Method for immobilizing beta-mannase and beta-xylanase by using yeast spores, application and products thereof

Abstract

The invention belongs to the technical field of enzyme immobilization, and particularly relates to a method for immobilizing beta-mannase and beta-xylanase by using yeast spores, application and products thereof. According to the invention, beta-mannase and beta-xylanase fixed between a spore dityrosine layer and a chitosan layer are successfully obtained, and the detection of the immobilized beta-mannase and beta-xylanase shows that the immobilized beta-mannase can tolerate a wider temperature range, so that the immobilized beta-mannase can be used for preparing the immobilized beta-mannase and the immobilized beta-xylanase. The relative activity at 90 DEG C keeps about 60% of the maximum activity; the relative activity of the immobilized beta-xylanase at the temperature of 75 DEG C is kept about 68% of the maximum activity, and compared with free enzymes, the two immobilized enzymes both show wide pH tolerance and good reusability.

Description

Technical Field

[0001] The invention belongs to the technical field of enzyme immobilization, and specifically relates to a method for immobilizing beta-mannanase and beta-xylanase by using yeast spores, application and products thereof. Background Art

[0002] Mannan is an important plant hemicellulose polysaccharide, which is widely found in the cell walls of leguminous plants. Hydrolyzed manno-oligosaccharides (MOS) are functional nutrients that can improve intestinal flora and are widely used in food, feed, paper and textile, petroleum industry and other fields. Mannan hydrolysis involves several different enzymes, the main ones being endo-β-mannanase and β-xylanase.

[0003] Spore-immobilized enzyme is produced by transferring a plasmid containing the target enzyme gene into Saccharomyces cerevisiae using genetic engineering technology. During the sporulation process of Saccharomyces cerevisiae, the spore wall is assembled from the inside to the outside in sequence with a mannose layer, a β-glucan layer, a chitosan layer and a dityrosine layer. During the assembly process, the target enzyme is fixed from the inner cavity of the spore membrane to between the chitosan layer and the dityrosine layer.

[0004] Prior art CN109182302A discloses a method for immobilizing cellulase using yeast spores, and successfully obtains hemicellulase that can be fixed between the spore dityrosine layer and the chitosan layer. By testing the immobilized hemicellulase, it is found that the optimal temperature of the immobilized enzyme is increased to 75°C, the optimal reaction pH value is reduced to 3.2, and the optimal reaction temperature is 20 mmol / L at a phosphate concentration of 20 mmol / L and Mg 2+ The enzyme activity is highest when the concentration is within 15mmol / L.

[0005] So far, free β-mannanase and β-xylanase have been cloned from different microorganisms and expressed in heterologous host cells. However, free enzymes have great limitations in industrial applications. For example, mannanase and xylanase are easily inactivated under extreme conditions such as high temperature, strong acid and alkali, and are not easy to separate from the reaction system. At the same time, the addition of free enzymes is not conducive to the purification and refining of oligomannosaccharides and oligoxylose. Therefore, it is of great application value and economic benefit to construct recombinant β-xylanase and β-mannanase with excellent performance and immobilize them to improve their acid and alkali resistance and reusability. Summary of the invention

[0006] In view of the deficiencies of the prior art, the present invention provides a method for immobilizing mannanase and xylanase by using yeast spores, application and products thereof.

[0007] To achieve the above-mentioned object of the invention, the technical solution of the present invention is as follows:

[0008] In a first aspect, the present invention provides a method for immobilizing β-mannanase and β-xylanase using yeast spores, the method comprising the following steps:

[0009] (1) Synthesis of β-mannanase and β-xylanase target genes;

[0010] (2) constructing recombinant plasmids and transforming them into expression strains;

[0011] (3) Induce the expression strain to produce spores and immobilize β-mannanase and β-xylanase.

[0012] Specifically, the β-mannanase is derived from Aspergillus niger, and its nucleotide sequence is shown in SED ID NO:1.

[0013] Specifically, the β-xylanase is derived from Aspergillus niger, and its nucleotide sequence is shown in SED ID NO:2.

