Non-diagnostic-purpose miRNA detection method and kit based on dual cascade amplification of Pt nanoprobe

Abstract

The invention belongs to the field of miRNA detection, and particularly relates to a non-diagnostic-purpose miRNA detection method based on dual cascade amplification of a Pt nanoprobe and a kit. Comprising the following steps: 1) obtaining a Pt NPs (at) Ab nanoprobe; (2) carrying out an ISAR-CRISPR / Cas12a reaction; and (3) dripping on a nucleic acid test strip for capillary action, adding a quenching substrate into the T line for catalysis after the chromatographic reaction is finished, and judging the concentration of miRNA by observing the T line. According to the invention, a Pt nanoprobe is introduced as a fluorescence quenching probe, and after TMB is dropwise added, double-amplification cascade fluorescence quenching is generated. Due to the adoption of a double-amplification cascade fluorescence quenching strategy, the fluorescence quenching efficiency can be greatly improved, so that an ultra-low background fluorescence signal is ensured. The method has a good application prospect, can be used as a general detection method for detecting a specific nucleic acid target, and is widely applied to the fields of nucleic acid detection and the like.

Description

Technical Field

[0001] The invention belongs to the field of miRNA detection, and in particular relates to a non-diagnostic miRNA detection method and a kit based on double cascade amplification of Pt nanoprobes. Background Art

[0002] As people's health requirements continue to increase, the trace detection of various biomarkers has become an urgent challenge that requires urgent attention. In particular, strict requirements are placed on the analysis and identification of complex, diverse and low-concentration biomarkers.

[0003] Analytical methods based on fluorescence quenching mechanisms have gained increasing attention in the detection and quantification of specific analytes. The fluorescence quenching mechanism relies on efficient quenchers to quench fluorophores, thereby significantly improving the detection sensitivity and ensuring ultra-low background signals. Currently, graphene oxide (GO), carbon nanotubes (CNTs), MoS2, noble metal nanoparticles (NPs) and polydopamine (PDA) have been widely used as fluorescence quenching materials, especially noble metal nanomaterials such as gold nanoparticles (AuNPs), platinum nanoparticles (Pt NPs) and silver nanoparticles (Ag NPs). Because of their high molar extinction coefficients, they have been widely used as quenchers to quench different fluorescent dyes. Therefore, noble metal nanomaterials have been introduced into homogeneous detection technology as fluorescence quenching probes for the detection of various biomarkers.

[0004] Compared with homogeneous detection technology, immunochromatographic test strips (ICTs), as a detection platform that combines antigen-antibody immunoaffinity reaction with chromatography technology, have broad application prospects in point-of-care testing (POCT) for biomarker identification due to their convenience, rapidity and affordability. However, for trace biomarkers, the application is severely limited due to the poor fluorescence quenching effect of noble metal nanoparticles. There are two key factors that affect the fluorescence quenching effect: one is the distance at which quenching occurs. A donor can only quench fluorescent dyes at a relatively close distance (1 to 10 nm), resulting in a limited number of quenched fluorescent dyes; the other reason is the absorption spectrum of the quencher, which can usually only achieve a single spectral overlapping quenching ability, so it is difficult to cover the excitation spectrum and emission spectrum of the fluorescent dye. Therefore, how to increase the number of fluorescent dyes quenched directly or indirectly by a quencher and screen out quenchers with a suitable absorption spectrum range are key factors in improving the detection sensitivity of analytical methods based on the fluorescence quenching mechanism.

[0005] In order to increase the number of fluorescent dyes quenched by a single quencher, many scholars have done a lot of work on the design of nanomaterials, such as encapsulation with SiO2, surface plasma absorption of noble metal nanoparticles, and chemical etching of noble metals, but most methods are still not ideal. In fact, most noble metal nanomaterials can be used as nanozymes to catalyze TMB and ABTS to produce color reactions. In addition, oxidized 3,3',5,5'-tetramethylbenzidine (oxTMB) also has a broad-spectrum quenching mode, which can effectively absorb the emission (Em) light of the fluorophore. Combining these two enhancement strategies may improve the detection sensitivity based on the fluorescence quenching mechanism. Summary of the invention

[0006] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a method for detecting miRNA based on double cascade amplification of Pt nanoprobes for non-diagnostic purposes.

