NaCl, 5-15 mM dithiothreitol, and 3%-8% glycerol, pH 6.8-7.2.

[0017] Specifically, the single-chain binding protein is expressed by a host cell.

[0018] More specifically, the host cell includes: Escherichia coli, Bacillus subtilis, lactic acid bacteria, Lactobacillus plantarum, Saccharomyces cerevisiae or Kluyveromyces marxianus.

[0019] More specifically, the vector used to express GP32 includes, but is not limited to, pGEX, pMAL, pTrcHis, pBAD or pQE.

[0020] More specifically, the single-stranded binding protein includes: GP32, UvsX, UvsY, ecSSB or recombinase polymerase amplification.

[0021] In certain specific embodiments of the present invention, the amino acid sequence of GP32 is numbered as YP_007417806.1 in NCBI.

[0022] In certain specific embodiments of the present invention, the amino acid sequence of UvsX is numbered in NCBI: YP_009010227.1.

[0023] On the other hand, the present invention provides the use of the above preparation method in preparing a single-stranded binding protein without residual nuclease and / or residual nucleic acid.

[0024] In yet another aspect, the present invention provides a method for detecting residual nuclease in a single-stranded binding protein.

[0025] Specifically, when the nuclease is a deoxyribonuclease, the probe used is: FAM-GACCTGCTCAGTACGAGAGGACCGCAGGTC-BHQ1; when the nuclease is a ribonuclease, the probe used is: FAM-CGUACCUCAUAGUACG-BHQ1.

[0026] More specifically, the detection method determines the residual state of nuclease according to the amount of probe degradation.

[0027] In certain specific embodiments of the present invention, a probe degradation amount of ≤1 pmol indicates that there is no residual ribonuclease.

[0028] In yet another aspect, the present invention provides a method for detecting residual host cell nucleic acid in a single-stranded binding protein.

[0029] Specifically, the detection method uses primers to amplify the genome of the host cell and determines whether there is residual nuclease based on the amplification situation.

[0030] In certain specific embodiments of the present invention, the method uses primers E. coli 16S rRNA-F (SEQ ID NO.1) and E. coli 16S rRNA-R (SEQ ID NO.2) to perform fluorescent quantitative PCR amplification on E. coli 16S rRNA, and determines the result according to the Ct value.

[0031] SEQ ID NO.1:GGAAGAAGCTTGCTTCTTTGCTGAC; SEQ ID NO. 2: AGCCCGGGGATTTCACATCTGACTTA.

[0032] In certain specific embodiments of the present invention, a Ct value of >35 cycles is judged as no host cell nucleic acid remains.

[0033] Compared with the prior art, the present invention has the following advantages: The technical solution provided by the present invention can effectively remove nucleases and nucleic acid residues of host cells, and the purification process is simple, the cost is low, and the protein purity is high. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 The electrophoresis results of the bacterial quality inspection results in Example 1.

[0035] Figure 2 This is the result of sodium dodecyl sulfate-polyacrylamide gel electrophoresis of GP32 protein in Example 2.

[0036] Figure 3 This is the q-PCR profile for detecting Escherichia coli genome residues in Experimental Example 1.

[0037] Figure 4 These are the experimental results of using recombinase polymerase amplification to amplify influenza B virus in Experimental Example 2.

[0038] Figure 5These are the experimental results of using recombinase polymerase amplification to amplify Bacillus subtilis in Experimental Example 2. DETAILED DESCRIPTION

[0039] The present invention is further described in detail below in conjunction with specific examples. The following examples are not intended to limit the present invention, but are only intended to illustrate the present invention. The experimental methods used in the following examples are generally conventional, unless otherwise specified, and the materials, reagents, etc. used in the following examples are commercially available, unless otherwise specified.

[0040] Example 1 Preparation method of single-chain binding protein The culture medium formula used in this application is shown in Table 1.

[0041] Table 1

[0042] 1. Strain construction (1) Add 1 μL of 10 ng / μL GP32 plasmid to 100 μL of thawed Rosetta (DE3) competent cells, gently stir to mix, and place on ice for 25 min.

[0043] (2) After heat shock in a water bath at 42°C for 45 seconds, quickly place in ice and let stand for 2 minutes.

[0044] (3) Add 700 μL of fresh antibiotic-free LB medium, mix well, and place on a shaker at 37°C, 200 rpm for 60 min.

[0045] (4) Take 200 μL of bacterial solution, gently pipette to resuspend and evenly spread on LB plate containing ampicillin resistance (0.1%), and invert and culture in a constant temperature incubator at 37°C for 16 h.

[0046] 2. Seed solution preparation Pick the monoclonal colonies with normal growth in the plate and put them into 100 mL LB medium, then add ampicillin to a final concentration of 100 mg / L, and culture in a constant temperature shaker at 37°C, 220 rpm, for 16 h.

