Nucleic acid incubation liquid, kit and method for extracting nucleic acid of mycobacterium tuberculosis

Abstract

The invention discloses a nucleic acid incubation solution, a kit and a method for extracting nucleic acid. The nucleic acid incubation solution comprises 5 mg / mL-20 mg / mL of variant bacteriolysin, 5 mg / mL-20 mg / mL of alpha-amylase and 1 wt%-20 wt% of an anionic surfactant. According to the method, the to-be-detected sample is incubated in the nucleic acid incubation liquid containing the variable bacteriolysin, the alpha-amylase and the anionic surfactant with certain concentrations, then the nucleic acid release liquid, the nucleic acid precipitation liquid and other reagents are used for extracting the mycobacterium tuberculosis nucleic acid, the extracted nucleic acid product is good in quality, and the integrity of the extracted nucleic acid product can be kept; and the method has the advantages of short time consumption, high efficiency, simplicity and convenience in operation, low cost, safety, harmlessness and convenience in storage and transportation of the sample.

Description

Technical Field

[0001] The present invention belongs to the technical field of nucleic acid extraction, and more specifically, the present invention relates to a nucleic acid incubation solution, a kit and a method for extracting nucleic acid of Mycobacterium tuberculosis. Background Art

[0002] Mycobacterium tuberculosis (MTB) is the main pathogen that causes tuberculosis (TB). The cell wall structure of MTB is complex, consisting of multiple components such as polysaccharides and lipids. These components are tightly connected by covalent and non-covalent bonds, forming a highly ordered and dense structure. This complex structure makes it difficult to lyse the cell wall by conventional methods, thereby increasing the difficulty of nucleic acid extraction.

[0003] At present, the Mycobacterium tuberculosis nucleic acid products or extraction methods commonly used in the market or laboratories mainly include the following:

[0004] 1. CTAB (cetyltrimethylammonium bromide) method

[0005] The most commonly used method for extracting Mycobacterium tuberculosis nucleic acid in the laboratory is to incubate with lysozyme for 16 to 20 hours, then add sodium dodecyl sulfate (SDS) and proteinase K to remove proteins and other impurities in the sample. After chromatographic separation of nucleic acids using CTAB and chloroform-isoamyl alcohol, the nucleic acids are precipitated with isopropanol and washed with 75% ethanol to obtain Mycobacterium tuberculosis nucleic acid. The CTAB extraction process is very time-consuming and requires strict control of temperature and time. Residual organic components may inhibit subsequent molecular detection such as PCR. Multiple washing and purification steps are required, and the operation is relatively cumbersome. Chloroform and isoamyl alcohol are both hazardous chemicals, which pose certain risks to operators.

[0006] 2. Magnetic bead method

[0007] By utilizing the specific adsorption capacity of magnetic beads, nucleic acids can be extracted efficiently and quickly. It can also be automated and is suitable for high-throughput sample processing. The use of magnetic beads in the magnetic bead method is relatively expensive and requires specialized magnetic bead extraction equipment, which increases the cost of testing and has certain requirements for laboratory conditions.

[0008] 3. High temperature method, strong alkali method, strong acid method

[0009] High temperature / strong alkali / strong acid can quickly destroy the cell wall, effectively destroy the outer membrane structure of tuberculosis bacteria, and release nucleic acids, proteins and other biological molecules in the cell. High temperature / strong alkali / strong acid will cause certain damage to nucleic acid molecules and cause double-stranded DNA molecules to unwind, resulting in some detection work that relies on double-stranded DNA (such as DNA nucleic acid quality detection before gene sequencing) being unable to detect normally and accurately.

[0010] 4. Bead milling

[0011] The bead milling method uses a high-speed stirrer or vibrator to quickly stir samples containing tiny glass beads or metal beads, thereby destroying the cell wall of Mycobacterium tuberculosis through mechanical friction and impact force. It is particularly suitable for treating bacteria that are difficult to break the cell wall. It has high cell wall breaking efficiency and uniform sample processing. The bead milling method is mostly manual processing and is only suitable for small-scale laboratory research. It cannot extract nucleic acids from large batches of samples, and the cost of using equipment for large-scale application is high.

[0012] 5. Ultrasonic method

[0013] The ultrasonic cell wall breaking method uses the cavitation effect produced by high-frequency ultrasound to quickly destroy the cell wall through local high pressure and high temperature. Ultrasound can effectively destroy the outer membrane structure of Mycobacterium tuberculosis and release biological molecules such as nucleic acids and proteins in the cell. This method has the advantages of simple operation and high cell wall breaking efficiency. The use of ultrasound requires precise adjustment of the energy of ultrasound, otherwise it may cause sample overheating or nucleic acid degradation, and most testing laboratories do not have ultrasound equipment.

[0014] In summary, all the current methods for extracting Mycobacterium tuberculosis nucleic acid have their shortcomings. The Mycobacterium tuberculosis nucleic acid extraction kits currently on the market are only suitable for PCR and qPCR amplification and detection, and there are no kits that can be used for high-throughput sequencing. If you want to perform drug resistance analysis and genome analysis on Mycobacterium tuberculosis, you still need to use the traditional and extremely time-consuming CTAB method. Therefore, there is an urgent need to innovate and develop a Mycobacterium tuberculosis nucleic acid extraction reagent that is time-saving, low-cost, safe and harmless, universal in laboratories, does not require specific dedicated instruments, has good nucleic acid product quality and can maintain its integrity, and will not affect subsequent PCR amplification, high-throughput sequencing and other downstream analyses. Summary of the invention

[0015] Based on this, the object of the present invention is to provide a nucleic acid incubation solution, a kit and a method for extracting Mycobacterium tuberculosis nucleic acid. After the sample to be tested is incubated in the nucleic acid incubation solution, the nucleic acid is extracted. The extracted nucleic acid has high concentration and high quality and will not affect subsequent downstream analysis such as PCR amplification and high-throughput sequencing.