[0007] To achieve the above object, the technical solution adopted by the present invention is:

[0008] A method for detecting miRNA based on double cascade amplification of Pt nanoprobes for non-diagnostic purposes, characterized by comprising the following steps:

[0009] 1) After adding digoxigenin antibody to the Pt NPs solution for reaction, BSA solution was added to block the unbound sites to obtain the Pt NPs@Ab nanoprobe;

[0010] 2) performing ISAR-CRISPR / Cas12a reaction; adding Pt NPs@Ab nanoprobes to the ISAR / Cas12a reaction solution containing different concentrations of miRNA to obtain a mixed solution;

[0011] 3) dropping the mixed solution obtained in step 2) onto a nucleic acid test strip for capillary action, adding a quenching substrate to the T line for catalysis after the chromatography reaction is completed, and judging the concentration of the miRNA by observing the T line.

[0012] In step 1), Pt NPs are prepared by the following redox method; preferably, the following method is used for preparation: H2PtCl4.6H2O is added with KOH and L-ascorbic acid; the mixture is stirred at 40-80°C, preferably at 60°C until it turns black and has a metallic luster, and stirring is continued at room temperature to obtain Pt NPs, which are stored at 4°C for subsequent use.

[0013] The miRNA is miR-15a-5p, and the sequence is: 5'UAGC AGCA CAUA AUGG UUUG UG-3'.

[0014] In step 2), the ISAR / Cas12a reaction solution was prepared in the following manner: dNTPs, hDNA probes, DNA primers and BST polymerase were added to miRNAs of different concentrations, and the reaction was carried out at 37°C for 30 minutes; Cas12a, crRNA and digoxigenin / ssDNA / biotin were then added and incubated at 37°C for 45 minutes to obtain ISAR / Cas12a reaction solutions containing miRNAs of different concentrations;

[0015] The miRNA opens the paired stem sequence of hDNA through nucleic acid hybridization, and the primer is extended under the action of Bst polymerase, gradually replacing the miRNA and completely hybridizing with the opened hDNA to form a dsDNA double-stranded sequence, and then Cas12a is added for specific recognition;

[0016] The stem-loop structure of the hDNA probe is: 5'CATCGTCCTAGTTTACGTCGCCGTCCAACTCACAAACCATTATGTGCTGCTAGGACGATG-3'; the DNA primer is 5'CCTGCTAC-3'; the sequence of crRNA is: 5'UAAUUUCUAAGUGUAGAU CGUCGCCGUCCAACU-3'; the reporter molecule ssDNA sequence is: 5'Digoxin-TTTTTTTTTT-Biotin.

[0017] The amount of Pt NPs@Ab nanoprobe added to the ISAR / Cas12a reaction solution is 0.5-3 μL / 60 μL; preferably 2 μL / 60 μL.

[0018] The quenching substrate in step 3) is one of 3,3',5,5'-tetramethylbenzidine TMB, 2,2-azo-bis(3-ethyl-benzothiazole-6-sulfonic acid) diammonium salt ABTS, o-phenylenediamine OPD and 3,3'-diaminobenzidine tetrahydrochloride DAB; preferably 3,3',5,5'-tetramethylbenzidine TMB; preferably, the amount of TMB added to the ISAR / Cas12a reaction solution is 0.4-1.2 μL / 60 μL; preferably 1 μL / 60 μL.

[0019] The chromatography reaction takes 5-25 min, preferably 20 min.

[0020] In step 3), the nucleic acid test strip is prepared in the following manner: SA-Cy5 and goat anti-mouse secondary antibody are streaked onto the nitrocellulose membrane as T line and C line respectively, and the test strip card and sample pad, binding pad, NC membrane, and absorption pad are assembled to form a nucleic acid test strip.

[0021] The catalytic time in step 3) is 0-120s; preferably 90s.

[0022] In step 3), the concentration of miRNA is inversely proportional to the visual result of T line, and is directly proportional to the fluorescence intensity result.