[0047] 3. Inoculation and fermentation (1) Add 10 L of the prepared fermentation medium into the fermenter, set the temperature to 37 °C, the ventilation volume to 4.5 L / min, 200 rpm, and calibrate the dissolved oxygen value after the dissolved oxygen stabilizes. Add ammonia water and phosphoric acid into the alkali bottle and acid bottle respectively in the clean bench.

[0048] (2) Add 500 mL of the prepared seed solution into the fermentation tank, and then add ampicillin solution to make the final concentration of ampicillin reach 100 mg / L.

[0049] (3) Control pH, temperature and dissolved oxygen conditions during the fermentation process.

[0050] pH control: During the fermentation process, the acid-base pump is adjusted to automatic control and the pH is maintained at around 7.0±0.1 until the end of fermentation.

[0051] Temperature control: The temperature is automatically controlled, the temperature before induction is 37±1℃, and the temperature after induction is 20±1℃.

[0052] Dissolved oxygen control: The dissolved oxygen is set to 30±10%. When the dissolved oxygen is lower than 20%, increase the speed first, then increase the ventilation volume to maintain the dissolved oxygen at 30±10%. When the dissolved oxygen is higher than 40%, reduce the ventilation volume first, then reduce the speed to maintain the dissolved oxygen at 30±10%.

[0053] Feeding: Start feeding when the dissolved oxygen recovers quickly. Use dissolved oxygen feedback feeding method. Add 100mL of feed each time the dissolved oxygen recovers.

[0054] (4) Induction: at OD 600 The induction was started when the value was 15±1, the induction temperature was 20°C, isopropyl-β-D-thiogalactoside was added to a final concentration of 1 mM, and the induction was continued for 9 h.

[0055] (6) Detect and record OD once every hour 600 , record the fermentation inoculation related parameters every two hours.

[0056] 4. Bacteria collection (1) The bacterial solution was centrifuged in a floor centrifuge at 8000 rpm, 15 min, and 4°C.

[0057] (2) After centrifugation, remove the supernatant, scrape the precipitate into a ziplock bag, and weigh and record the net weight of the bacteria after centrifugation.

[0058] (3) The label machine prints labels and sticks them on ziplock bags and production records.

[0059] 5. Crude purification method After high-pressure crushing and high-speed centrifugation, the protein supernatant was purified by Ni column affinity purification, and the impurities were washed with Ni-wash buffer (Ni-wash buffer: 52mM tris(hydroxymethyl)aminomethane, 0.25M sodium chloride, 10mM imidazole, 1% Triton-X100 and 5% glycerol, pH 7.0) for gradient washing. Elution was performed with elution buffer.

[0060] 6. Bacteria quality inspection (1) Prepare samples according to the order and volume in Table 2: Table 2

[0061] Note: Instant protein loading buffer, manufacturer: Yamei, concentration: 5×, product number: L7101S; binding buffer (50mM Tris, 0.25M sodium chloride, 10mM imidazole and 5% glycerol, pH 7.0).

[0062] (2) Add samples and protein molecular weight standards to the sample wells of sodium dodecyl sulfate-polyacrylamide gel electrophoresis, 5 μL for each sample; perform electrophoresis, and then perform staining. After staining, observe the gel run results on the gel imaging system, take photos and save them, and determine the protein molecular weight based on the position of the electrophoresis bands. The electrophoresis results are shown in Figure 1 .

[0063] The quality inspection results are shown in Table 3.

[0064] Table 3

[0065] The quality inspection standards for bacteria are as follows: Protein molecular weight: After the crudely purified single-chain binding protein is subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis, the position distribution of the electrophoretic bands should conform to the theoretical molecular weight of 33 kDa.

[0066] Protein expression: After the single-stranded binding protein expressed by wet bacteria was purified by Ni column, the protein expression amount and wet bacteria mass ratio were calculated. The protein expression amount of each fermentation wet bacteria should be ≥0.5%.

[0067] Figure 1 The experimental results in Table 3 meet the quality inspection standards and can be used for the next experiment.

[0068] Example 2 Single-chain binding protein purification method The reagent formula used in this example is shown in Table 4.

[0069] Table 4 Reagents

[0070]

[0071] 1. Sample processing (1) Weigh X g of GP32 wet bacteria and place them in a beaker; resuspend the wet bacteria in GP32 resuspension buffer and adjust the volume to 10X mL. Stir with a handheld homogenizer until there are no lumps of bacteria. Set the centrifuge parameters: 9000 rpm, 4°C, centrifuge for 20 min, and remove the supernatant.

