Pediococcus pentosaceus CCFM1402 capable of effectively repairing skin barrier and self-fermentation metabolite of Pediococcus pentosaceus CCFM1402

Abstract

The invention discloses pediococcus pentosaceus CCFM1402 capable of effectively repairing a skin barrier and a self-fermentation metabolite of the pediococcus pentosaceus CCFM1402, and belongs to the technical field of microorganisms and medicines. The pediococcus pentosaceus CCFM1402 provided by the invention has the effect of improving the skin barrier function in both external use and oral administration; the cell activity of damaged HaCaT cells and the expression of the gene level of skin barrier function protein and tight junction protein can be improved by virtue of a thallus lysate and a fermented supernatant (metagen) of the external pediococcus pentosaceus CCFM1402; and the DNFB-induced mouse skin barrier injury can be relieved in the aspects of appearance, skin barrier protein expression and the like by orally taking viable bacteria and postbiotics of the pediococcus pentosaceus CCFM1402. Therefore, the pediococcus pentosaceus CCFM1402 has a huge application prospect in preparation of external or oral medicines for repairing the skin barrier and preparation of food, health care products or cosmetics.

Description

Technical Field

[0001] The invention relates to a Pediococcus pentosaceus CCFM1402 and its self-fermentation metabolites which are effective in repairing skin barriers, and belongs to the technical field of microorganisms and the technical field of medicine. Background Art

[0002] Human skin acts as a barrier between the body and the external environment, preventing the entry of pathogenic organisms and foreign matter. Damage to the skin barrier is at the root of many common skin diseases, which are intricately linked. Environmental insults, genetic or inflammatory factors can impair the skin barrier, leading to increased transepidermal water loss. The epidermis is composed of basal keratinocytes, which are highly proliferative and differentiate as they migrate toward the skin surface. This differentiation is characterized by the orderly expression of specific proteins, intercellular junctional complexes, lipids, and proteases / antiproteases. The lipid / protein ratio in the stratum corneum, as well as the thickness of the stratum corneum, are thought to play a role in the skin barrier function (i.e., TEWL).

[0003] There are many inventions for directly synthesizing and adding related substances to improve the barrier function for the improvement of skin barrier function. For example, CN118085020A discloses a cyclic tripeptide with soothing effect and a preparation method. This peptide has a stronger ability to inhibit the activity of hyaluronidase, promotes the gene expression of skin barrier repair-related filaggrin and tight junction protein 1, and effectively enhances the skin barrier function. CN118255862A discloses a recombinant humanized filaggrin and its preparation method and application. Although the use of synthetic substances such as cyclic tripeptides and recombinant humanized filaggrin to improve the skin barrier is effective, there are defects that are difficult to overcome. First, the skin permeability of these macromolecular substances is poor, and it is difficult to penetrate into the skin layer. Secondly, the action time is short and it depends on continuous use to maintain the effect. Different individuals also have different reactions to exogenous substances, which may cause allergies and other problems. In addition, relying on external synthetic substances may interfere with the self-repair mechanism of the skin and cannot truly stimulate the intrinsic repair ability of the skin. In contrast, the technical solution using postbiotics can promote skin self-repair by regulating the skin microecology, and has good biocompatibility and safety. Postbiotics have a smaller molecular structure and can act more deeply into the skin, helping to restore the balance of skin flora, enhance the barrier function, and provide a more stable and long-term repair effect. Therefore, providing a microorganism or its postbiotic that helps repair the skin barrier is of great significance for stimulating the skin's self-repair ability and maintaining the skin's health. Summary of the invention

[0004] The invention provides application of Pediococcus pentosaceus CCFM1402 and postbiotics thereof in preparing a product for repairing skin barrier.

[0005] The invention provides a Pediococcus pentosaceus CCFM1402, which is preserved in Guangdong Province Microbiological Culture Collection Center with a preservation number of GDMCC No: 65087.

[0006] The Pediococcus pentosaceus CCFM1402 was derived from the feces of healthy people. The strain was sequenced and analyzed, and the obtained sequence was compared with the nucleic acid sequence in NCBI. The result showed that it was Pediococcus pentosaceus, and was named Pediococcus pentosaceus CCFM1402.

[0007] The colonies of Pediococcus pentosaceus CCFM1402 on the MRS solid culture medium are raised, white, smooth and round.

[0008] The present invention also provides a microbial preparation containing the Pediococcus pentosaceus CCFM1402, wherein the content of the Pediococcus pentosaceus CCFM1402 in the microbial preparation is ≥1×10 6 CFU / mL or 1×10 6 CFU / g.

[0009] The present invention also provides a postbiotic prepared by applying the Pediococcus pentosaceus CCFM1402.

[0010] In one embodiment, the postbiotics include bacterial lysate, killed or inactivated cells, fermentation supernatant, or any of the above powders prepared by drying.

[0011] In one embodiment, the inactivated or inactivated cells are prepared as follows: the Pediococcus pentosaceus CCFM1402 is cultured in a culture medium for a period of time, bacterial cells in the cell culture fluid are collected, and inactivated bacterial cells are obtained after heat treatment.

[0012] In one embodiment, the heat treatment conditions are: 65° C., 30 min.

[0013] In one embodiment, the method for preparing the bacterial lysate is: culturing the Pediococcus pentosaceus CCFM1402 in a culture medium for a period of time, collecting bacterial cells, high-pressure homogenizing, and obtaining the bacterial lysate from the supernatant of the centrifugation.

[0014] In one embodiment, the fermentation supernatant is the supernatant obtained by culturing Pediococcus pentosaceus CCFM1402 in a culture medium for a period of time and then centrifuging the culture medium.

[0015] The present invention also provides a composition containing the Pediococcus pentosaceus CCFM1402 and / or its postbiotics.

[0016] In one embodiment, the composition includes but is not limited to food, medicine, health care product or daily chemical product.

[0017] In one embodiment, the daily chemical products include skin care products, cosmetics or toiletries; the medicines include smear-type medicines or oral medicines.

[0018] In one embodiment, the food comprises the above composition and conventional auxiliary materials.

[0019] In one embodiment, the conventional auxiliary materials include one or more of fillers, flavoring agents, binders, disintegrants, lubricants, antacids, and nutritional enhancers.

[0020] In one embodiment, the health care product comprises the above composition and conventional auxiliary materials.

[0021] In one embodiment, the conventional auxiliary materials include one or more of fillers, flavoring agents, binders, disintegrants, lubricants, antacids, and nutritional enhancers.

[0022] In one embodiment, the composition is a probiotic powder.