[0023] The present invention also includes a kit, comprising the nucleic acid test paper, an ISAR / Cas12a reaction solution without miRNA, and a Pt NPs@Ab nanoprobe.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] The present invention introduces Pt nanoprobe as a fluorescence quenching probe, and FRET occurs between Pt NPs and Cy5, transferring part of the energy to Pt NPs, while continuing to release the remaining energy, generating fluorescence with a wavelength of 663nm. After TMB is added dropwise, under the influence of the fluorescence inner filter effect, the excitation light (Ex) and emission light (Em) of Cy5 will be partially absorbed, thereby generating a double-amplification cascade fluorescence quenching. Due to the adoption of the double-amplification cascade fluorescence quenching strategy, the fluorescence quenching efficiency can be greatly improved, thereby ensuring an ultra-low background fluorescence signal. The present invention has good application prospects and can be used as a general detection method for detecting specific nucleic acid targets, and is expected to be widely used in the fields of nucleic acid detection. In order to obtain the best measurement performance, the amount of probe added, the time of the chromatography reaction, the amount of TMB added and the catalytic time are optimized at the same time, and the optimal system conditions are determined. The test strip finally prepared is used to detect miR-15a-5p. The method has been successfully applied to the target nucleic acid in the detection system, and its feasibility, sensitivity and accuracy have been verified. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 Schematic diagram of the method for detecting miRNA based on dual cascade amplification of Pt nanoprobes for non-diagnostic purposes;

[0027] Figure 2 The quenching efficiency diagram of different catalytic substrates based on the catalytic activity of Pt nanozymes;

[0028] Figure 3 This is a diagram of the optimization results of the miRNA method;

[0029] Figure 4 This is a feasibility operation result diagram. DETAILED DESCRIPTION

[0030] In order to enable those skilled in the art to better understand the technical solution of the present invention, the present invention is further described in detail below in conjunction with the accompanying drawings and the best embodiments.

[0031] Example 1: Different catalytic substrate quenching efficiencies based on the catalytic activity of Pt NPs nanozymes

[0032] 1) Pt NPs were prepared by redox reaction, specifically comprising the following steps: 4 mL of 2 mM H2PtCl4.6H2O was added to 6 mL of 50 μL of 1 M KOH and 3 mL of 10 mM L-ascorbic acid. The mixture turned black after being stirred at 60°C for 1 hour, and then stirred at room temperature for 2 hours to obtain a uniformly dispersed Pt NPs solution, which was stored at 4°C for subsequent use;

[0033] 2) Add 300 μL Cy5, 100 μL Pt NPs and catalytic solutions of different quenching substrates (300 μL, 8 mM TMB, ABTS, OPD, DAB) to the EP tube. After mixing for 4 minutes, scan the fluorescence Em spectrum at 600-750 nm under 652 nm Ex light, and record the fluorescence photos with AzureC600. Add different concentrations of Pt NPs to the mixed solution including TMB, Cy5 and H2O2, calculate the fluorescence intensity using ImageJ, and take photos with AzureC600. The results are shown in Figure 2 , indicating that TMB oxidation product has the best ability to quench Cy5, with a quenching efficiency of 76.25%.

[0034] Example 2: Optimization of the method for detecting miR-15a-5p:

[0035] Preparation of Pt NPs@Ab nanoprobe (referred to as probe or Pt probe): After adding anti-digoxin antibody to the uniformly dispersed Pt NPs solution for reaction, BSA solution is added to block the unbound sites to obtain Pt NPs@Ab nanoprobe, which specifically includes the following steps: 300ng anti-digoxin antibody is mixed with 1mL Pt NPs and slowly stirred for 1 hour at 4°C. Then 200μL, 5% (w / v) BSA is added to block the sites of uncoupled antibodies and blocked at 4°C for one hour. The resulting solution is centrifuged at 13000rpm for 15 minutes to remove unbound antibodies. The precipitate after centrifugation is resuspended in 100μL water and stored at 4°C to obtain Pt NPs@Ab nanoprobe.

[0036] The nucleic acid detection test strip is assembled in the following manner: the sample pad is cut into 1.1-2 cm, the binding pad is in contact with one end of the sample pad, and the binding pad is cut into 0.3-0.8 cm; the NC membrane is in contact with the other end of the binding pad, which includes a detection line and a quality control line; the prepared SA-Cy5 is quantified to 1-5 mg / mL with PBST; 1-5 mg / mL of goat anti-mouse secondary antibody is prepared at the same time; the required SA-Cy5 and goat anti-mouse secondary antibody are respectively streaked onto the nitrocellulose membrane by a streaking instrument to form a T line and a C line for detecting miRNA; the test strip includes a sample pad, a binding pad, an NC membrane and absorbent paper. After drying at 37°C for 1 hour, the various parts are assembled on a back card, and the back card is cut into single strips of 2-5 mm by a strip cutter to form a nucleic acid test strip.