[0072] (2) Use GP32 Ni-lysis buffer to make the precipitate volume to 4X mL, and stir with a handheld homogenizer until there are no lumps of bacteria; turn on the refrigeration power, refrigeration, and circulation pump buttons of the high-pressure crusher (ATS model: AH-1500) in sequence, and set the refrigeration temperature to 4°C; when the refrigerator temperature reaches 4°C, turn on the high-pressure crusher power supply, clean the high-pressure crusher pipeline with 500±10mL purified water, and set the parameters: speed 50, pressure 0-20 bar; slowly pour the resuspended bacterial solution into the high-pressure crusher sample cup, set the parameters: speed 50, pressure 1000-1200 bar; start crushing and collect the crushed liquid; repeat 10 times until the crushing is completed; (3) Transfer the disrupted bacterial liquid to a 100 mL centrifuge bottle and place it in a high-speed refrigerated centrifuge at 13,000 rpm and 4°C for 30 min. After centrifugation, transfer the supernatant to a clean beaker and stir it magnetically. Slowly add polyethyleneimine to a final concentration of 0.4%. Stir it magnetically for 5 min and then centrifuge it at 12,000 rpm and 4°C for 30 min. (4) Transfer the supernatant from the centrifugation to a new clean beaker and stir it magnetically. Slowly add ammonium sulfate particles (3.61 g / 10 mL). After balancing for 30 minutes, centrifuge at 13,000 rpm for 30 minutes. Remove the supernatant and keep the precipitate. Add 500 mL of ammonium sulfate solution (2.73 M) to the precipitate. After 30 minutes, centrifuge at 13,000 rpm for 30 minutes.

[0073] (5) Remove the supernatant and dissolve the precipitate with 500±50 mL Ni-binding buffer. Centrifuge at 13500 rpm and 4°C for 30 min. Finally, filter with a pore size of 0.45 μm.

[0074] 2. Ni-FF affinity chromatography A BXK50 / 20 chromatography column was used with 130 mL Ni-FF as filler and purified water at a flow rate of 12 mL / min to flush the column for 2 CVs.

[0075] After washing, use Ni-elution buffer at a flow rate of 12 mL / min for 3 CV.

[0076] After washing, the column was equilibrated for 5 CV using Ni-binding buffer at a flow rate of 12 mL / min.

[0077] After the equilibration is completed, the Ni-binding buffer flow rate is set to 0.5 mL / min, and the sample is loaded. After the loading is completed, the Ni-washing buffer is used at a flow rate of 10 mL / min to equilibrate the column for 4 CV, and then the Ni-binding buffer is used at a flow rate of 10 mL / min to equilibrate to the baseline A280. When the baseline A280 detection line is stabilized below 50 mAu, linear gradient elution is performed according to Table 5 (volume ratio): Table 5

[0078] When the A280 detection line rises above 150 mAu, start collecting samples, and when it drops below 150 mAu, stop collecting. The collected liquid is marked as "GP32-His-1".

[0079] Decide whether to keep or discard the forepeak based on the electrophoresis results, and pool all the collected fluids that need to be retained into one tube, labeled "GP32-His-1".

[0080] 3. DEAE Sepharose ion exchange chromatography The collected "GP32-His-1" sample was measured for volume with a measuring cylinder, transferred to a clean beaker, added with a magnetic bar, and placed on a magnetic stirrer.

[0081] The dilution buffer was slowly added dropwise to the "GP32-His-1" sample, the conductivity was adjusted to 10 ms / cm±2 ms / cm, and after equilibrium, it was filtered using a 0.22 μm vacuum filter.

[0082] A BXK26 / 20 chromatography column was used, the filler was 110 mL DEAE, and the column was washed with purified water at a flow rate of 7 mL / min for 2 CV.

[0083] After washing, use IEX-elution buffer at a flow rate of 7 mL / min for 3 CV.

[0084] After washing, a mixture of IEX-binding buffer and IEX-elution buffer with a volume ratio of 9:1 was set at a flow rate of 7 mL / min and balanced for 5 CVs.

[0085] After equilibration, set the IEX-binding buffer flow rate to 0.5 mL / min and load the sample.

[0086] After loading, a mixture of IEX-binding buffer and IEX-elution buffer with a volume ratio of 9:1 was used, the flow rate was set to 10 mL / min, and the balance was performed until the detection line was stabilized below 50 mAu.

[0087] The elution conditions of impurities are shown in Table 6. When the UV detection line rises to 150 mAu, samples are collected in separate tubes, 6 mL per tube. Collection is stopped when the UV detection line drops to 150 mAu. The collected liquid is marked as "GP32-DEAE-1".

[0088] Table 6

[0089] After the elution of impurities was completed, the elution conditions of the target protein were as shown in Table 7. When the UV detection line rose to 150 mAu, samples were collected in separate tubes, 6 mL per tube, and collection was stopped when the UV detection line dropped to 150 mAu. The collected liquid was marked as "GP32-DEAE-2".

[0090] Table 7

[0091] 4. Phenyl-FF hydrophobic chromatography Dithiothreitol was added to the GP32-DEAE-2 sample to a final concentration of 10 mM, and the conductivity was adjusted to 130 ms / cm±5 ms / cm with 3 M ammonium sulfate stock solution before loading.