[0023] In one embodiment, the bacterial powder is a solid powder postbiotic prepared by drying the prepared liquid postbiotic of Pediococcus pentosaceus CCFM1402.

[0024] In one embodiment, drying includes but is not limited to spray drying, vacuum freeze drying, fluidized bed drying, vacuum drying preparation.

[0025] The present invention also provides application of the composition in preparing products for repairing skin barrier or skin damage.

[0026] In one embodiment, the product comprises at least one of the following effects:

[0027] (1) Improve the cell viability of skin keratinocytes (HaCaT) damaged by sodium dodecyl sulfate (SDS) in vitro;

[0028] (2) Improve the barrier function and structural protein expression of skin keratinocytes (HaCaT) damaged by sodium dodecyl sulfate (SDS) in vitro;

[0029] (3) Reduce the manifestations of skin barrier damage in individuals (blood biochemical indicators, skin appearance);

[0030] (4) Increase the barrier function and structural proteins of individual skin tissue;

[0031] (5) Increase basement membrane protein in individual skin tissue;

[0032] (6) Reduce the individual's inflammatory response.

[0033] In one embodiment, the symptoms associated with skin barrier disruption include increased skin appearance, skin proteins, and inflammatory factors in the blood.

[0034] In one embodiment, the skin damage comprises skin dryness, decreased elasticity, sagging, wrinkles, oxidative damage, and protein loss.

[0035] In one embodiment, the application method includes topical application and oral administration.

[0036] In one embodiment, the content of Pediococcus pentosaceus CCFM1402 in the product is not less than 1×10 7 CFU / mL.

[0037] In one embodiment, the dosage of postbiotics prepared by Pediococcus pentosaceus CCFM1402 in the product is not less than 1510 μg / kg body weight.

[0038] In one embodiment, the product is a medicine or a cosmetic.

[0039] In one embodiment, the medicine comprises the Pediococcus pentosaceus CCFM1402, a drug carrier and / or a pharmaceutical excipient.

[0040] In one embodiment, the pharmaceutical excipient comprises an excipient and an additive.

[0041] In one embodiment, the pharmaceutical excipients include solvents, propellants, solubilizers, cosolvents, emulsifiers, colorants, binders, disintegrants, fillers, lubricants, wetting agents, osmotic pressure regulators, stabilizers, glidants, flavoring agents, preservatives, suspending agents, coating materials, fragrances, anti-adhesive agents, integrities, penetration enhancers, pH regulators, buffers, plasticizers, surfactants, foaming agents, defoamers, thickeners, inclusion agents, humectants, absorbents, diluents, flocculants and deflocculating agents, filter aids and release retardants.

[0042] In one embodiment, the cosmetic contains Pediococcus pentosaceus CCFM1402, matrix raw materials and / or conventional excipients.

[0043] In one embodiment, the matrix raw materials include oil raw materials, wax raw materials, synthetic oil raw materials, powdery raw materials, colloid raw materials, coagulants, and surfactants.

[0044] In one embodiment, the conventional auxiliary materials include one or more of moisturizers, whitening agents, flavoring agents, adhesives, lubricants, preservatives, film agents, antioxidants, emulsifiers, and cosmetic nutritional additives.

[0045] The present invention also provides application of the Pediococcus pentosaceus CCFM1402 in food production.

[0046] The present invention also provides the use of the Pediococcus pentosaceus CCFM1402 or the microbial preparation or the postbiotic in preparing daily chemical products for improving skin hydration.

[0047] Beneficial effects:

[0048] The Pediococcus pentosaceus CCFM1402 and the postbiotics prepared therefrom of the present invention have the ability to alleviate skin barrier damage and increase the expression of related proteins for external and oral use, which is specifically embodied in:

[0049] (1) Improve the cell activity of skin keratinocytes (HaCaT) damaged by sodium dodecyl sulfate (SDS);

[0050] (2) In vitro, the mRNA expressions of FLG, IVL, LOR, ZO-1, Occludin, and CLDN in skin keratinocytes (HaCaT) damaged by sodium dodecyl sulfate (SDS) were increased;

[0051] (3) increase the levels of skin barrier function proteins (FLG, LOR, and IVL) in individuals with skin barrier damage;

[0052] (4) increase the levels of skin barrier structural proteins (ZO-1, OCCLUDIN, and CLDN) in individuals with skin barrier damage;

[0053] (5) Enhance the basement membrane barrier effect in individuals with skin barrier damage;

[0054] (6) Repair the skin appearance of individuals with skin barrier damage;

[0055] (7) Reduce the inflammatory response caused by individuals with skin barrier damage.

[0056] Therefore, postbiotics prepared from Pediococcus pentosaceus CCFM1402 have great application prospects in products that alleviate host skin barrier damage.

[0057] Biomaterial Deposit

[0058] Pediococcus pentosaceus CCFM1402, taxonomically named Pediococcus pentosaceus, was deposited in Guangdong Provincial Microbiological Culture Collection Center on September 2, 2024, with the deposit number GDMCC No: 65087, and the deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou. BRIEF DESCRIPTION OF THE DRAWINGS

[0059] Figure 1 :Evaluation of the effects of different concentrations of SDS on HaCaT cell damage;

[0060] Figure 2 :Effects of different postbiotics on the proliferation of HaCaT cells;

[0061] Figure 3 :The effects of different postbiotics on the viability of HaCaT cells after SDS injury;

[0062] Figure 4 :Different postbiotics repair the barrier function and structural protein gene expression of HaCaT cells after SDS injury;

[0063] Figure 5 :Receptors for the onset pathway of postbiotic repair effects of Pediococcus pentosaceus CCFM1402;

[0064] Figure 6 :Animal experiment procedures;

[0065] Figure 7 :Effects of Pediococcus pentosaceus CCFM1402 and its prepared postbiotics on barrier function proteins in mouse skin tissue;

[0066] Figure 8 :Effects of Pediococcus pentosaceus CCFM1402 and its prepared postbiotics on barrier structural proteins in mouse skin tissue;

[0067] Fig. 9 :Effects of Pediococcus pentosaceus CCFM1402 and its postbiotics on the expression of barrier protein genes in the basal layer of mouse skin;

[0068] Fig.10 :Effects of Pediococcus pentosaceus CCFM1402 and its prepared postbiotics on TEWL and stratum corneum water content of mouse skin tissue;

[0069] Fig.11 :Effects of Pediococcus pentosaceus CCFM1402 and its prepared postbiotics on inflammation in mouse skin tissue and serum;

[0070] Fig.12 :Pathway receptors through which Pediococcus pentosaceus CCFM1402 and postbiotics prepared from it act on repairing the skin barrier.