[0016] The specific technical solutions for achieving the above-mentioned invention objectives include the following.

[0017] In a first aspect of the present invention, a nucleic acid incubation solution for extracting nucleic acid is provided, wherein the nucleic acid incubation solution comprises 5 mg / mL to 20 mg / mL mutanolysin, 5 mg / mL to 20 mg / mL α-amylase and 1 wt% to 20 wt% anionic surfactant.

[0018] The second aspect of the present invention provides a kit for extracting nucleic acid from Mycobacterium tuberculosis, the kit comprising the above-mentioned nucleic acid incubation solution and a nucleic acid releasing solution, wherein the nucleic acid releasing solution is 3M to 8M guanidine salt.

[0019] The third aspect of the present invention provides a method for extracting Mycobacterium tuberculosis nucleic acid using the above kit, comprising the following steps:

[0020] (1) Centrifuge the sample to be tested, collect the bacteria, and add nucleic acid incubation solution for incubation;

[0021] (2) Add nucleic acid release solution, lyse the solution, and centrifuge at high speed to obtain the supernatant;

[0022] (3) Add nucleic acid precipitation solution, centrifuge instantly, let stand and collect supernatant;

[0023] (4) Place the adsorption column in a collection tube, transfer the supernatant to the adsorption column, centrifuge, and discard the filtrate in the collection tube;

[0024] (5) Reinstall the adsorption column in the collection tube, add the purified solution to the adsorption column, centrifuge, discard the filtrate in the collection tube, reinstall the adsorption column in the collection tube, empty the column, centrifuge, and spin dry the adsorption column;

[0025] (6) Transfer the adsorption column to a new centrifuge tube, add TE buffer or sterile enzyme-free water to the center of the adsorption column membrane, let it stand at room temperature, centrifuge, discard the adsorption column, and collect the nucleic acid.

[0026] We found that by using a certain concentration of mutanolysin, α-amylase and anionic surfactant in combination as the nucleic acid incubation solution in the nucleic acid extraction reagent, incubating the Mycobacterium tuberculosis sample to be tested, and then using nucleic acid release solution, nucleic acid precipitation solution and other reagents to extract Mycobacterium tuberculosis nucleic acid, the extracted nucleic acid product has good quality and can maintain its integrity, will not affect subsequent PCR amplification, and can be used for downstream analysis such as high-throughput sequencing.

[0027] The method for extracting Mycobacterium tuberculosis nucleic acid of the present invention is time-saving and highly efficient (the extraction time required for a single sample in the whole process is 20 minutes to 30 minutes, which greatly improves the extraction efficiency compared with the traditional CTAB method, and a large number of samples can be extracted simultaneously), simple to operate (the whole process has only 6 steps, and all of them are commonly used operations for experimenters, and the experimenters can easily master and use them without special training), low cost (no specific dedicated instruments are required, and no high-cost auxiliary means such as magnetic beads, glass beads, ultrasonic instruments, and high-precision automation instruments are required. Only oscillators, water baths / metal baths, high-speed centrifuges and other commonly used laboratory instruments are required), safe and harmless (the reagent components do not contain hazardous chemicals such as chloroform and isoamyl alcohol, which will not cause physical harm to the operator and will not pollute the environment), and convenient for sample storage and transportation (the nucleic acid incubation solution uses biological enzymes and can be incubated at 37° C. or room temperature for 24 hours. Transporting and placing samples at room temperature does not affect the final extraction efficiency). BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 The agarose gel electrophoresis diagram of nucleic acids extracted with different concentrations of mutanolysin in Example 3 of the present invention; wherein, lane 1: 1 mg / mL, lane 2: 5 mg / mL, lane 3: 10 mg / mL.

[0029] Figure 2 The agarose gel electrophoresis diagram of nucleic acids extracted using different concentrations of mutanolysin and lysozyme in Example 4 of the present invention; wherein, lane 1: 5 mg / mL lysozyme, lane 2: 15 mg / mL mutanolysin, lane 3: 5 mg / mL mutanolysin, lane 4: 0 mg / mL mutanolysin.

[0030] Figure 3 This is an agarose gel electrophoresis diagram of nucleic acids extracted using different concentrations of α-amylase in Example 5 of the present invention; wherein, lane 1: 10 mg / mL, lane 2: 5 mg / mL, lane 3: 1 mg / mL, lane 3: 0.1 mg / mL.

[0031] Figure 4 This is an agarose gel electrophoresis diagram of nucleic acids extracted using different concentrations of α-amylase and lysozyme in Example 6 of the present invention; wherein, lane 1: 10 mg / mL lysozyme, lane 2: 15 mg / mL α-amylase, lane 3: 10 mg / mL α-amylase, lane 4: 0 mg / mL α-amylase.