[0092] A XK26 / 200 mm chromatography column was used, and the filler was 65 mL Phenyl-FF.

[0093] The specific steps are shown in Table 8: Table 8

[0094] (3) Detect each elution peak by electrophoresis and label the collected liquid as “GP32-HIC-1”.

[0095] 5. Ni-FF affinity chromatography After measuring the volume of the collected "GP32-HIC-1" sample with a measuring cylinder, transfer it to a clean beaker, add a magnet, place it on a magnetic stirrer, and slowly add 2 times the volume of Ni-binding buffer of the GP32-HIC-1 sample dropwise to the "GP32-HIC-1" sample and filter it with a 0.22μm vacuum filter.

[0096] A BXK26 / 20 chromatography column was used, the filler was 65 mL Ni-FF, and the purified water flow rate was 7 mL / min. The column was flushed for 2 CVs.

[0097] After washing, Ni-elution buffer was used at a flow rate of 7 mL / min to wash the column for 5 CV.

[0098] After washing, the column was equilibrated with Ni-binding buffer at a flow rate of 7 mL / min for 5 CV.

[0099] After equilibration, the sample was loaded, and after loading, Ni-wash buffer was used at a flow rate of 10 mL / min to equilibrate the column for 4 CV.

[0100] Then use Ni-binding buffer at a flow rate of 10 mL / min and balance until the A280 detection line is stabilized below 50 mAu.

[0101] When the A280 detection line is stable below 50 mAu, linear gradient elution is performed. The elution conditions are shown in Table 9: Table 9

[0102] When the A280 detection line rises, the UV reaches above 150 mAu, and until it drops below 150 mAu, stop collecting. The collected liquid is labeled "GP32-His-2".

[0103] 6. QHP ion exchange chromatography The collected "GP32-His-2" sample was measured for volume with a measuring cylinder, transferred to a clean beaker, added with a magnetic bar, and placed on a magnetic stirrer.

[0104] A dilution buffer 3.5 times the volume of the GP32-His-2 sample was slowly added dropwise to the "GP32-His-2" sample, and after equilibrium, the sample was filtered using a 0.22 μm vacuum filter.

[0105] A BXK26 / 20 chromatography column was used, the filler was 50 mL QHP, the flow rate was 7 mL / min, and the purified water was washed for 2 CV.

[0106] A mixed solution of 90% IEX-binding buffer and 10% IEX-elution buffer by volume was used, the flow rate was set to 7 mL / min, and the equilibrium was 3 CV.

[0107] After equilibration, the flow rate of IEX-binding buffer was set to 0.5 mL / min, and the sample was loaded at a speed of 12 mL / min. After loading, the above mixed solution was used to equilibrate until the detection line was stabilized below 50 mAu.

[0108] Linear gradient elution of impurities: 30% IEX-elution buffer and 4CV, flow rate of 10mL / min, collect samples when the UV detection line rises to 150mAu, 6mL per tube, stop collecting when the UV detection line drops to 150mAu, and mark the collected liquid as "GP32-QHP-1".

[0109] Linear gradient elution of target protein: elution conditions are shown in Table 10: Table 10

[0110] When the UV detection line rises to 150mAu, collect the sample, 6mL per tube, and stop collecting when the UV detection line drops to 150mAu. The collected liquid is marked as "GP32-QHP-2". (The conductivity should be 17mS / cm when the peak begins to appear; the conductivity should be 26mS / cm at the peak tip).

[0111] 7. Sephadex G-25 molecular sieve chromatography Sample processing: The collected liquid of GP32-QHP-2 was concentrated by ultrafiltration membrane pack. The maximum loading volume of a single batch of G-25 molecular sieve chromatography was 50 mL.

[0112] Chromatographic column XK26 / 70mm, filler 330mL Sephadex G-25, purified water, flow rate 10mL / min, flushing 60min.

[0113] 1× storage buffer, flow rate 8mL / min, equilibrate the column for 60min until UV detection and conductivity detection are stable.

[0114] Set the flow rate of 1× storage buffer to 0.5mL / min, load the sample, and change the flow rate to 8mL / min after loading. (The loading volume should not exceed 1 / 4 of the G25 column volume, preferably less than 50mL) When the UV detection line rises, collect 4 mL of sample in each tube. Stop collecting and observe the conductivity peak when the UV detection line drops to equilibrium. The conductivity peak and UV peak should be separated to avoid overlap. The collected liquid is marked as "GP32-G25 enzyme solution".

[0115] 8. GP32-G25 enzyme solution treatment A. Concentration measurement: Take 10 μL of the collected "GP32-G25 enzyme solution" and measure the absorbance at 280 nM using UV spectrophotometry.