[0071] “*” indicates statistical difference compared with the Model group (P<0.05), “**” indicates significant statistical difference compared with the Model group (P<0.01), “***” indicates extremely significant statistical difference compared with the Model group (P<0.001); “****” indicates extremely significant statistical difference compared with the Model group (P<0.0001). DETAILED DESCRIPTION

[0072] The present invention will be further described below in conjunction with specific embodiments.

[0073] The human keratinocytes (HaCaT) involved in the following examples were purchased from Shanghai Cell Bank.

[0074] The BALB / c mice involved in the following examples were purchased from Vital River Company.

[0075] The Pediococcus pentosaceus FWXBH44M2, Pediococcus pentosaceus FCQNA17L4, Pediococcus pentosaceus VCQYC5144M12, Pediococcus pentosaceus FWXBH2M1 and Pediococcus pentosaceus CCFM1402 involved in the following examples are strains screened by the Food Biotechnology Center of Jiangnan University.

[0076] The culture medium involved in the following examples is as follows:

[0077] Improved MRS liquid medium: yeast powder 5.0 g / L, peptone 10.0 g / L, glucose 20.0 g / L, anhydrous sodium acetate 2.0 g / L, diammonium hydrogen citrate 2.0 g / L, dipotassium hydrogen phosphate 2.6 g / L, manganese sulfate monohydrate 0.25 g / L, magnesium sulfate heptahydrate 0.5 g / L and Tween-80 1 mL / L, pH 6.2-6.4.

[0078] Improved MRS solid medium: yeast powder 5.0 g / L, peptone 10.0 g / L, glucose 20.0 g / L, anhydrous sodium acetate 2.0 g / L, diammonium hydrogen citrate 2.0 g / L, dipotassium hydrogen phosphate 2.6 g / L, manganese sulfate monohydrate 0.25 g / L, magnesium sulfate heptahydrate 0.5 g / L, Tween-80 1 mL / L and agar 20.0 g / L, pH 6.2-6.4.

[0079] Cell culture medium: 89% (v / v) DMEM medium + 10% (v / v) fetal bovine serum + 1% (v / v) 100× penicillin and streptomycin mixed solution (the penicillin content in the mixed solution is 10000 U / mL, and the streptomycin concentration is 10 mg / mL).

[0080] The cell recovery and culture methods involved in the following examples are as follows:

[0081] First, take out the frozen human keratinocyte cell line (HaCaT) from the -80℃ refrigerator, thaw quickly in a 37℃ water bath, then add 5mL of cell culture medium and centrifuge at 1000r / min for 3min, discard the supernatant. Add 1mL of cell culture medium to resuspend the cells and place them in a culture dish, and place them in a 37℃ incubator containing 5% CO2 for culture. When the cells regain vitality and grow for 1 to 2 days to reach 70% to 80% fusion, cell passage is performed.

[0082] Example 1: Preparation of postbiotics by Pediococcus pentosaceus CCFM1402

[0083] 1. Screening and identification of Pediococcus pentosaceus CCFM1402

[0084] The strain sample screening was derived from the feces of healthy people. After pretreatment, it was stored in a -80°C refrigerator in 20% glycerol. After being taken out and thawed, it was mixed and 0.5 mL of the sample was taken and added to 4.5 mL of normal saline. The normal saline was used for gradient dilution. The appropriate gradient dilution solution was selected and coated on MRS solid medium. It was cultured at 37°C for 48 hours, and typical colonies of Pediococcus pentosaceus were picked and streaked on MRS solid medium for purification. Single colonies were picked and transferred to MRS liquid medium for bacterial enrichment and preserved in 30% glycerol to obtain strains. The strain genome was extracted for 16S rDNA amplification and sequencing (performed by Suzhou Jinweizhi Biotechnology Co., Ltd.). The results were determined to be Pediococcus pentosaceus through NCBI sequence alignment and named Pediococcus pentosaceus CCFM1402. The Pediococcus pentosaceus CCFM1402 has been deposited in Guangdong Provincial Microbiological Culture Collection Center with a deposit number of GDMCC No: 65087.

[0085] 2. Preparation of postbiotics by Pediococcus pentosaceus CCFM1402

[0086] (1) streaking Pediococcus pentosaceus CCFM1402 from a bacterial preservation tube, culturing in a 37°C water-tight constant temperature incubator using a modified MRS solid medium for 48 hours to obtain a single colony; picking a single colony and inoculating it into a modified MRS liquid medium, culturing at 37°C for 12-18 hours, and obtaining a culture solution 1;

[0087] The culture solution 1 was inoculated into the modified MRS liquid medium at an inoculum volume of 2% (v / v), and cultured at 37° C. for 12 h to obtain a seed solution;

[0088] The seed solution was inoculated into the improved MRS liquid medium at 2% (v / v) for expansion and cultured at 37°C for 18 hours. The number of viable bacteria was recorded and the bacterial solution a was obtained.

[0089] The bacterial solution a was centrifuged at 8000 r / min for 30 min, the supernatant and the bacterial mud were collected, the supernatant was heat treated (65°C for 30 min), and then freeze-dried to obtain the lyophilized powder of the fermentation supernatant of Pediococcus pentosaceus CCFM1402 (referred to as CCFM1402-Q) for standby use. The bacterial mud was resuspended in double distilled water with 75% volume of the original bacterial solution, the resuspended liquid was heat treated (65°C for 30 min), and then homogenized in a high-pressure homogenizer (1000 MPa, 10P times), and after homogenization, the supernatant was taken at 8000 r / min for 30 min to obtain the bacterial lysate (referred to as CCFM1402-L).

[0090] The postbiotics of Pediococcus pentosaceus CCFM1402 (bacterial lysate CCFM1402-L and fermentation supernatant CCFM1402-Q) were prepared by the above means.

[0091] The preparation method of live bacteria of Pediococcus pentosaceus CCFM1402 is as follows: prepare the bacterial solution according to the same method as above, adjust the concentration of the bacterial solution to the same level as that of bacterial solution a, centrifuge the bacterial mud obtained at 8000r / min for 30min, resuspend it in a ratio of 1g:2mL glycerol to obtain a glycerol tube of live bacteria of Pediococcus pentosaceus CCFM1402, recorded as CCFM1402-H.

[0092] (2) According to the method of step (1), the postbiotics of Pediococcus pentosaceus FWXBH44M2, Pediococcus pentosaceus FCQNA17L4, Pediococcus pentosaceus VCQYC5144M12 and Pediococcus pentosaceus FWXBH2M1 were simultaneously prepared.