[0032] Figure 5 This is an agarose gel electrophoresis diagram of nucleic acids extracted using different concentrations of SDS in Example 7 of the present invention; lane 1: 0 mg / mL, lane 2: 1 mg / mL, lane 3: 5 mg / mL.

[0033] Figure 6 This is an agarose gel electrophoresis diagram of nucleic acids extracted using different concentrations of guanidine isothiocyanate in Example 8 of the present invention; wherein lane 1: 4M, lane 2: 5M, lane 3: 6M, lane 4: 7M.

[0034] Figure 7 This is an agarose gel electrophoresis diagram of the nucleic acid extracted by using different incubation temperatures and times in Example 9 of the present invention; wherein, lane 1: 50°C 60 min, lane 2: 50°C 20 min, lane 3: 50°C 10 min, lane 4: 37°C 60 min, lane 5: 37°C 20 min.

[0035] Figure 8 This is a comparison of qPCR-CT values ​​of nucleic acids extracted using different pretreatment methods in Example 11 of the present invention. DETAILED DESCRIPTION

[0036] In order to facilitate the understanding of the present invention, the present invention will be described more fully below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0037] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art to which the present invention belongs. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used in the present invention includes any and all combinations of one or more of the related listed items.

[0038] Unless otherwise specified, the examples are all based on conventional experimental conditions or the conditions recommended by the manufacturer's instructions. The raw materials and reagents used in the present invention are all commercially available, and any biological germplasm material can be provided to the outside for scientific research.

[0039] In some embodiments of the present invention, a nucleic acid incubation solution for extracting nucleic acid is disclosed, which includes 5 mg / mL to 20 mg / mL mutanolysin, 5 mg / mL to 20 mg / mL α-amylase and 1 wt% to 20 wt% anionic surfactant.

[0040] Mutanolysin is an enzyme derived from Streptomyces (such as Streptomyces globisporus). Similar to lysozyme, it can cut N-acetylmuramoyl-β(1-4)-NN-acetylglucosamine in the peptidoglycan-polysaccharide complex in the cell wall and lyse the bacterial cell wall. α-Amylase helps to lyse the cell wall by degrading the polysaccharide components in the cell wall, making it easier for nucleic acids to be released from the cell. SDS is a strong anionic detergent that can destroy the cell membrane structure, release the nucleic acid in the cell, and bind to the protein to denature and precipitate it, thereby achieving the separation of nucleic acid and protein, which is beneficial to the subsequent purification of nucleic acid. We found that the organic combination of these three has a good effect on the extraction of nucleic acid, especially for the extraction of Mycobacterium tuberculosis nucleic acid. It can not only completely release the nucleic acid in the cell, but also will not cause degradation during the extraction process, and can well ensure the integrity of the nucleic acid. And through the subsequent corresponding nucleic acid release solution and nucleic acid precipitation solution, the integrity of the nucleic acid can continue to be maintained, and the purity of the nucleic acid can be maintained. Moreover, the entire extraction method is time-saving and the operation is very simple and convenient.

[0041] In some embodiments, the concentration of the mutanolysin is 5 mg / mL to 10 mg / mL, the concentration of the α-amylase is 5 mg / mL to 15 mg / mL, and the concentration of the anionic surfactant is 1 wt % to 10 wt %.

[0042] In some embodiments, the concentration of the mutanolysin is 5 mg / mL to 6 mg / mL, the concentration of the α-amylase is 8 mg / mL to 12 mg / mL, and the concentration of the anionic surfactant is 4 wt % to 6 wt %.

[0043] In some embodiments, the anionic surfactant is sodium dodecyl sulfate (SDS); the concentration of mutanolysin is 5 mg / mL to 6 mg / mL, the concentration of α-amylase is 8 mg / mL to 12 mg / mL, and the concentration of sodium dodecyl sulfate is 4 wt % to 6 wt %.

[0044] In some embodiments, the kit further comprises a nucleic acid releasing solution, a nucleic acid precipitation solution and a purification solution.

[0045] In some embodiments, the nucleic acid release solution is 3M to 8M guanidine salt, more preferably 4M to 7M guanidine salt; the nucleic acid precipitation solution is isopropanol; the purification solution is 70% to 80% ethanol. The guanidine salt is preferably guanidine isothiocyanate, and the nucleic acid can be precipitated by isopropanol. At this time, the solution (mixed liquid after adding nucleic acid incubation solution, nucleic acid release solution, and nucleic acid precipitation solution) is centrifuged through an adsorption column, and the nucleic acid will be adsorbed on the filter membrane. The purification solution is 75% ethanol, prepared with sterile enzyme-free water. Its function is to add it to the adsorption column and then centrifuge to wash the nucleic acid, then add TE buffer or enzyme-free sterile water to dissolve the nucleic acid on the filter membrane, and collect high-purity nucleic acid by centrifugation.

[0046] In other embodiments of the present invention, a method for extracting Mycobacterium tuberculosis nucleic acid is disclosed, comprising the following steps:

[0047] (1) Centrifuge the sample to be tested, collect the bacteria, and add nucleic acid incubation solution for incubation;

[0048] (2) Add nucleic acid release solution, lyse the solution, and centrifuge at high speed to obtain the supernatant;

[0049] (3) Add nucleic acid precipitation solution, centrifuge instantly, let stand and collect supernatant;

[0050] (4) Place the adsorption column in a collection tube, transfer the supernatant to the adsorption column, centrifuge, and discard the filtrate in the collection tube;

[0051] (5) Reinstall the adsorption column in the collection tube, add the purified solution to the adsorption column, centrifuge, discard the filtrate in the collection tube, reinstall the adsorption column in the collection tube, empty the column, centrifuge, and spin dry the adsorption column;

[0052] (6) Transfer the adsorption column to a new centrifuge tube, add TE buffer or sterile enzyme-free water to the center of the adsorption column membrane, let it stand at room temperature, centrifuge, discard the adsorption column, and collect the nucleic acid.