[0116] B. Result determination If the concentration of GP32-G25 enzyme solution is greater than 45 mg / mL, take V1 volume of GP32-G25 1× storage buffer to adjust the concentration of "GP32-G25 enzyme solution" to 45±5 mg / mL, perform D test first, and then perform E subpackaging and labeling.

[0117] C×V=C1×(V+V1) (C is the concentration of GP32-G25 enzyme solution, V is the volume of GP32-G25 enzyme solution, V1 is the volume of GP32-G25 1× storage buffer added, and C1 is the target concentration, which is between 45±5 mg / mL) If the concentration of GP32-G25 enzyme solution is between 45±5mg / mL, perform D test first, then perform E subpackaging and labeling; If the concentration of GP32-G25 enzyme solution is less than 40 mg / mL, perform C concentration and then return to A for inspection.

[0118] C. Concentration Membrane package cleaning: Connect the membrane package to the peristaltic pump, set the peristaltic pump speed to 90±20RPM, place the inlet tube in purified water, the reflux tube and the permeate tube in the waste liquid bucket, and start cleaning the membrane package. After the cleaning volume is about 100mL, empty the liquid in the membrane package.

[0119] Protein concentration: Place the inlet and return tubes into the "GP32-G25" to be concentrated at the same time, and place the permeate tube into the waste liquid bucket. Start the peristaltic pump to start concentration. When the concentration reaches 45±5mg / mL of the protein detection concentration of "GP32-G25", stop concentration. Empty the enzyme solution in the membrane package and pipeline. The volume after concentration is calculated according to the following formula C×V= C2×V2 (C is the concentration of GP32-G25 enzyme solution, V is the volume of GP32-G25 enzyme solution, V2 is the volume after concentration, and C2 is the concentration after concentration, which is between 45±5mg / mL) Membrane package cleaning A: Place the inlet tube in purified water, the reflux tube and the permeate tube in the waste liquid, and start cleaning the membrane package. After cleaning 100mL, empty the membrane package liquid.

[0120] Membrane package cleaning B: Place the inlet tube in 20% ethanol, the reflux tube and the permeate tube in the waste liquid, and start cleaning the membrane package. Stop sealing after cleaning 50mL and store the membrane package at 2-8℃.

[0121] D. Repackaging and labeling Disinfect the clean bench with 75% ethanol, and then sterilize with UV light for 20-25 minutes. Pack according to Table 11: Table 11

[0122] Example 3 Purification of UvsX recombinase The difference between the strain construction steps and those in Example 1 is that the plasmid transferred into E. coli is a plasmid carrying the UvsX recombinase encoding gene.

[0123] The purification steps are the same as in Example 2.

[0124] Comparative Example 1 The difference from Example 2 is that the hydrophobic chromatography step is omitted.

[0125] Experimental Example 1 Detection Method 1. Molecular weight and purity of target protein Quality standard: The finished single-chain conjugated protease solution is subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis and the protein purity is obtained by grayscale analysis. The protein purity is required to be ≥95%.

[0126] Steps: (1) Take a 1.5 mL centrifuge tube and dilute all the enzymes to be tested to 1 mg / mL with binding buffer according to the protein concentration of the enzyme to be tested; (2) Take another 1.5 mL centrifuge tube, add 15 μL of 5× instant protein loading buffer and then add 15 μL of 1 mg / mL diluted protein; (3) Centrifuge the tubes containing the samples separately to mix them evenly, heat them in a metal bath at 100°C for 5 min, and centrifuge them for later use; (4) Remove the seal from the bottom of the sodium dodecyl sulfate-polyacrylamide gel electrophoresis gel, fix it to the plate clamp, and place it in the electrophoresis tank. Fill the plate clamp with 1× glycine buffer. After confirming that there is no leakage, add 1× glycine buffer to the electrophoresis tank so that the liquid level is lower than the liquid level in the plate clamp. (5) Add samples to the sample wells of sodium dodecyl sulfate-polyacrylamide gel electrophoresis gel, add 5 μL of protein molecular weight standard to lane 1, and add 2 replicate wells of the samples to be tested to lanes 2-3. The sample volume of each sample to be tested is 10 μL, and the sample amount is 5 μg; (6) Cover the electrophoresis tank, turn on the power switch of the electrophoresis instrument, set the electrophoresis voltage to 140V, and the time to 45min; (7) After the electrophoresis is completed, peel off the gel in water and place it on the sample holder. After covering it with sealing tape, place the sample holder on the staining instrument for staining.

[0127] (8) After staining, observe the gel run results on a chemiluminescence imaging analysis system and take photos for grayscale analysis.

[0128] The experimental results are shown in Figure 2 ,from Figure 2 It can be seen that the molecular weight and protein purity of the target protein purified according to the method of Example 2 are in line with expectations and can be used for the next test.