[0093] Example 2: Establishment of in vitro sodium dodecyl sulfate (SDS) damaged keratinocyte (HaCaT) model

[0094] (1) HaCaT cells in logarithmic growth phase were cultured at 1.2×10 4 The cells were seeded in a 96-well plate at a concentration of 10 cells / 100 μL / well, and the outermost circle of the well plate was filled with PBS solution to prevent edge effect. After culturing for 36 h until the cells adhered to the wall, a blank group, a control group, and an SDS-treated group were set up;

[0095] Blank group: containing only cell culture medium without HaCaT cells;

[0096] Control group: containing cell culture medium and HaCaT cells but without SDS;

[0097] Treatment groups: contained cell culture medium, HaCaT cells and SDS (at concentrations of 6.25 μg / mL, 12.5 μg / mL, 25 μg / mL and 50 μg / mL).

[0098] (2) The above-mentioned well plates were incubated in an incubator at 37°C for 6 h, 12 h and 24 h respectively. After the incubation, 10 μL of CCK8 solution was added to each well and incubated for 1.5 h, and the absorbance (OD) at 450 nm was measured.

[0099] The cell viability was calculated according to the following formula: cell viability (%) = (OD value of treatment group - OD value of blank group) / (OD value of control group - OD value of blank group) × 100%.

[0100] (3) After nonlinear regression fitting, the effect on cell activity is as follows Figure 1 As shown, compared with the control group (cell proliferation rate 100%), the cell viability of the model group treated with 15 μg / mL SDS for 6 hours was 60.6%, and SDS modeling caused significant damage to HaCaT cells.

[0101] Example 3: Effect of postbiotics prepared by Pediococcus pentosaceus CCFM1402 on HaCaT cell activity

[0102] (1) HaCaT cells in logarithmic growth phase were cultured at 1.2×10 4 The cells were inoculated into a 96-well plate at a concentration of 10 cells / 100 μL / well, and the outermost circle of the well plate was filled with PBS solution to prevent edge effect. After culturing for 36 h until the cells adhered to the wall, a blank group, a control group, and a postbiotic treatment group were set up;

[0103] Blank group: containing only cell culture medium without HaCaT cells;

[0104] Control group: containing cell culture medium and HaCaT cells but without postbiotics;

[0105] Postbiotic treatment group: contains cell culture medium and HaCaT cells, as well as postbiotics.

[0106] The postbiotics were resuspended in cell culture medium (the amount of postbiotics after resuspension was the same as that of the fermentation to a concentration of 5.0×10 7 CFU / ml of bacterial liquid), and added 100 μL of postbiotics prepared from Pediococcus pentosaceus CCFM1402, Pediococcus pentosaceus FWXBH44M2, Pediococcus pentosaceus FCQNA17L4, Pediococcus pentosaceus VCQYC5144M12 and Pediococcus pentosaceus FWXBH2M1 respectively.

[0107] (2) The above-mentioned well plates were incubated in an incubator at 37°C for 24 h. After the incubation, 10 μL of CCK8 solution was added to each well and incubated for 1.5 h, and the absorbance (OD) at 450 nm was measured.

[0108] The cell viability was calculated according to the following formula: Cell viability (%) = (OD value of the treatment group - OD value of the blank group) / (OD value of the control group - OD value of the blank group) × 100%

[0109] Effects on cell viability Figure 2 As shown in the figure, compared with the control group (cell proliferation rate 100%), the addition of postbiotics consisting of Pediococcus pentosaceus CCFM1402 (CCFM1402-Q and CCFM1402-L), Pediococcus pentosaceus FWXBH44M2 (FWXBH44M2-Q and FWXBH44M2-L), Pediococcus pentosaceus FCQNA17L4 (FCQNA17L4-Q and FCQNA17L4-L), Pediococcus pentosaceus VCQYC5144M12 (VCQYC5144M12-Q and VCQYC5144M12-L) and Pediococcus pentosaceus FWXBH2M1 (FWXBH2M1-Q and FWXBH2M1-L) at a killed cell concentration of 5.0×10 7 The cell proliferation rates at CFU / ml were 100.38%, 100.03%, 99.97%, 101.08%, 99.77%, 101.73%, 99.48%, 100.28%, 100.01% and 100.36 respectively.

[0110] According to the ISO 10993-5:2009 toxicity grading evaluation method, if the cell viability is greater than 70%, it can be considered non-toxic. The above results show that the inactivated bacterial concentration is 5.0×10 7 The viability of HaCaT cells at the postbiotic concentration of CFU / ml was higher than 95%. Considering its non-cytotoxicity, the inactivated bacterial concentration can be selected as 5.0×10 7 CFU / ml is the appropriate postbiotic concentration for subsequent cell experiments.

[0111] Example 4: Effect of postbiotics prepared by Pediococcus pentosaceus CCFM1402 on HaCaT cell damage caused by SDS

[0112] (1) HaCaT cells in logarithmic growth phase were cultured at 1.2×10 4 The concentration of cells / 100 μL / well was inoculated into a 96-well plate, where the outermost circle of the well plate was filled with PBS solution to prevent edge effect, and cultured for 36 h until the cells adhered to the wall;

[0113] (2) After the cells adhered to the wall, different groups were treated with different medium changes and incubated for 6 h.

[0114] Control group: after changing the medium in step (1), containing cell culture medium and HaCaT cells, without postbiotic treatment, and without SDS modeling agent;

[0115] Model group: the medium in step (1) was replaced with a cell culture medium containing 15 μg / mL SDS, containing the original HaCaT cells without postbiotic treatment; the preparation method of the cell culture medium containing the SDS modeling agent: SDS was mixed evenly in the culture medium and sterilized by a 0.22 μm water filter membrane, so that the final concentration of SDS in the cell culture medium was 15 μg / mL;

[0116] Postbiotic treatment group: The treatment method was the same as the model group.

[0117] (3) After the incubation, the original culture medium was discarded and the cells were washed once with PBS. The corresponding postbiotic samples were added to the postbiotic treatment group, and the cell culture medium was added to the control group and the model group, and the cells were incubated again for 24 h.

[0118] Among them, the postbiotic treatment group used cell culture medium to resuspend the postbiotics (the amount of postbiotics after resuspending was the same as that of fermentation to a concentration of 5.0×10 7 CFU / ml of bacterial liquid), and added 100 μL of postbiotics prepared from Pediococcus pentosaceus CCFM1402, Pediococcus pentosaceus FWXBH44M2, Pediococcus pentosaceus FCQNA17L4, Pediococcus pentosaceus VCQYC5144M12 and Pediococcus pentosaceus FWXBH2M1 respectively.