[0037] 1) Probe dosage:

[0038] Take 6 1.5mL EP tubes, numbered 1-6, and add the reaction solution of the ISAR / Cas12a reaction to each one. Add 0.5, 1, 1.5, 2, 2.5, and 3μL of probes to centrifuge tubes 1-6, respectively, to make up the total volume of the reaction system to 60μL, and drop the mixed solution onto the nucleic acid test paper respectively. Use iPhone 13 to photograph the naked eye results and use ImageJ software to calculate the pixel intensity of the T line area.

[0039] The ISAR / Cas12a reaction solution contains 10 μL 100nM miRNA, 1 μL 2.5mM dNTPs, 1 μL 1 μM hDNA probe, 1 μL 1 μM DNA primer and 2.4U BST polymerase. The reaction solution was reacted at 37°C for 30 minutes. Then 1 μL 1 μM Cas12a, 1 μL 1 μM crRNA and 1 μL 10 μM digoxigenin / ssDNA / biotin were added and incubated at 37°C for 45 minutes to obtain the ISAR / Cas12a reaction solution;

[0040] The stem-loop structure of the hDNA probe is: 5'CATCGTCCTAGTTTACGTCGCCGTCCAACTCACAAACCATTATGTGCTGCTAGGACGATG-3'; the DNA primer is 5'CCTGCTAC-3'; the sequence of crRNA is: 5'UAAUUUCUAAGUGUAGAU CGUCGCCGUCCAACU-3'; the reporter molecule ssDNA sequence is: 5'Digoxin-TTTTTTTTTT-Biotin.

[0041] Results Figure 3 A, When the probe volume is 2.5 μL, the T line intensity reaches the maximum. To obtain higher sensitivity, the optimal probe volume is considered to be 2.5 μL.

[0042] 2) Chromatographic reaction time:

[0043] Take 5 1.5mL centrifuge tubes, number 1-5, add ISAR / Cas12a reaction solution to each tube (steps as above), and add 2μL of Pt NPs@Ab nanoprobe to make the total volume of the reaction system 60μL. After reacting at room temperature for 5min, 10min, 15min, 20min, and 25min, add the mixed solution dropwise to the nucleic acid test paper, take naked eye results with iPhone 13, and calculate the pixel intensity of the T line area with ImageJ software. Figure 3 B. Results show that the intensity of the T line increases with the increase of the chromatography reaction time. At 20 minutes, the intensity of the T line reaches the maximum, indicating that the chromatography reaction is complete.

[0044] 3) Dosage of TMB:

[0045] Take 5 1.5mL EP tubes, numbered 1-5, add the completed ISAR / Cas12a reaction to each tube and add 2μL of Pt NPs@Ab nanoprobe to make the total volume of the reaction system 60μL (as shown above), and add 0.4, 0.6, 0.8, 1.0, and 1.2μL of TMB to the nucleic acid test strips after the chromatography reaction. Use iPhone 13 to take naked eye results and use ImageJ software to calculate the pixel intensity of the T line area. Figure 3 C When the amount of TMB added is small, it is difficult to obtain obvious experimental results, and a large amount added will affect signal acquisition, so the volume of TMB is selected as 1 μL.

[0046] 4) Optimization of TMB catalysis time

[0047] Take 5 1.5mL centrifuge tubes, number 1-5, add the reaction solution of ISAR / Cas12a reaction to each tube, and add 2μL of Pt probe. After reacting at room temperature for 20 minutes, add 1μL of TMB dropwise, take naked eye results with iPhone 13 at 0, 30s, 60s, 90s, and 120s, and calculate the pixel intensity of the T line area with ImageJ software. Figure 3 D The results showed that the optimal condition for the catalytic reaction was 90s.

[0048] Example 3: A method for detecting miRNA based on double cascade amplification of Pt nanoprobes for non-diagnostic purposes, comprising the following steps:

[0049] 1) After adding digoxin antibody to the Pt NPs solution for reaction, a BSA solution is added to block the unbound sites to obtain a Pt NPs@Ab nanoprobe; specifically, the following steps are used:

[0050] 1.1) Pt NPs were prepared by redox reaction, specifically comprising the following steps: 4 mL of 2 mM H2PtCl4.6H2O was added to 6 mL of 50 μL of 1 M KOH and 3 mL of 10 mM L-ascorbic acid. The mixture turned black after being stirred at 60°C for 1 hour, and then stirred at room temperature for 2 hours to obtain a uniformly dispersed Pt NPs solution, which was stored at 4°C for subsequent use;

[0051] 1.2) 300 ng of anti-digoxin antibody was mixed with 1 mL of Pt NPs solution and stirred slowly at 4°C for 1 hour. Then 200 μL of 5% (w / v) BSA was added to block the sites of uncoupled antibodies and blocked at 4°C for one hour. The resulting solution was centrifuged at 13000 rpm for 15 minutes to remove unbound antibodies. The pellet after centrifugation was resuspended in 100 μL of water and stored at 4°C to obtain Pt NPs@Ab nanoprobes.