[0053] In some embodiments, the incubation temperature in step (1) is 37°C to 50°C, and the incubation time is 20min to 60min; preferably, the incubation temperature is 37°C to 38°C, and the incubation time is 20min to 30min.

[0054] In the following examples, mutanolysin (Cat. No.: M9901, derived from Streptomyces sphaeroides) and α-amylase (Cat. No.: 10065, derived from Aspergillus oryzae) used were purchased from Sigma-Aldrich (Shanghai) Trading Co., Ltd. YeaRed nucleic acid dye and DNA Marker (GoldBand DL5,000) were purchased from Yisheng Biotechnology (Shanghai) Co., Ltd. Other raw materials and reagents not specified were commercially available.

[0055] The present invention is described in detail below with reference to the accompanying drawings and specific embodiments.

[0056] Example 1 Kit for extracting Mycobacterium tuberculosis nucleic acid

[0057] This embodiment provides a kit for extracting Mycobacterium tuberculosis, comprising:

[0058] 1. Nucleic acid incubation solution: composed of 5 mg / mL mutanolysin, 10 mg / mL α-amylase, and 5% SDS (preparation method: weigh 0.05 g mutanolysin, 0.1 g α-amylase, and 0.5 g SDS, add sterile enzyme-free water to dissolve and make up to 10 mL).

[0059] 2. Nucleic acid release solution: 6M guanidine isothiocyanate.

[0060] 3. Nucleic acid precipitation solution: isopropanol.

[0061] 4. Purification solution: 75% ethanol solution.

[0062] Example 2 Method for extracting Mycobacterium tuberculosis nucleic acid

[0063] This embodiment provides a method for extracting Mycobacterium tuberculosis nucleic acid, comprising the following steps:

[0064] 1. Take 1mL to 1.5mL of the sample to be tested (such as clinical patient samples or cultured Mycobacterium tuberculosis) in a centrifuge tube, remove the supernatant by high-speed centrifugation, and wash the bacteria 2 to 3 times until the preservation solution or culture medium of the bacteria is clean. Then add 100μLTE buffer or sterile enzyme-free water to the bacteria, add 200μL nucleic acid incubation solution, mix gently, and incubate at 37℃ for 20min;

[0065] 2. Add 500 μL of nucleic acid release solution to the centrifuge tube, mix well, lyse for 2 minutes, and centrifuge at 15,000 rpm for 1 minute;

[0066] 3. Collect the supernatant after centrifugation into a new centrifuge tube, add 600 μL of nucleic acid precipitation solution, mix well, centrifuge for 3s to 5s, and let stand for 2min;

[0067] 4. Place the adsorption column in the collection tube, transfer 700 μL to 800 μL of the supernatant from the previous step to the adsorption column, and centrifuge at 12,000 rpm for 30 seconds; discard the filtrate in the collection tube, and repeat this step until the supernatant is filtered from the adsorption column;

[0068] 5. Reinstall the adsorption column in the collection tube, add 600 μL of purification solution to the adsorption column, and centrifuge at 12000 rpm for 30 seconds; pour out the filtrate in the collection tube, reinstall the adsorption column in the collection tube, empty the column, and centrifuge at 12000 rpm for 30 seconds to dry the adsorption column;

[0069] 6. Transfer the adsorption column to a new centrifuge tube, add 50μLTE buffer or sterile enzyme-free water to the center of the adsorption column membrane, let stand at room temperature for 2 minutes, and centrifuge at 12000rpm for 30 seconds; discard the adsorption column, collect the nucleic acid, and store it at -80℃.

[0070] Example 3 Comparison of the Effect of Mutanolysin Concentration on the Quality of Extracted Nucleic Acids

[0071] Using 1 mL of cultured Mycobacterium tuberculosis (from the Chinese Center for Disease Control and Prevention) bacterial solution as a sample, nucleic acid was extracted using the kit of Example 1 (the concentration of mutanolysin in the nucleic acid incubation solution was 1 mg / mL, 5 mg / mL, and 10 mg / mL, respectively, and the rest was the same as Example 1) and the method of Example 2.

[0072] 1. Use agarose gel electrophoresis to detect the quantity and quality of the extracted nucleic acid samples. The agarose gel electrophoresis method is as follows: weigh an appropriate amount of agarose at a ratio of 1%, place it in a conical flask, and add the corresponding volume of 1×TAE electrophoresis buffer. Place the conical flask in a microwave and heat until the agarose is completely dissolved. When cooled to 50℃~60℃, add YeaRed nucleic acid dye 10000× aqueous solution (referred to as nucleic acid dye) (add 5μL nucleic acid dye solution to every 50mL agarose solution). Pour the agarose solution containing nucleic acid dye into the gelator and insert the comb. Solidify at room temperature for about 30min~60min. Pull out the comb for standby use. Place the gel in the electrophoresis tank, add an appropriate amount of 1×TAE electrophoresis buffer in the electrophoresis tank, make sure that the liquid surface covers the gel, and make sure that one end of the spot hole is close to the negative pole of the electrophoresis tank. Add 10 μL DNA Marker and the sample to be tested mixed with Loading buffer to the sample wells (add 2.5 μL 5×DNA Loading buffer to every 10 μL sample to be tested). Connect the electrophoresis tank to a power source with a power supply parameter of 120V-30min. After the electrophoresis is completed, remove the gel, observe the DNA bands on the gel plate under ultraviolet light, and use a gel imaging system to take photos and record.