[0119] (4) Add 10 μL of CCK8 solution to each well and incubate for 1.5 h, then measure the absorbance (OD) at 450 nm.

[0120] The cell viability was calculated according to the following formula: cell viability of model group (%) = (OD value of model group - OD value of blank group) / (OD value of control group - OD value of blank group) × 100%; cell viability of treatment group (%) = (OD value of treatment group - OD value of blank group) / (OD value of control group - OD value of blank group) × 100%.

[0121] Effects of postbiotics on HaCaT cell damage caused by SDS Figure 3 Compared with the control group (cell viability 100%), the cell viability of the model group was 51.73%, and SDS modeling caused significant damage to HaCaT cells.

[0122] After adding CCFM1402-Q and CCFM1402-L to the treatment group, the cell viability was 84.14% and 81.33% respectively, compared with 51.73% in the model group. CCFM1402-Q and CCFM1402-L significantly improved the viability of HaCaT cells compared with the model group, indicating that the postbiotics of Pediococcus pentosaceus CCFM1402 can effectively alleviate the damage caused by SDS to HaCaT cells.

[0123] Other treatment groups Pediococcus pentosaceus FWXBH44M2 (FWXBH44M2-Q and FWXBH44M2-L), Pediococcus pentosaceus FCQNA17L4 (FCQNA17L4-Q and FCQNA17L4-L), Pediococcus pentosaceus VCQYC5144M12 (VCQYC5144M12-Q and VCQYC5144M12-L) and Pediococcus pentosaceus FWXBH2M1 (FWXBH44M2-Q and FWXBH44M2-L) After treatment with postbiotics from P. pentosaceus (WXBH2M1-Q and FWXBH2M1-L), the viability of HaCaT cells was 75.28%, 74.67%, 64.67%, 71.11%, 67.67%, 72.55% and 69.66%, respectively. That is, the postbiotics from other Pediococcus pentosaceus do not have the excellent ability of the postbiotics from Pediococcus pentosaceus CCFM1402 to alleviate the damage of HaCaT cells caused by SDS.

[0124] Example 5: Effect of postbiotics prepared by Pediococcus pentosaceus CCFM1402 on the repair of barrier function and structural protein gene expression in SDS-damaged HaCaT cells

[0125] (1) HaCaT cells were cultured at 1.8×10 4 Cells / well were seeded on 6-well plates and cultured for 36 h until the cells adhered to the plate.

[0126] (2) After the cells adhered to the wall, different groups were treated with different medium changes and incubated for 6 h.

[0127] Control group: after changing the medium in step (1), containing cell culture medium and HaCaT cells, without postbiotic treatment, and without SDS modeling agent;

[0128] Model group: the medium in step (1) was replaced with a cell culture medium containing 15 μg / mL SDS, containing the original HaCaT cells without postbiotic treatment; the preparation method of the cell culture medium containing the SDS modeling agent: SDS was mixed evenly in the culture medium and sterilized by a 0.22 μm water filter membrane, so that the final concentration of SDS in the cell culture medium was 15 μg / mL;

[0129] Postbiotic treatment group: The treatment method was the same as the model group.

[0130] Among them, the postbiotic treatment group used cell culture medium to resuspend the postbiotics (the amount of postbiotics after resuspending was the same as that of fermentation to a concentration of 5.0×10 7 CFU / ml of bacterial liquid), and 2 mL of postbiotics prepared from Pediococcus pentosaceus CCFM1402 (CCFM1402-Q and CCFM1402-L) were added respectively.

[0131] (3) After the incubation, the culture supernatant was discarded, each well was quickly washed three times with PBS, 1 mL of cell lysis solution was added to each well, and the cells were repeatedly pipetted and the cell lysis solution was aspirated to extract RNA, which was reverse transcribed into cDNA using an RT-PCR reverse transcription kit. The expression of genes in HaCaT cells was detected by real-time fluorescence quantitative method. -△△Ct The mRNA expression levels of FLG, IVL, LOR, ZO-1, OCCLUDIN and CLDN were calculated using the formula, wherein the internal reference was GAPDH, and the primers were described in Table 1 below. The results are shown in Table 1. Figure 4 shown.

[0132] Table 1 Primer sequences

[0133]

[0134] Filaggrin (FLG) is essential for the skin barrier function. It is an important molecule that connects keratin fibers in the stratum corneum of human skin. With the help of FLG monomers, keratin fibers are regularly aggregated to form a solid physical barrier in the outermost layer of the epidermis, which can prevent the loss of epidermal moisture and the invasion of external allergens. The loss of FLG is associated with many skin diseases, such as eczema (atopic dermatitis) and ichthyosis. The defects or loss of FLG protein in these diseases can lead to weakened skin barrier function, thereby increasing the skin's sensitivity to external stimuli. Therefore, the goal is to alleviate the damage of SDS to keratinocytes by increasing the gene expression of FLG. The results of FLG expression are shown in Figure 2. Figure 4 It can be seen that the expression of FLG mRNA in the control group was 1, and the expression of the model group decreased to 0.21 after SDS intervention; the postbiotics prepared by Pediococcus pentosaceus CCFM1402 (CCFM1402-Q and CCFM1402-L), FWXBH44M2-L and VCQYC5144M12-L significantly increased the expression of FLG mRNA in HaCaT cells to 1.38, 1.36, 1.91 and 1.06; while the expression of FLG mRNA after treatment with postbiotics FWXBH44M2-Q and VCQYC5144M12-Q of other Pediococcus pentosaceus was only 0.42 and 0.36, respectively, and compared with the model group, they did not show a significant upregulation effect on FLG mRNA expression. In this indicator, only the fermentation supernatant and bacterial lysate of CCFM1402 had a significant upregulation effect on FLG mRNA expression, so the subsequent indicators only characterized the relevant functions of this strain.

[0135] Involucrin (IVL) is cross-linked with loricrin under the catalysis of keratinocyte transglutaminase to form an insoluble cornified envelope, which constitutes the unique keratin barrier structure of the epidermis. It also interacts with other keratinocyte differentiation proteins such as filaggrin (FLG) to maintain the structure and function of the skin barrier. Figure 4 It can be seen that the expression level of IVL mRNA in the control group was 1, and the expression level in the model group decreased to 0.17 after SDS intervention; the postbiotics prepared by Pediococcus pentosaceus CCFM1402 (CCFM1402-Q and CCFM1402-L) significantly increased the expression level of IVL mRNA in HaCaT cells to 4.12 and 3.52, which were 23 times and 19 times higher than those in the model group.