[0129] 2. Deoxyribonuclease (DNase) residues Quality standard: The degradation amount of the probe in the reaction system of the sample to be tested is detected by the fluorescent probe method. The detection conditions and test results are shown in Table 12: Table 12

[0130] Steps: (1) Probe dilution: The probe sequence was synthesized by Genewise Biotechnology Co., Ltd. The synthetic sequence information is shown in Table 13: Table 13

[0131] The working concentration of the probe for nuclease residue detection is 10 μM.

[0132] (2) Dilution of the sample to be tested For all samples to be tested, 2 μL was taken and diluted to 1 μg / μL or 1 U / μL using DNase I reaction buffer (NEB, B0303SVIAL) according to their detection concentration. After vortex mixing and centrifugation, the samples were placed in an ice box (or on ice) for later use.

[0133] (3) Preparation of reaction system Take a 1.5mL centrifuge tube and prepare the reaction solution according to Table 14: Table 14

[0134] (4) Reaction system packaging and sample addition After the prepared reaction solution is mixed and centrifuged, it is dispensed into a 96-well white opaque ELISA plate, 95 μL per well. 5 μL of the diluted DNase I positive control, the diluted test sample, and the blank control (10× DNase I reaction buffer) are added to the corresponding wells, and each sample is repeated 3 times.

[0135] The reaction system should be prepared on ice throughout the process and kept at a low temperature.

[0136] (5) Reaction program setting Cover the plate, mix well, centrifuge, and react on the plate (the plate reader can be preheated in advance). The reaction program is set as follows: gain setting 35%, incubation at 37℃ for 240min, and fluorescence acquisition every 5min.

[0137] (6) Data processing Take the last fluorescence value of each reaction three-well as the calculation data, calculate the average value of the three-well positive control, test sample, and negative control, and calculate the K value of the test sample according to the following formula:

[0138] A1 is the fluorescence value generated by the deoxyribonuclease I positive control, i.e., the positive fluorescence value; A0 is the fluorescence value produced by the blank control, i.e., the negative fluorescence value; A2 is the fluorescence value produced by the sample; K is the residual value of deoxyribonuclease.

[0139] The default positive control deoxyribonuclease I degrades all 5 pmol of the probe in the reaction system, and the K value is 100%. The degradation amount of the probe in the sample to be tested in the reaction system is calculated based on the K value of the sample to be tested, and the probe degradation amount is required to meet the quality standard.

[0140] The results of the residual deoxyribonuclease of the single-stranded binding protein GP32 purified in Example 2 are shown in Table 15, and the results of the residual deoxyribonuclease of the single-stranded binding protein GP32 purified in Comparative Example 1 are shown in Table 16.

[0141] Table 15

[0142] Table 16

[0143] It can be seen from Tables 15-16 that the method of the present invention can effectively remove the deoxyribonuclease residues in the single-stranded binding protein.

[0144] The results of residual deoxyribonuclease of the purified single-stranded binding protein UsvX in Example 3 are shown in Table 17.

[0145] Table 17

[0146] It can be seen from Table 17 that the method of the present invention can effectively remove the deoxyribonuclease residues in the UsvX single-stranded binding protein.

[0147] 3. Residual ribonuclease Quality standard: By using the fluorescent probe method, the degradation amount of the probe in the reaction system of the sample to be tested is calculated to be ≤1pmol, indicating that the residual ribonuclease in the sample to be tested is qualified.

[0148] Steps: (1) Probe dilution: The probe sequence was synthesized by Shanghai Langjing Biotechnology Co., Ltd. and purified by high performance liquid chromatography. The 5' end was modified with FAM fluorescence and the 3' end was modified with BHQ1 fluorescence. The synthetic sequence information is shown in Table 18: Table 18

[0149] The working concentration of the probe for residual RNase detection was 50 μM.

[0150] (2) Dilution of the sample to be tested For all samples to be tested, take 2 μL of the sample according to their detection concentration and dilute it to 1 mg / mL using 10× RNase reaction buffer. Vortex and centrifuge, and place it in an ice box (or on ice) for later use.

[0151] (3) Dilution of RNase A positive control Take a 1.5mL centrifuge tube, place it on ice, add 495μL 10× RNase reaction buffer, take 5μL RNase A stock solution and add it to the centrifuge tube, pipette 3 times, vortex mix and centrifuge, then place it on ice. The concentration is 100ng / μL and is marked as S1. Take a 1.5 mL centrifuge tube, place it on ice, add 495 μL 10× RNase reaction buffer, take 5 μL S1 and add it to the centrifuge tube, pipette it 3 times, vortex and centrifuge it, and place it on ice. The concentration is 1 ng / μL and is marked as S2. Take a 1.5mL centrifuge tube, place it on ice, add 10μL 10× RNase reaction buffer, take 6μL S2 and add it to the centrifuge tube, pipette 3 times, vortex mix and centrifuge, mark it as S3, which is the prepared RNase A positive control, and place it on ice for later use.