[0073] Agarose gel electrophoresis results Figure 1 As shown. Figure 1It can be seen that when the concentration of mutanolysin is 1 mg / mL, no bands appear in the extracted nucleic acid sample in agarose gel electrophoresis. When the concentration of mutanolysin is 5 mg / mL and 10 mg / mL, obvious bands appear in the extracted nucleic acid sample in agarose gel electrophoresis, indicating that the concentration of mutanolysin in the nucleic acid incubation solution has a significant effect on the quality of the extracted nucleic acid.

[0074] 2. Use the HiScript II One Step qRT-PCR SYBR Green Kit (Cat. No.: Q221-01) purchased from Novozymes to perform fluorescence quantitative qPCR on the samples with electrophoresis bands to verify their yield, including the following steps:

[0075] (1) Synthetic primers for the Mycobacterium tuberculosis gene IS1018

[0076] F(SEQ ID NO:1):CCTGCTGCACTCCATCTAC

[0077] R(SEQ ID NO:2):CGTCGAGTACCCGATCATAT

[0078] (2) Prepare a fluorescence quantitative qPCR reaction system and perform a fluorescence quantitative PCR reaction. The reaction system is shown in Table 1, and the reaction procedure is shown in Table 2.

[0079] Table 1

[0080]

[0081]

[0082] Table 2

[0083]

[0084] (3) Analyze the amplification curve and melting curve and calculate the CT value

[0085] 3. Entrust Annoroad Gene Technology (Beijing) Co., Ltd. to conduct quality testing before high-throughput sequencing. The company's feedback results are judged as B or above as qualified (judgment rules: A. Concentration ≥ 5ng / μL, electrophoresis bands are clear, samples are qualified, the total sample volume meets the total volume for two library constructions, and the quality meets the subsequent library construction requirements; B. Concentration ≥ 5ng / μL, electrophoresis bands are clear, samples are qualified, the total sample volume meets the library construction requirements once but less than twice, and some quality indicators are slightly low or qualified; C. Concentration ≥ 5ng / μL, electrophoresis bands are not clear, and some indicators of the sample do not fully meet the library construction requirements. The library can be built at risk, but the sequencing quality may be affected; D. Concentration ≤ 5ng / μL, no electrophoresis bands, some or all indicators of the sample do not meet the library construction requirements at all, and the sample is not recommended).

[0086] The results are shown in Table 3.

[0087] Table 3

[0088]

[0089] The results in Table 3 show that when the concentration of mutanolysin is 1 mg / mL, the concentration of the extracted nucleic acid is very low, and the quality inspection is judged as Class C, which is unqualified. When the concentration of mutanolysin is 5 mg / mL and 10 mg / mL, the concentration of the extracted nucleic acid is significantly improved, and the quality is good, and the quality inspection is judged as Class B, which is qualified. qPCR has a lower Ct value, among which, when the concentration of mutanolysin is 5 mg / mL, the Ct value is lower and the effect is better. Example 4 Comparison of the effects of different concentrations of mutanolysin and lysozyme on the quality of extracted nucleic acids

[0090] Using 1 mL of cultured Mycobacterium tuberculosis bacterial solution as a sample, nucleic acid was extracted using the kit of Example 1 (the mutanolysin in the nucleic acid incubation solution was 0 mg / mL, 5 mg / mL, and 15 mg / mL, respectively, and the mutanolysin was replaced by 5 mg / mL lysozyme, and the rest was the same as Example 1) and the method of Example 2.

[0091] The extracted nucleic acid samples were verified by agarose gel electrophoresis in Example 3, and the results were as follows: Figure 2 As shown. Figure 2 It can be seen that when the concentration of mutanolysin is 0 mg / mL, the bands of the extracted nucleic acid sample in agarose gel electrophoresis are weak. When the concentration of mutanolysin is 5 mg / mL and 15 mg / mL, or 5 mg / mL mutanolysin is replaced by 5 mg / mL lysozyme, the extracted nucleic acid sample shows obvious bands in agarose gel electrophoresis.

[0092] The qPCR method of Example 3 was used for verification, and Annoroad Gene Technology (Beijing) Co., Ltd. was commissioned to perform quality inspection (same as Example 3). The results are shown in Table 4.

[0093] Table 4

[0094]

[0095]

[0096] The results in Table 4 show that when the concentration of mutanolysin is 0, the concentration of the extracted nucleic acid is low, and the quality inspection is judged as Class C, which is unqualified, and the Ct value is also very high; when the concentration of mutanolysin is 5 mg / mL and 15 mg / mL, or when mutanolysin is replaced by lysozyme, the quality inspection of the extracted nucleic acid is Class B, which is qualified, but the concentration of nucleic acid extracted by the nucleic acid incubation solution containing 5 mg / mL lysozyme is very low, significantly lower than the concentration of nucleic acid extracted by the nucleic acid incubation solution containing 5 mg / mL mutanolysin. Compared with 15 mg / mL mutanolysin, when 5 mg / mL mutanolysin is used, the concentration of extracted nucleic acid is higher, has a lower Ct value, and the quality of the extracted nucleic acid is the best.