[0136] Loricrin (LOR) is involved in the formation of the cornified envelope during keratinization, a tough, water-insoluble outer membrane that is essential for maintaining the integrity of the skin barrier. In addition, it helps maintain the hydration state of the skin and maintains the softness and elasticity of the skin by working with other keratinocyte differentiation proteins. Defects or absence of LOR proteins in these diseases can lead to a weakening of the skin barrier function, thereby increasing the sensitivity of the skin to external stimuli. Its abnormal expression or loss of function is associated with certain skin diseases, such as ichthyosis and certain types of keratosis. LOR expression results are determined by Figure 4 It can be seen that the expression level of LOR mRNA in the control group was 1, and the expression level in the model group decreased to 0.22 after SDS intervention. Postbiotics prepared by Pediococcus pentosaceus CCFM1402 (CCFM1402-Q and CCFM1402-L) significantly increased the expression level of LOR mRNA in HaCaT cells to 1.53 and 1.25.

[0137] Zonula occludens 1 (ZO-1), occludens connexin (OCCLUDIN) and occludens DN (CLDN) are key components of tight junctions (TJs) between cells and are structural proteins of the skin barrier. They are involved in controlling the transport of substances between cells and are essential for maintaining the selective permeability of the skin barrier. In addition, they are not only involved in the physical connection between cells, but also in the signal transduction process within cells, affecting cell proliferation, differentiation and migration. When the skin is damaged, these proteins are involved in the reconstruction of tight junctions and help repair the skin barrier. The results of the expression of the three structural proteins are shown in Figure 2. Figure 4It can be seen that CCFM1402-Q has a significant upregulation effect on ZO-1, CLDN and OCCLUDIN compared with the model group, and can increase mRNA to 2.32, 2.44 and 1.51 respectively. CCFM1402-L can only upregulate OCCLUDIN mRNA in HaCaT cells to 1.05. Therefore, CCFM1402-Q has a better repair effect on barrier structural proteins.

[0138] The above results show that the postbiotics (fermentation supernatant and bacterial lysate) prepared by Pediococcus pentosaceus can upregulate the expression of functional proteins (FLG, IVL and LOR) and structural proteins (ZO-1, OCCLUDIN and CLDN) mRNA when HaCaT cells are damaged by SDS, and repair the damage of SDS to HaCaT cells by alleviating cellular protein dysfunction and alleviating cell apoptosis.

[0139] Example 6: Effects of postbiotics prepared by Pediococcus pentosaceus CCFM1402 on cell pathway receptors

[0140] (1) HaCaT cells were cultured at 1.8×10 4 Cells / well were seeded on 6-well plates and cultured for 36 h until the cells adhered to the plate.

[0141] (2) After the cells adhered to the wall, the original culture medium was discarded, and the corresponding postbiotic samples were added to the postbiotic treatment group and the cell culture medium was added to the control group, and the cells were incubated again for 24 h.

[0142] Among them, the postbiotic treatment group used cell culture medium to resuspend the postbiotics (the amount of postbiotics after resuspending was the same as that of fermentation to a concentration of 5.0×10 7 CFU / ml of bacterial liquid), and 2 mL of postbiotics prepared from Pediococcus pentosaceus CCFM1402 (CCFM1402-Q and CCFM1402-L) were added respectively.

[0143] (3) After the incubation, the culture supernatant was discarded, each well was quickly washed three times with PBS, 1 mL of cell lysis solution was added to each well, and the cells were repeatedly pipetted and the cell lysis solution was aspirated to extract RNA, which was reverse transcribed into cDNA using an RT-PCR reverse transcription kit. The expression of genes in HaCaT cells was detected by real-time fluorescence quantitative method. -△△Ct The mRNA expression levels of AHR, OVOL1 and STAT3 were calculated using the formula, where the internal reference was GAPDH, and the primers were described in Table 2 below. The results are shown in Table 2. Figure 5 shown.

[0144] Table 2: Primer sequences

[0145]

[0146]

[0147] The AHR signaling pathway plays a role in maintaining the integrity of the skin barrier. Low AHR expression is associated with increased skin barrier permeability, enhanced susceptibility to infection, and increased pathological features in atopic dermatitis models. As a transcription factor, OVOL1 is involved in regulating gene expression related to skin barrier function. At the same time, OVOL1 was identified as a direct transcriptional target of AHR, and the expression of OVOL1 affects AHR regulation of related gene expression in keratinocytes. The absence of OVOL1 in keratinocytes impedes the barrier-promoting function of AHR. JAK / STAT is also a classic pathway for maintaining the skin barrier and inhibiting inflammation, and downregulation of STAT3 content can serve as a characteristic target in this pathway. According to Figure 5 The results show that the fermentation supernatant of CCFM1402 can significantly upregulate the gene expression of AHR and OVOL1 to 1.7 and 2.06, respectively, activating the expression of this pathway, while the dead CCFM1402 bacteria cannot upregulate the expression of the two, and this pathway is not activated. However, the fermentation supernatant of CCFM1402 cannot downregulate the expression of STAT3, while the dead CCFM1402 bacteria can downregulate the expression of STAT3 to 0.43.

[0148] In summary, CCFM1402 fermentation supernatant will repair the HaCaT cell barrier through the AHR-OVOL1 pathway, and CCFM1402 dead bacteria will repair the HaCaT cell barrier through the JAK / STAT pathway.

[0149] Example 7: Effects of Pediococcus pentosaceus CCFM1402 and postbiotics prepared therefrom on the barrier function level in the skin of mice with skin barrier damage

[0150] The preparation method of the postbiotics (CCFM1402-Q and CCFM1402S) and live bacteria of Pediococcus pentosaceus CCFM1402 involved in the following examples is the same as that in Example 1, except that the bacterial sludge obtained by centrifuging the cultured bacterial liquid at 8000r / min for 30min is resuspended in double distilled water with 75% volume of the original bacterial liquid, and the resuspended liquid is heat treated at 65°C for 30min without high-pressure homogenization to obtain inactivated bacteria.

[0151] (1) 45 healthy female BALB / c mice aged 7 weeks were randomly divided into 9 cages, with 5 mice in each cage. The 9 cages were as follows: except for the model group (Model) which had 2 cages, the blank group and the other groups each had 1 cage, which were:

[0152] Blank group (Control): Use normal saline as control;

[0153] Model group: normal saline was used as the control;

[0154] CCFM1402-H group: live bacteria of Pediococcus pentosaceus CCFM1402 were used, with a dose of 1×10 9 CFU;

[0155] CCFM1402S group: Pediococcus pentosaceus CCFM1402 postbiotics (inactivated bacteria) were used, with a dose of: viable bacteria count 1×10 9 CFU;

[0156] CCFM1402-Q group: Pediococcus pentosaceus CCFM1402 metabolite (fermentation supernatant) was used, with a dose of 151 mg / kg mouse body weight;

[0157] Among them, the inactivated bacteria or metabolites in the above groups are prepared from bacterial liquid with the corresponding amount of live bacteria.