[0152] Note: The positive control should be prepared freshly each time.

[0153] (4) Preparation of reaction system Take a 1.5mL centrifuge tube and prepare the reaction solution according to Table 19: Table 19

[0154] (5) Reaction system packaging and sample addition After the prepared reaction solution is mixed and centrifuged, it is dispensed into a 96-well white opaque ELISA plate, 75 μL per well. 5 μL of diluted RNase A as a positive control, diluted test sample, and blank control DNase I reaction buffer are added to the corresponding wells, and each sample is repeated 3 times.

[0155] (6) On-machine reaction Cover the ELISA plate, mix well, centrifuge, and react on the reaction machine. The reaction program is set as follows: gain setting 30%, incubation at 37℃ for 180min, and fluorescence acquisition every 2min.

[0156] (7) Data processing Take the last fluorescence value of each three-well reaction as the calculation data, and calculate the coefficient of variation of the three-well positive control, test sample, and negative control, respectively. The coefficient of variation is required to be ≤10%; Calculate the K value of the sample to be tested according to the following formula:

[0157] A1 is the average fluorescence value produced by the RNase A positive control, i.e., the positive fluorescence value; A0 is the average fluorescence value produced by the blank control, i.e., the negative fluorescence value; A2 is the average fluorescence value produced by the sample; K is the residual value of ribonuclease.

[0158] The default positive control ribonuclease A degrades all 25pmoL of the probe in the reaction system, and the K value is 100%. Based on the K value of the sample to be tested, the degradation amount of the probe in the reaction system can be calculated, and the probe degradation amount is required to be ≤1pmoL.

[0159] The experimental results of the GP32 protein purified in Example 2 are shown in Table 20, and the experimental results of the GP32 protein purified in Comparative Example 1 are shown in Table 21.

[0160] Table 20

[0161] Table 21

[0162] It can be seen from Tables 20-21 that purification according to the method of Example 2 can effectively remove the ribonuclease residues in the GP32 single-stranded binding protein.

[0163] 4. E. coli genome residues Quality standard: Use 5 μg GP32 as template, 25 μL reaction system, fluorescent quantitative PCR amplification for 40 cycles, detect Escherichia coli 16s DNA, and the Ct value should be greater than 35 in the absence of host genome.

[0164] Steps: Prepare the PCR reaction system, use 1×TE buffer 10μM primers, and prepare the PCR reaction system with the extracted DNA sample solution. The components required for each 25μL PCR reaction system are shown in Table 22: Table 22

[0165] (2) Prepare a PCR reaction mixture without DNA template, add 24 μL of PCR mixture to each well of a 96-well reaction plate, and then pipette 1 μL of nuclease-free water, DNA sample, and enzyme sample to be tested to each well of the 96-well reaction plate. Perform 3 replicates for each sample. Take another 25 μL of nuclease-free water and perform 3 replicates for the negative control.

[0166] (3) After covering the 96-well reaction plate with an optical cover film, gently shake and mix, and quickly centrifuge for a short time to remove bubbles. Place the reaction plate in a fluorescent quantitative PCR instrument to run the reaction, set the parameters as shown in Table 23, and set the two-step reaction program.

[0167] Table 23

[0168] Data collection was performed during the annealing extension phase.

[0169] Data processing: The highest point of the negative control fluorescence value was used as the fluorescence threshold.

[0170] The experimental results of the purified GP32 protein obtained in Example 2 are shown in Tables 24 and Figure 3 .

[0171] Table 24

[0172] The experimental results show that the method of the present invention can effectively remove the host cell nucleic acid residues in the single-stranded binding protein.

[0173] Experimental Example 2 Functional detection of GP32 purified by the method of the present invention Using the purified GP32 of the present invention, the recombinase polymerase amplification technology was applied to perform isothermal amplification of influenza B virus. The DNA fluorescence isothermal amplification reaction system is shown in Table 25, and the amplification conditions are shown in Table 26.

[0174] Table 25

[0175] Table 26

[0176] The amplification results are as follows Figure 4 As shown, it is explained that the use of the purified GP32 of the present invention can effectively achieve isothermal amplification of influenza B virus.

[0177] Using the purified GP32 of the present invention, the recombinase polymerase amplification technology was applied to perform isothermal amplification on Bacillus subtilis. The DNA fluorescence isothermal amplification reaction system is shown in Table 27; the isothermal amplification reaction conditions are shown in Table 28.

[0178] Table 27

[0179] Table 28

[0180] Specific results such as Figure 5 As shown, the experimental results indicate that the use of the purified GP32 of the present invention can effectively achieve isothermal amplification of Bacillus subtilis.

[0181] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, rather than to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions of the technical solution of the present invention by ordinary technicians in this field do not deviate from the essence and scope of the technical solution of the present invention.