[0052] 2) 2.5 μL of Pt NPs@Ab probe was added to the mixed solution containing 0 and 100 nM miR-15a-5p, which had completed the ISAR / Cas12a reaction;

[0053] The reaction solution after the ISAR / Cas12a reaction contains 10 μL 100nM (or 0 μL) of miRNA, 1 μL 2.5mM dNTPs, 1 μL 1 μM hDNA probe, 1 μL DNA primer and 2.4U BST polymerase. The reaction solution was reacted at 37 ° C for 30 minutes. Then 1 μL 1 μM Cas12a, 1 μL 1 μM crRNA and 1 μL 10 μM digoxin / ssDNA / biotin were added and incubated at 37 ° C for 45 minutes to obtain the ISAR / Cas12a reaction solution;

[0054] The stem-loop structure of the hDNA probe is: 5'CATCGTCCTAGTTTACGTCGCCGTCCAACTCACAAACCATTATGTGCTGCTAGGACGATG-3'; the DNA primer is 5'CCTGCTAC-3'; the sequence of crRNA is: 5'UAAUUUCUAAGUGUAGAU CGUCGCCGUCCAACU-3'; the reporter molecule ssDNA sequence is: 5'Digoxin-TTTTTTTTTT-Biotin.

[0055] 3) The mixed solution obtained in step 2) was dropped onto the nucleic acid test strip for capillary action. After the chromatography reaction was completed for 25 minutes, 1 μL TMB was added to the T line. Then, the naked eye results were directly photographed with iPhone 13, and the corresponding fluorescence intensity was recorded with AzureC600 under 50 ms of illumination. The pixel intensity of the T line area was calculated using ImageJ software. Figure 4 Shown.

[0056] The results showed that when miRNA-15a-5p was added, resulting in digoxin / ssDNA / biotin cleavage, there was almost no visual signal on the T line due to the separation of digoxin / ssDNA / biotin and the inability to form a sandwich structure. The fluorescence of the Cy5 dye on the T line did not change much. When miR-15a-5p was not present, the color of the T line turned blue due to the peroxidase-like activity of the Pt nanoprobe, and the fluorescence was significantly reduced due to the efficient quenching ability of oxTMB based on the fluorescence inner filter effect. Figure 4 Shown.

[0057] In summary, the present invention introduces Pt nanoprobes as fluorescence quenching probes, and FRET occurs between PtNPs and Cy5, transferring part of the energy to PtNPs, while continuing to release the remaining energy, generating fluorescence with a wavelength of 663nm. After TMB is added dropwise, under the influence of the fluorescence inner filter effect, the excitation light (Ex) and emission light (Em) of Cy5 will be partially absorbed, thereby generating a double-amplification cascade fluorescence quenching. Due to the use of a double-amplification cascade fluorescence quenching strategy, the fluorescence quenching efficiency can be greatly improved, thereby ensuring an ultra-low background fluorescence signal. The present invention has good application prospects and can be used as a general detection method for detecting specific nucleic acid targets, and is expected to be widely used in the fields of nucleic acid detection. In order to obtain the best measurement performance, the inventor optimized the amount of probe added, the time of the chromatography reaction, the amount of TMB added and the catalytic time, and determined the optimal system conditions. The test strips finally prepared are used to detect miR-15a-5p. This method has been successfully applied to the target nucleic acid in the detection system, verifying its feasibility, sensitivity and accuracy.