[0158] The experiment lasted for four weeks, and gavage was performed every day from the 7th day to the 28th day; before modeling, the back skin of the mice was shaved with a razor and depilatory cream, with the size of 2 cm long x 1.5 cm wide. A basic solution was prepared with acetone and olive oil (4:1 v / v), and then DNFB and the basic solution were mixed to prepare 0.5% and 0.2% DNFB sensitizing drugs. Modeling started in the 3rd week, and on the first day of modeling, 25 μL of 0.5% DNFB drug was applied to the back skin of the mice. Afterwards, 25 μL of 0.2% DNFB drug was used on days 18, 21, 24 and 27. The blank group mice used an equal amount of basic solution. The specific experimental methods are as follows. Figure 6 shown.

[0159] After the experiment, the mice were killed and blood was collected from the eyeballs. After standing for 40 minutes, the blood was centrifuged at 3000 r / min for 20 minutes to obtain the blood supernatant for ELISA detection; the back skin tissue was cut and ground into a homogenate at a weight-to-volume ratio of 1:10 with PBS, and the homogenate was centrifuged at 3000 r / min for 20 minutes and the skin supernatant was obtained for detection by an ELISA kit.

[0160] Elisa kit was used to detect the contents of filaggrin (FLG), loricrin (LOR) and involucrin (IVL) in mouse skin. Figure 7 shown.

[0161] Compared with the control group (3921.33pg / 100mg), the FLG content in the skin of the model group decreased significantly to 2724.167pg / 100mg. The oral CCFM1402-S, CCFM1402-H, and CCFM1402-Q groups significantly increased the FLG content compared with the model group, restoring the FLG content in the skin to 4107.83pg / 100mg, 3382.50pg / 100mg, and 4014.67pg / 100mg. The content of LOR in the control group was 507.75pg / 100mg, and the content of LOR (438.75pg / 100mg) in the model group was reduced to 0.86 times that of the control group. Compared with the model group, oral CCFM1402-S and CCFM1402-Q groups could significantly increase their content to 481.00pg / 100mg and 476.92pg / 100mg, while there was no significant difference between the CCFM1402-H group and the model group. For IVL, the content in the control group was 716.4pg / 100mg, and the content in the model group was 610.9pg / 100mg. Only the CCFM1402-Q group could significantly increase the content of IVL compared with the model group, and the content in this group was restored to 646.25pg / 100mg.

[0162] The above results show that Pediococcus pentosaceus CCFM1402 and its prepared postbiotics (lysate and supernatant) can increase the content of functional proteins in the skin of mice with skin barrier damage, among which CCFM1402-Q showed more obvious improvement compared with the model group.

[0163] Example 8: Effects of Pediococcus pentosaceus CCFM1402 and postbiotics prepared therefrom on the levels of barrier structural proteins in the skin of mice with skin barrier damage

[0164] The animal experiment design, gavage groups and skin homogenate sample preparation used in the following examples are the same as those in Example 7. The levels of barrier structural proteins ZO-1, CLDN and Occludin in the skin of mice with skin barrier damage are as follows: Figure 8 shown.

[0165] (1) Skin ZO-1 content: The ZO-1 content in the control group was 57.8 pg / 100 mg, and that in the model group was 47.78 pg / 100 mg. The oral CCFM1402-S, CCFM1402-H, and CCFM1402-Q groups significantly increased the ZO-1 content compared with the model group, which were 53.87 pg / 100 mg, 55.93 pg / 100 mg, and 51.83 pg / 100 mg, respectively.

[0166] (2) Skin CLDN content: The CLDN content in the control group was 96.05 pg / 100 mg, and that in the model group was 67.59 pg / 100 mg. The CLDN content in the oral CCFM1402-S, CCFM1402-H, and CCFM1402-Q groups was significantly higher than that in the model group, which were 96.46 pg / 100 mg, 91.07 pg / 100 mg, and 76.28 pg / 100 mg, respectively.

[0167] (3) Occludin content in the skin: The occludin content in the control group was 87.78 pg / 100 mg, and that in the model group was 68.82 pg / 100 mg. Compared with the model group, the occludin content in the oral CCFM1402-S, CCFM1402-H, and CCFM1402-Q groups was significantly higher than that in the model group, which were 77.48 pg / 100 mg, 77.08 pg / 100 mg, and 79.56 pg / 100 mg, respectively.

[0168] In summary, based on the comprehensive indicators of skin structural proteins, it can be seen that Pediococcus pentosaceus CCFM1402 and the postbiotics prepared therefrom can increase the content of skin structural proteins. Its dead bacteria, live bacteria and fermentation supernatant can all upregulate the content of such proteins and restore it to a level equivalent to that of the control group.

[0169] Example 9: Effects of Pediococcus pentosaceus CCFM1402 and postbiotics prepared therefrom on the gene expression of basement membrane barrier proteins in mice with skin barrier damage

[0170] The animal experiment design and gavage groups involved in the following examples are the same as those in Example 7. Skin RNA was extracted using the Novozyme kit and reversely transcribed into cDNA to detect the gene expression of fibronectin and laminin in the skin, wherein the primer sequences are described in Table 3 below. Fibronectin and laminin are proteins in the basal layer of the skin that are essential for the health of the skin barrier.

[0171] Table 3: Primer sequences

[0172]

[0173] By detecting the mRNA content of fibronectin and adhesion protein, it can be seen that the relative expression of fibronectin mRNA of oral CCFM1402-S, CCFM1402-H and CCFM1402-Q is 2.40, 1.40, and 1.56, which are significantly upregulated compared with the model group (0.56). For adhesion protein, oral CCFM1402-S can increase its relative expression of mRNA to 1.08, while oral CCFM1402-Q and CCFM1402-H cannot increase this indicator. The relative mRNA content of fibronectin and adhesion protein is shown in Figure 2. Fig. 9 shown.

[0174] Example 10: Effects of Pediococcus pentosaceus CCFM1402 and postbiotics prepared therefrom on the skin condition of mice with skin barrier damage

[0175] The animal experiment design and oral gavage groups involved in the following examples are the same as those in Example 8. The skin surface state test was performed using a skin tester Cutometer DUAL MPA580 equipped with a TEWL probe and a stratum corneum moisture content CM825 probe. The skin TEWL and moisture content of oral CCFM1402-S, CCFM1402-H and CCFM1402-Q are shown in the figure. Fig.10 The TEWL of the oral CCFM1402-Q group decreased to 22.36 g / m 2 / h, compared with the model group (45.48g / m 2 / h) decreased by 2.03 times. At the same time, this group also had a significant increase in the water content of the stratum corneum compared with the model group. The water content of oral CCFM1402-Q was 28.67, which was 1.73 times that of the model group (16.53). However, there was no significant difference in TEWL and stratum corneum water content between oral CCFM1402-H and CCFM1402-S and the model group.