[0014] SEQ ID NO 1:

[0015]

[0016] SEQ ID NO 2:

[0017] .

[0018] Among them, the gene encoding β-mannanase was named manA; the gene encoding β-xylanase was named xynB.

[0019] Specifically, the recombinant plasmid is pRS424 or pRS426.

[0020] Preferably, the recombinant plasmid is pRS424.

[0021] More specifically, the manA gene insertion site is EcoRI / XhoI.

[0022] More specifically, the xynB gene insertion site is EcoRI / NotI.

[0023] Specifically, the expression strain is a wild-type Saccharomyces cerevisiae strain or a defective Saccharomyces cerevisiae strain.

[0024] In some embodiments, the expression strain is a wild-type Saccharomyces cerevisiae strain.

[0025] More specifically, the expression strain is wild-type Saccharomyces cerevisiae strain AN120.

[0026] Wherein, the signal peptide of the wild-type Saccharomyces cerevisiae strain AN120 is a secretion signal peptide with SPR1 gene.

[0027] In the above experimental step (3), the spore production also includes culturing the recombinant strain in a culture medium, collecting the bacterial cells by sedimentation, and collecting the spore precipitate by sedimentation.

[0028] Specifically, the culture medium components include: peptone, yeast extract, potassium acetate and adenine.

[0029] In further detail, the spore pellet is stored at -30°C to -10°C.

[0030] In another aspect, the present invention discloses the role of the above-mentioned β-mannanase and β-xylanase in yeast spore fixation.

[0031] In yet another aspect, the present invention further discloses a biomaterial, characterized in that the biomaterial comprises yeast spores prepared by any one of the aforementioned methods.

[0032] Compared with the prior art, the present invention has the following beneficial effects:

[0033] The invention uses wild-type saccharomyces cerevisiae ascospores as immobilized enzyme carriers, immobilizes β-mannanase and β-xylanase, and expresses β-mannanase and β-xylanase with secretory signal peptides in yeast spores by transferring genes from Aspergillus niger into saccharomyces cerevisiae. Since the enzymes are blocked by the dityrosine layer of the dense mesh structure, they are fixed between the chitosan layer and the dityrosine layer during the formation of the spore wall, thereby obtaining spore-immobilized enzymes, and the expression and immobilization of the enzymes are carried out simultaneously. It is no longer necessary to add two enzymes from an exogenous source, which greatly reduces the cost of raw materials, and the obtained enzymes have high reusability and strong stress resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 This is the electrophoresis diagram for verifying the PCR amplification results of manA gene.

[0035] Figure 2 This is the electrophoresis diagram to verify the PCR amplification results of xynB gene.

[0036] Figure 3This is the map of the recombinant plasmid pRS424-manA (pRS424-TEFpr-ss-RFP-MANA).

[0037] Figure 4 This is the map of the recombinant plasmid pRS424-xynB (424-SS-GFP-xynB-His).

[0038] Figure 5 The results of laser confocal microscopy observation of the expression of red fluorescent protein in spores containing mannanase.

[0039] Figure 6 The results of observing the expression of green fluorescent protein in spores containing xylanase using laser confocal microscopy.

[0040] Figure 7 The figure shows the SDS-PAGE result of mannanase.

[0041] Figure 8 The figure shows the SDS-PAGE result of xylanase.

[0042] Fig. 9 A is the effect of temperature on the enzyme activity of spore-immobilized mannanase and free mannanase, and B is the effect of pH on the enzyme activity of spore-immobilized mannanase and free mannanase.

[0043] Fig.10 To analyze the reusability of immobilized mannanase on spores.

[0044] Fig.11 A is the effect of temperature on the enzymatic activities of spore-immobilized xylanase and free xylanase, and B is the effect of pH on the enzymatic activities of spore-immobilized xylanase and free xylanase.

[0045] Fig.12 To analyze the reusability of immobilized xylanase on spores. DETAILED DESCRIPTION

[0046] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples without specifying specific conditions are usually selected according to conventional methods and conditions or according to the product specifications.