[0097] Example 5 Comparison of the Effect of α-Amylase Concentration on the Quality of Extracted Nucleic Acids

[0098] 1 mL of cultured Mycobacterium tuberculosis was used as a sample, and nucleic acid was extracted using the kit of Example 1 (the α-amylase in the nucleic acid incubation solution was 10 mg / mL, 5 mg / mL, 1 mg / mL, and 0.1 mg / mL, respectively, and the rest was the same as in Example 1) and the method of Example 2. The extracted nucleic acid sample was verified by agarose gel electrophoresis in Example 3, and the results were as follows: Figure 3 As shown. Figure 3 It can be seen that when the concentration of α-amylase is 1 mg / mL and 0.1 mg / mL, no bands appear in the extracted nucleic acid samples in agarose gel electrophoresis. When the concentration of α-amylase is 5 mg / mL and 10 mg / mL, obvious bands appear in the extracted nucleic acid samples in agarose gel electrophoresis, indicating that the concentration of α-amylase in the nucleic acid incubation solution also has a significant effect on the quality of the extracted nucleic acid.

[0099] The qPCR method of Example 3 was used for verification, and Annoroad Gene Technology (Beijing) Co., Ltd. was commissioned to perform quality inspection (same as Example 3). The results are shown in Table 5.

[0100] Table 5

[0101]

[0102]

[0103] The results in Table 5 show that when the concentration of α-amylase is 0.1 mg / mL, the concentration of extracted nucleic acid is significantly lower, and the Ct value cannot be detected by qPCR detection; when the concentration of α-amylase is 1 mg / mL, the concentration of extracted nucleic acid is greatly improved, but the Ct value cannot be detected by qPCR detection, and when the concentration is 0.1 mg / mL and 1 mg / mL, the quality inspection judgment is C level, which is unqualified. When the concentration of α-amylase is 5 mg / mL and 10 mg / mL, the concentration of extracted nucleic acid is high, the quality is good, and the quality inspection judgment is B level, which is qualified and has a lower Ct value. Among them, when the concentration of α-amylase is 10 mg / mL, the Ct value is lower and the effect is better.

[0104] Example 6 Comparison of the effects of different concentrations of α-amylase and lysozyme on the quality of extracted nucleic acids

[0105] Using 1 mL of cultured Mycobacterium tuberculosis bacterial solution as a sample, nucleic acid was extracted using the kit of Example 1 (the α-amylase in the nucleic acid incubation solution was 0 mg / mL, 10 mg / mL, and 15 mg / mL, respectively, and the α-amylase was replaced by 10 mg / mL lysozyme, and the rest was the same as Example 1) and the method of Example 2.

[0106] The extracted nucleic acid samples were verified by agarose gel electrophoresis in Example 3, and the results were as follows: Figure 4 As shown. Figure 4 It can be seen that when the concentration of α-amylase is 0 mg / mL, no bands appear in the extracted nucleic acid sample in agarose gel electrophoresis. When the concentration of α-amylase is 10 mg / mL and 15 mg / mL, or when 10 mg / mL α-amylase is replaced with 10 mg / mL lysozyme, obvious bands appear in the extracted nucleic acid sample in agarose gel electrophoresis.

[0107] The qPCR method of Example 3 was used for verification, and Annoroad Gene Technology (Beijing) Co., Ltd. was commissioned to perform quality inspection (same as Example 3). The results are shown in Table 6.

[0108] Table 6

[0109]

[0110]

[0111] The results in Table 6 show that when the concentration of α-amylase is 0, the concentration of the extracted nucleic acid is low, and the quality inspection is judged as Class C, which is unqualified, and the Ct value cannot be detected; when the concentration of α-amylase is 10 mg / mL and 15 mg / mL, or α-amylase is replaced by lysozyme, the quality inspection of the extracted nucleic acid is Class B, which is qualified, but the concentration of nucleic acid extracted by the nucleic acid incubation solution containing 10 mg / mL lysozyme is very low, significantly lower than the concentration of nucleic acid extracted by the nucleic acid incubation solution containing 10 mg / mL α-amylase. Compared with α-amylase at 15 mg / mL, when α-amylase is 10 mg / mL, the extracted nucleic acid concentration is higher, has a lower Ct value, and the extracted nucleic acid has the best quality.

[0112] Example 7 Comparison of the Effect of SDS Concentration on the Quality of Extracted Nucleic Acids

[0113] 1 mL of cultured Mycobacterium tuberculosis was used as a sample, and nucleic acid was extracted using the kit of Example 1 (the SDS in the nucleic acid incubation solution was 0, 1 wt%, and 5 wt%, respectively, and the rest was the same as in Example 1) and the method of Example 2. The extracted nucleic acid sample was verified by agarose gel electrophoresis in Example 3, and the results were as follows: Figure 5 As shown. Figure 5 It can be seen that, compared with the SDS concentration of 0% or 1%, when the SDS concentration is 5%, the bands of the extracted nucleic acid sample in agarose gel electrophoresis are significantly brighter.