Claims

1. A method for preparing a single-stranded binding protein, characterized in that: The purification of the single-stranded binding protein comprises the following steps: (1) Affinity chromatography: using Ni-FF as the filler of the chromatography column; (2) Ion exchange chromatography: DEAE Sepharose FF is used as the filler of the chromatography column; (3) Hydrophobic chromatography: Phenyl-FF is used as the filler of the chromatography column; (4) Affinity chromatography: using Ni-FF as the filler of the chromatography column; (5) Ion exchange chromatography: using QHP as the filler of the chromatography column; (6) Molecular sieve chromatography: Sephadex G-25 is used as the filler of the chromatography column.

2. The preparation method according to claim 1, characterized in that: In step (1) and step (4), the buffer used in the affinity chromatography includes: Ni-binding buffer: 25-75 mM Tris, 0.1-0.5 M NaCl, 5-15 mM imidazole, and 3%-8% glycerol, pH 7.8-8.2; Ni-wash buffer: 25-75 mM Tris, 0.1-0.5 M NaCl, 5-15 mM imidazole, 0.5%-1.5% Triton-X100, and 3%-8% glycerol, pH 7.8-8.2; Ni-elution buffer: 25-75 mM Tris, 0.1-0.5 M NaCl, 400-600 mM imidazole, and 3%-8% glycerol, pH 7.8-8.2; The volume of Ni-FF filler in step (1) is 120-150 mL: The volume of the Ni-FF filler in step (4) is 60-70 mL.

3. The preparation method according to claim 1, characterized in that: In step (2) and step (5), the buffer used in the ion exchange chromatography includes: IEX-binding buffer: 25-75 mM Tris, 25-75 mM NaCl, 5-15 mM DTT, and 3%-8% glycerol, pH 6.8-7.2; IEX-Elution Buffer: 25-75 mM Tris, 400-600 mM NaCl, 5-15 mM DTT, and 3%-8% glycerol, pH 6.8-7.

2.

4. The preparation method according to any one of claims 1 or 3, characterized in that The volume of the filler DEAE Sepharose FF in step (2) is 100-120 mL.

5. The preparation method according to any one of claims 1 or 3, characterized in that: The volume of the filler QHP described in step (5) is 40-60 mL.

6. The preparation method according to claim 1, characterized in that: The buffer used in the hydrophobic chromatography described in step (3) includes: HIC binding buffer: 25-75 mM Tris and 1.0-1.5 mM ammonium sulfate, pH 7.3-7.7; HIC elution buffer: 25-75 mM Tris, pH 7.3-7.7; HIC Wash Buffer: 25-75 mM Tris and 40%-60% ethylene glycol, pH 7.3-7.

7.

7. The preparation method according to claim 1, characterized in that: The volume of the Sephadex G-25 filler described in step (6) is 300-350 mL.

8. The preparation method according to claim 1, characterized in that: The buffer used in the molecular chromatography described in step (6) includes: 1× Storage Buffer: 25-75 mM Tris, 400-600 mM NaCl, 5-15 mM DTT, and 3%-8% glycerol, pH 6.8-7.

2.

9. The preparation method according to claim 1, characterized in that: The single-chain binding protein is expressed by a host cell.

10. The preparation method according to claim 9, characterized in that: The host cells include: Escherichia coli, Bacillus subtilis, lactic acid bacteria, Lactobacillus plantarum, Saccharomyces cerevisiae or Kluyveromyces marxianus.

11. The preparation method according to claim 10, characterized in that: The following steps are also included: S1: fermentation; S2: bacterial collection; S3: bacterial quality inspection; S4: Bacteria treatment: After the bacteria are broken, the collected bacteria are treated with polyethyleneimine PEI precipitation and ammonium sulfate graded precipitation.

12. The preparation method according to claim 1, characterized in that: The single-chain binding protein includes: GP32, UvsX, Uvs Y, ecSSB or RPA.

13. Use of the preparation method according to any one of claims 1 to 12 in preparing a single-stranded binding protein free of nuclease residues and / or nucleic acid residues.

14. A method for detecting residual nuclease in a single-stranded binding protein prepared by the preparation method according to any one of claims 1 to 12.

15. The detection method according to claim 14, characterized in that: When the nuclease is deoxyribonuclease, the degradation amount of the probe FAM-GACCTGCTCAGTACGAGAGGACCGCAGGTC-BHQ1 is ≤1 pmol, indicating that there is no deoxyribonuclease residue.

16. The detection method according to claim 14, characterized in that: When the nuclease is ribonuclease, the degradation amount of the probe FAM-CGUACCUCAUAGUACG-BHQ1 is ≤1 pmol, indicating that there is no ribonuclease residue.

17. A method for detecting residual host cell nucleic acid in a single-stranded binding protein, characterized in that: Primers SEQ ID NO.1-2 were used for fluorescence quantitative PCR amplification. If the Ct value was greater than 35 cycles, no host cell nucleic acid remained.

Images