[0047] Experimental reagents:

[0048] Table 1 Experimental reagents and sources

[0049] Experimental reagents source Part Number β-Mannanase gene manA Tianlin Biotechnology (Shanghai) Co., Ltd. — β-Xylanase xynB Aspergillus niger — Saccharomyces cerevisiae plasmid pRS424 This laboratory collection — Wild-type yeast strain AN120 This laboratory collection — Endonuclease EcoR Ⅰ Bao Biotechnology (Dalian) Co., Ltd. 1611 XOt Bao Biotechnology (Dalian) Co., Ltd. 1635 NotI Bao Biotechnology (Dalian) Co., Ltd. 1623 Nucleic acid polymerase Solebow C115 Carob Gum Sigma L8190 Beech wood xylan Solebow X8163

[0050] The culture medium formula in the embodiment is:

[0051] "%" in the formula indicates the mass percentage;

[0052] Yeast medium YPAD: 2% peptone, 1% yeast extract, 2% glucose, 2% agar, a small amount of adenine;

[0053] Yeast sporulation buffer medium YPAce: 2% peptone, 1% yeast extract, 2% potassium acetate, a small amount of adenine;

[0054] Sporulation medium: 2% potassium acetate;

[0055] E. coli culture medium LB: 1% peptone, 0.5% yeast extract, 1% NaCl.

[0056] Example 1 Construction of plasmid vector

[0057] (1) Tianlin Biotechnology (Shanghai) Co., Ltd. artificially synthesized β-mannanase from Aspergillus niger, and β-xylanase genes were amplified from Aspergillus niger, named manA and xynB, respectively. The nucleic acid sequence of manA is shown in SEQ ID NO: 1, and the nucleic acid sequence of xynB is shown in SEQ ID NO: 2.

[0058] (2) The manA and xynB genes with the original signal peptide deleted were amplified using primers manA-F1 / R1 and xynB-F1 / R1, respectively. The gene amplification results are shown in Figure 1 and Figure 2 As shown, it can be seen that the amplified manA and xynB gene fragments are of correct size.

[0059] Table 2 PCR reaction system

[0060]

[0061] Table 3 PCR reaction program

[0062]

[0063] SEQ ID NO 3(manA-F1):TAGAATTCCTACCAAAGGCGTCCCC;

[0064] SEQ ID NO 4 (manA-R1): ATATCTCGAGGCGGCCGCTTAAGCTGACCC TATA;

[0065] SEQ ID NO 5(xynB-F1): GACTCTGTCGCCCAGCGTTCGGATG;

[0066] SEQ ID NO 6(xynB-R1): TTACTGAACAGTGATGGACGAAGAT.

[0067] (3) The Saccharomyces cerevisiae expression vector pRS424 was double-digested with restriction endonucleases EcoRⅠ and XhoI, and then the amplified manA gene was recombined and constructed into the Saccharomyces cerevisiae expression vector pRS424 to obtain the recombinant plasmid pRS424-manA; the Saccharomyces cerevisiae expression vector pRS424 was double-digested with restriction endonucleases EcoRⅠ and NotI, and then the amplified xynB gene was recombined and constructed into the Saccharomyces cerevisiae expression vector pRS424 to obtain the recombinant plasmid pRS424-xynB. The map of the recombinant plasmid is shown in FIG. Figure 3 and Figure 4 As shown;

[0068] (4) The recombinant plasmid is transformed into the Escherichia coli DH5α strain, and then the positive clones are screened on an ampicillin-resistant LB agar plate, the recombinant plasmid is extracted and sequenced, and the recombinant Escherichia coli with correct sequencing is stored as glycerol bacteria.