[0114] The samples were then verified using the qPCR method of Example 3, and quality testing was performed by Annoroad Gene Technology (Beijing) Co., Ltd. (same as Example 3). The results are shown in Table 7.

[0115] Table 7

[0116]

[0117] The results in Table 7 show that when the concentration of SDS is 1% and 5%, the quality of the extracted nucleic acid is good, and the quality inspection is judged as Class B, which is qualified; when the concentration of SDS is 0%, the concentration of the extracted nucleic acid is very low, and the quality inspection is judged as Class C, which is unqualified. When the concentration of SDS is 5%, the Ct value is lower and the effect is better.

[0118] Example 8 Comparison of the Effect of Guanidine Thiocyanate Concentration on the Quality of Extracted Nucleic Acids

[0119] 1 mL of cultured Mycobacterium tuberculosis bacterial liquid was used as a sample, and nucleic acid was extracted using the kit of Example 1 (the concentrations of nucleic acid release agent guanidine isothiocyanate were 4M, 5M, 6M, and 7M, respectively, and the rest were the same as in Example 1) and the method of Example 2. The extracted nucleic acid sample was verified by agarose gel electrophoresis in Example 3, and the results were as follows: Figure 6 As shown. Figure 6 It can be seen that the nucleic acid samples extracted with guanidine isothiocyanate of different concentrations all have obvious bands in agarose gel electrophoresis.

[0120] The samples were then verified using the qPCR method of Example 3, and quality testing was performed by Annoroad Gene Technology (Beijing) Co., Ltd. (same as Example 3). The results are shown in Table 8.

[0121] Table 8

[0122]

[0123] The results in Table 8 show that the quality of nucleic acids extracted by guanidine isothiocyanate at different concentrations is good, and the quality inspection is judged to be Class B, which is qualified. Among them, when the concentration of guanidine isothiocyanate is 6M, the Ct value is lower and the effect is better.

[0124] Example 9 Comparison of the Effect of Incubation Temperature on the Quality of Extracted Nucleic Acids

[0125] 1 mL of cultured Mycobacterium tuberculosis bacterial liquid was used as a sample, and nucleic acid was extracted using the kit of Example 1 and the method of Example 2 (incubation time and temperature were: 50°C 60 min, 50°C 30 min, 50°C 20 min, 37°C 60 min, 37°C 20 min, respectively). The extracted nucleic acid sample was verified by agarose gel electrophoresis of Example 3, and the results were as follows: Figure 7 As shown. Figure 7 It can be seen that the nucleic acid samples extracted using different incubation temperatures and times all have obvious bands in agarose gel electrophoresis.

[0126] The samples were then verified using the qPCR method of Example 3, and quality testing was commissioned to Annoroad Gene Technology (Beijing) Co., Ltd. The results are shown in Table 9.

[0127] Table 9

[0128]

[0129] The results in Table 9 show that the quality of nucleic acids extracted at different incubation temperatures and times is good, and the quality inspection judgment is all Class B, which is qualified. Among them, since the bands at 37°C are brighter than those at 60°C, considering saving time and improving efficiency, incubation at 37°C for 20 minutes is preferred.

[0130] Example 10 Comparison of the effects of different extraction methods on the quality of extracted nucleic acids

[0131] Four 1 mL cultured Mycobacterium tuberculosis bacterial suspensions were used as samples, and nucleic acid was extracted using the kit of Example 1, the method of Example 2, and the CTAB method (a traditional Mycobacterium tuberculosis extraction method in the laboratory) for comparison.

[0132] The CTAB method includes the following steps:

[0133] (1) Collect Mycobacterium tuberculosis cells in a centrifuge tube, centrifuge at 12000 rpm for 5 min, discard the supernatant, resuspend the cell pellet in 400 μL TE, add 50 μL lysozyme (10 mg / mL), mix well, and incubate at 37°C for 16 to 20 hours;

[0134] (2) Add 70 μL of 10% SDS and 5 μL of proteinase K (20 mg / mL) solution, mix well, and incubate at 65°C for 10 min;

[0135] (3) Add 100 μL of 5 M NaCl and 100 μL of CTAB / NaCl mixture, vortex until the liquid turns milky white, and incubate at 65°C for 10 min;

[0136] (4) Add 750 μL of chloroform / isoamyl alcohol (24:1) mixture, mix thoroughly by inversion, centrifuge at 12,000 rpm for 5 min, transfer the supernatant to another centrifuge tube, add 0.6 times the volume of ice-cold isopropanol to precipitate DNA, place at -20°C for 30 min, and centrifuge at 12,000 rpm for 15 min;

[0137] (5) Discard the supernatant and wash the DNA precipitate with 1 mL of 75% ice ethanol; centrifuge at 12,000 rpm for 5 min; remove as much liquid as possible from the tube and dry at 37°C for 10 min;

[0138] (6) Dissolve the DNA precipitate in 50 μL TE and store at 4°C until use.

[0139] The extracted nucleic acid samples were verified by qPCR in Example 3, and quality testing was performed by Annoroad Gene Technology (Beijing) Co., Ltd. (same as in Example 3). The results are shown in Table 10.

[0140] Table 10

[0141]

[0142] The results in Table 10 show that the nucleic acid extracted using the kit and extraction method of Example 1 of the present invention is of qualified quality and can be used for high-throughput sequencing. Compared with the CTAB method, the time consumption is greatly reduced, the nucleic acid concentration is significantly higher, and the Ct value is significantly lower.