[0176] Therefore, oral administration of CCFM1402-Q has a good repairing effect on the skin surface condition.

[0177] Example 11: Effects of Pediococcus pentosaceus CCFM1402 and postbiotics prepared therefrom on blood and skin inflammation in mice with skin barrier damage

[0178] The animal experiment design, gavage groups and skin homogenate sample preparation used in the following examples are the same as those in Example 8. The three indicators of serum IgE, skin histamine and skin IL-4 reflect the inflammation of the skin to a certain extent. Fig.11 shown.

[0179] Oral administration of CCFM1402-Q can significantly reduce the IgE content compared with the model group. The IgE content of the model group was 1.39μg / mL, and the IgE content of the CCFM1402-Q group was 1.21μg / mL. The oral levels of CCFM1402-S and CCFM1402-H were 1.41μg / mL and 1.34μg / mL, respectively. The former was higher than the model group, while the latter had no significant difference.

[0180] In the index of skin histamine (HIS), compared with the control group (11.67ng / 100mg), the histamine content of the model group skin increased significantly to 13.74ng / 100mg. Oral administration of CCFM1402-H and CCFM1402-Q can significantly reduce the histamine content of the skin to 10.95ng / 100mg and 12.35ng / 100mg compared with the model group. However, oral administration of CCFM402-S cannot significantly reduce the histamine content of the skin, and its content is 13.56ng / 100mg.

[0181] As for the IL-4 content in the skin, the IL-4 content in the control group was 192.4pg / 100mg, and the IL-4 content in the model group was 1.13 times that of the blank control group, which was 217.825pg / 100mg. Oral administration of CCFM1402-H significantly downregulated the IL-4 content in the skin (175.27pg / 100mg), while oral administration of CCFM1402-Q also downregulated the IL-4 content in the skin (197.77pg / 100mg), but there was no significant difference with the model group.

[0182] In summary, oral administration of CCFM1402-H and CCFM1402-Q can alleviate the inflammation in the DNFB-damaged mouse skin barrier model to varying degrees, and CCFM1402-H has a better anti-inflammatory effect.

[0183] Example 12: Pediococcus pentosaceus CCFM1402 fermentation supernatant repairs skin barrier damage in mice via AHR-OVOL1 receptor and OX40 receptor

[0184] The animal experiment design and gavage groups involved in the following examples are the same as those in Example 7. Skin RNA was extracted using the Novozyme kit and reversely transcribed into cDNA to detect the gene expression of AHR, OVOL1 and OX40 in the skin, wherein the primer sequences are described in Table 4 below.

[0185] According to the results obtained in the above examples, comprehensive analysis of all indicators showed that oral CCFM1402-Q has a good skin barrier repair effect, so the oral CCFM1402-Q group was selected to analyze the repair mechanism. Fig.12 It can be seen that oral administration of CCFM1402-Q can significantly upregulate the mRNA expression of AHR and OVOL1 to 6.68 and 2.74, which are 19.1 and 2.22 times of the model group, respectively. In addition, the expression of OX40 receptor can be significantly downregulated to 1.07 compared with the model group (1.84), which is 0.58 times of the model group.

[0186] Based on this, it can be inferred that CCFM1402-Q can repair the skin barrier in the DNFB-damaged mouse skin model by upregulating the expression of AHR-OVOL1 and downregulating OX40, two different pathway receptors.

[0187] Table 4: Primer sequences

[0188]

[0189] AHRACATCACCTACGCCAGTCGCGCTTTGGAAGGATTTGACTTGA OVOL1 TGAACATGAGCCTTCGAGACT CAAGGGTCACCTTCATCTTGG

[0190] OX40 TACCTACCCCAGTGGTCACAAACGGATGACATAGAGTATCCCTG

[0191] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A strain of Pediococcus pentosaceus CCFM1402, characterized in that: The Pediococcus pentosaceus CCFM1402 is deposited in Guangdong Microbiological Culture Collection Center with a deposit number of GDMCC: 65087.

2. A microbial preparation containing Pediococcus pentosaceus CCFM1402 according to claim 1, characterized in that: The content of Pediococcus pentosaceus CCFM1402 in the microbial preparation is ≥1×10 6 CFU / mL or 1×10 6 CFU / g.

3. A postbiotic prepared by using Pediococcus pentosaceus CCFM1402 according to claim 1, characterized in that: The postbiotics include lysate, inactivated cells, fermentation supernatant of Pediococcus pentosaceus CCFM1402, or any powder prepared by drying.

4. A composition containing the Pediococcus pentosaceus CCFM1402 according to claim 1 and / or the microbial preparation according to claim 2, and / or the postbiotic according to claim 3.

5. The composition according to claim 4, characterized in that The composition includes food, medicine, health care product or daily chemical product.

6. The composition according to claim 5, characterized in that The composition further comprises conventional auxiliary materials; the conventional auxiliary materials include one or more of fillers, flavoring agents, binders, disintegrants, lubricants, antacids, and nutritional enhancers.

7. The composition according to claim 5, characterized in that The daily chemical products include skin care products, cosmetics or toiletries; the medicines include smear-type medicines or oral medicines.

8. A method for preparing postbiotics from Pediococcus pentosaceus CCFM1402, characterized in that: Include (a) or (b): (a) culturing the Pediococcus pentosaceus CCFM1402 according to claim 1, centrifuging to obtain a fermentation supernatant, inactivating it by heat treatment, and then freeze-drying to obtain a postbiotic freeze-dried powder; (b) The Pediococcus pentosaceus CCFM1402 according to claim 1 is cultured, inactivated by heat treatment, crushed by high-pressure homogenization, and then freeze-dried to obtain a postbiotic freeze-dried powder.

9. Use of the Pediococcus pentosaceus CCFM1402 according to claim 1 and / or the microbial preparation according to claim 2, and / or the postbiotic according to claim 3 in the preparation of a product for repairing the skin barrier or repairing skin damage.

10. Use of the Pediococcus pentosaceus CCFM1402 according to claim 1 and / or the microbial preparation according to claim 2, and / or the postbiotic according to claim 3 in the preparation of daily chemical products for improving skin hydration.

Images