[0058] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A method for detecting miRNA based on double cascade amplification of Pt nanoprobes for non-diagnostic purposes, characterized in that: The steps include: 1) After adding digoxigenin antibody to the Pt NPs solution for reaction, BSA solution was added to block the unbound sites to obtain the Pt NPs@Ab nanoprobe; 2) performing ISAR-CRISPR / Cas12a reaction; adding PtNPs@Ab nanoprobes to the ISAR / Cas12a reaction solution containing different concentrations of miRNA to obtain a mixed solution; 3) dropping the mixed solution obtained in step 2) onto a nucleic acid test strip for capillary action, adding a quenching substrate to the T line for catalysis after the chromatography reaction is completed, and judging the concentration of the miRNA by observing the T line.

2. The method for detecting miRNA based on double cascade amplification of Pt nanoprobes for non-diagnostic purposes according to claim 1, characterized in that: In step 1), Pt NPs are prepared by the following redox method; preferably, the following method is used for preparation: H2PtCl4.6H2O is added with KOH and L-ascorbic acid; the mixture is stirred at 40-80°C, preferably at 60°C until it turns black and has a metallic luster, and stirring is continued at room temperature to obtain Pt NPs, which are stored at 4°C for subsequent use.

3. The method for detecting miRNA based on double cascade amplification of Pt nanoprobes for non-diagnostic purposes according to claim 1, characterized in that: The miRNA is miR-15a-5p, and the sequence is: 5'UAGC AGCA CAUA AUGG UUUG UG-3'.

4. The method for detecting miRNA based on double cascade amplification of Pt nanoprobes for non-diagnostic purposes according to claim 3, characterized in that: In step 2), the ISAR / Cas12a reaction solution was prepared in the following manner: dNTPs, hDNA probes, DNA primers and BST polymerase were added to miRNAs of different concentrations, and the reaction was carried out at 37° C. for 30 minutes; Cas12a, crRNA and digoxin / ssDNA / biotin were then added and incubated at 37° C. for 45 minutes to obtain ISAR / Cas12a reaction solutions containing miRNAs of different concentrations; The stem-loop structure of the hDNA probe is: 5'CATCGTCCTAGTTTACGTCGCCGTCCAACTCACAAACCATTATGTGCTGCTAGGACGATG-3'; the DNA primer is 5'CCTGCTAC-3'; the sequence of crRNA is: 5'UAAUUUCUAAGUGUAGAU CGUCGCCGUCCAACU-3'; the reporter molecule ssDNA sequence is: 5'Digoxin-TTTTTTTTTT-Biotin.

5. The method for detecting miRNA based on double cascade amplification of Pt nanoprobes for non-diagnostic purposes according to claim 4, characterized in that: In step 2), the amount of Pt NPs@Ab nanoprobe added to the ISAR / Cas12a reaction solution is 0.5-3 μL / 60 μL; preferably 2 μL / 60 μL.

6. The method for detecting miRNA based on double cascade amplification of Pt nanoprobes for non-diagnostic purposes according to claim 1, characterized in that: The quenching substrate in step 3) is one of 3,3',5,5'-tetramethylbenzidine TMB, 2,2-azo-bis(3-ethyl-benzothiazole-6-sulfonic acid) diammonium salt ABTS, o-phenylenediamine OPD and 3,3'-diaminobenzidine tetrahydrochloride DAB; preferably 3,3',5,5'-tetramethylbenzidine TMB; preferably, the amount of TMB added to the ISAR / Cas12a reaction solution is 0.4-1.2 μL / 60 μL; preferably 1 μL / 60 μL.

7. The method for detecting miRNA based on double cascade amplification of Pt nanoprobes for non-diagnostic purposes according to claim 1, characterized in that: The chromatography reaction takes 5-25 min, preferably 20 min.

8. The method for detecting miRNA based on double cascade amplification of Pt nanoprobes for non-diagnostic purposes according to claim 1, characterized in that: In step 3), the nucleic acid test strip is prepared in the following manner: SA-Cy5 and goat anti-mouse secondary antibody are streaked onto the nitrocellulose membrane as T line and C line respectively, and the test strip card and sample pad, binding pad, NC membrane, and absorption pad are assembled to form a nucleic acid test strip; the catalysis time in step 3) is 0-120s; preferably 90s.

9. The method for detecting miRNA based on double cascade amplification of Pt nanoprobes for non-diagnostic purposes according to claim 1, characterized in that: In step 3), the concentration of miRNA is inversely proportional to the visual result of T line, and is directly proportional to the fluorescence intensity result.

10. A kit, characterized in that: It includes the nucleic acid test paper, the ISAR / Cas12a reaction solution without miRNA, and the Pt NPs@Ab nanoprobe.

Images