[0143] Example 11 Comparison of the effects of incubation methods on the quality of extracted nucleic acids

[0144] Two 1 mL portions of cultured Mycobacterium tuberculosis bacterial liquid were used as samples, and nucleic acid was extracted using the kit of Example 1 and the method of Example 2, and the bead milling method (using glass beads to oscillate and grind the bacteria for 5 min) and the ultrasonic method (using an ultrasonic disruptor to disrupt the bacteria, power 100 W, ultrasonic time 10 s, interval 10 s, total time 1 min) were used as control nucleic acid extraction pretreatment methods (except for the first step of nucleic acid incubation, other steps were the same).

[0145] The extracted nucleic acid samples were verified by qPCR in Example 3; and Annoroad Gene Technology (Beijing) Co., Ltd. was commissioned to perform quality testing (same as in Example 3), and the results are shown in Table 11. The CT values ​​of the three methods were statistically analyzed, and the results are shown in Table 11. Figure 8 shown.

[0146] Table 11

[0147]

[0148] The results in Table 11 show that when the pretreatment method in the extraction method of the present invention is replaced by the ultrasonic method and the bead milling method, the quality of the extracted nucleic acid is qualified. However, the Ct values ​​obtained by qPCR verification show that the incubation method is less than the ultrasonic method, the incubation method is less than the bead milling method, and the Ct values ​​obtained by the incubation method, the ultrasonic method and the bead milling method are significantly different ( Figure 8 ). Since the ultrasonic method requires the laboratory to be equipped with an ultrasonic instrument, but many laboratories do not have such conditions, its wide applicability is very poor; and the bead milling method requires manual vibration grinding of each sample, and it is impossible to extract multiple samples in large quantities at the same time, so its wide applicability is poor and its efficiency is low. Therefore, the extraction method of the present invention has wider applicability, higher efficiency, and higher nucleic acid concentration.

[0149] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0150] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A nucleic acid incubation solution for extracting nucleic acid, characterized in that: The invention comprises 5mg / mL to 20mg / mL mutanolysin, 5mg / mL to 20mg / mL alpha-amylase and 1wt% to 20wt% anionic surfactant.

2. The nucleic acid incubation solution according to claim 1, characterized in that The concentration of the mutanolysin is 5 mg / mL to 10 mg / mL, the concentration of the α-amylase is 5 mg / mL to 15 mg / mL, and the concentration of the anionic surfactant is 1 wt % to 10 wt %.

3. The nucleic acid incubation solution according to claim 2, characterized in that: The concentration of the mutanolysin is 5 mg / mL to 6 mg / mL, the concentration of the α-amylase is 8 mg / mL to 12 mg / mL, and the concentration of the anionic surfactant is 4 wt % to 6 wt %.

4. The nucleic acid incubation solution according to claim 1, characterized in that The anionic surfactant is sodium dodecyl sulfate; the concentration of mutanolysin is 5 mg / mL to 6 mg / mL, the concentration of α-amylase is 8 mg / mL to 12 mg / mL, and the concentration of the anionic surfactant is 4 wt % to 6 wt %.

5. A kit for extracting Mycobacterium tuberculosis nucleic acid, characterized in that: The kit comprises the nucleic acid incubation solution according to any one of claims 1 to 4, and a nucleic acid releasing solution, wherein the nucleic acid releasing solution is 3M to 8M guanidine salt.

6. The kit for extracting Mycobacterium tuberculosis nucleic acid according to claim 5, characterized in that: The method also comprises a nucleic acid precipitation solution and a purification solution, wherein the nucleic acid precipitation solution is isopropanol; and the purification solution is 70% to 80% ethanol.

7. The kit for extracting Mycobacterium tuberculosis nucleic acid according to claim 5 or 6, characterized in that: The nucleic acid releasing solution is 4M to 7M guanidine isothiocyanate.

8. A method for extracting Mycobacterium tuberculosis nucleic acid, characterized in that: Using the kit according to any one of claims 5 to 7, comprising the following steps: (1) Centrifuge the sample to be tested, collect the bacteria, and add nucleic acid incubation solution for incubation; (2) Add nucleic acid release solution, lyse the solution, and centrifuge at high speed to obtain the supernatant; (3) Add nucleic acid precipitation solution, centrifuge instantly, let stand and collect supernatant; (4) Place the adsorption column in a collection tube, transfer the supernatant to the adsorption column, centrifuge, and discard the filtrate in the collection tube; (5) Reinstall the adsorption column in the collection tube, add the purified solution to the adsorption column, centrifuge, discard the filtrate in the collection tube, reinstall the adsorption column in the collection tube, empty the column, centrifuge, and spin dry the adsorption column; (6) Transfer the adsorption column to a new centrifuge tube, add TE buffer or sterile enzyme-free water to the center of the adsorption column membrane, let it stand at room temperature, centrifuge, discard the adsorption column, and collect the nucleic acid.

9. The method for extracting Mycobacterium tuberculosis nucleic acid according to claim 8, characterized in that: The incubation temperature in step (1) is 37° C. to 50° C., and the incubation time is 20 min to 60 min.

10. The method for extracting Mycobacterium tuberculosis nucleic acid according to claim 9, characterized in that: The incubation temperature is 37° C. to 38° C., and the incubation time is 20 min to 30 min.

Images