[0069] Example 2 Immobilization of β-mannanase and β-xylanase on yeast spores

[0070] (1) The recombinant plasmids pRS424-manA and pRS424-xynB of Example 1 were transformed into competent cells of wild-type Saccharomyces cerevisiae AN120 using lithium acetate transformation solution and screened on SD / Trp plates to obtain recombinant strains pRS424-manA-AN120 and pRS424-xynB-AN120. The experimental results of laser confocal microscopy and SDS-PAGE are shown in Figure 2. Figure 5-8 As shown, it indicates that manA protein and xynB protein were successfully expressed;

[0071] (2) Method for inducing spore production of recombinant strains: select a monoclonal yeast strain and shake it slowly in SD / Trp liquid culture medium, and culture it in a shaking incubator at 25-35°C for 12-18 hours; transfer the bacterial liquid to YPAce culture medium and shake it vigorously, and culture it in a shaking incubator at 25-35°C for 24-36 hours; collect the yeast cells by sedimentation, resuspend the cells with 2% KAc, and culture them at 25-35°C for 24-36 hours to induce spore production; after sedimentation, centrifuge to obtain the precipitate, wash the collected precipitated spores twice with sterile water, resuspend them in 5-10 mL of protoplast buffer, add a small amount of lyticase, and treat them in a shaking incubator at 37°C for about 3 hours; ultrasonically disrupt the spores for 30-60 minutes (break for 2 seconds and stop for 2 seconds), and obtain free single spores by microscopic examination; wash the spores three times with pre-cooled sterile water to obtain purified spores, freeze-dry them, and store them at 20°C.

[0072] Example 3 Performance comparison of immobilized β-mannanase and free enzyme

[0073] (1) Enzyme activity

[0074] The β-mannanase was immobilized using wild-type spores in accordance with Example 2, and the enzyme activities of the spore-immobilized enzyme and the free enzyme were compared. The amount of enzyme required to catalyze the reaction of 1 μmol reducing sugar per minute at 70°C and pH 5.5 was defined as one enzyme activity unit U.

[0075] Source of free mannanase: The mannanase gene was introduced into plasmid pPIC9K to construct recombinant plasmid pPIC9K-manA, which was transformed into Pichia pastoris to obtain recombinant strain pPIC9K-manA-GS115. Free mannanase secreted into the supernatant was obtained by methanol-induced expression, and then concentrated and freeze-dried to obtain free mannanase dry powder.

[0076] Weigh 10 mg of spore-immobilized β-mannanase, add 1000 μL of 0.5% carob bean gum (5 mg / mL) buffer at pH 5.5 to dilute and mix, react at 70°C for 10 min, then add 1.5 mL of DNS solution, heat in a boiling water bath for 5 min, cool immediately, and measure OD 540 , calculate the enzyme activity.

[0077] In the control group, 10 mg of freeze-dried free mannanase powder was weighed and diluted with 1000 μL of 0.5% carob bean gum (5 mg / mL) buffer at pH 5.5. After reacting at 70°C for 10 min, 1.5 mL of DNS solution was added and heated in a boiling water bath for 5 min. The mixture was cooled immediately and the OD was measured. 540 , the enzyme activity calculation formula is:

[0078]

[0079] Where: A is the amount of mannose calculated based on the enzyme activity standard curve (μmoL);

[0080] 10 a : Conversion factor for converting the amount of enzyme in the reaction system to 1g;

[0081] 10 b : Enzyme reaction time;

[0082] The calculation results are shown in Table 4 below.

[0083] Table 4

[0084] Enzyme type Enzyme activity (U / g) Spore-immobilized mannanase 120.68 Free enzyme 325.46

[0085] (2) Temperature stability

[0086] The spore-immobilized enzyme and free enzyme were placed at different temperatures of 50°C, 55°C, 60°C, 65°C, 70°C, 75°C, 80°C, 85°C, and 90°C for 10 h, and the residual relative activity was detected using a standard reaction system. The results are shown in Fig. 9 As shown in A in FIG, the enzyme has the highest activity at 70°C. Compared with the free enzyme, the immobilized enzyme can tolerate a wider temperature range, and the relative activity at 90°C remains about 60% of the maximum activity.

[0087] (3) pH stability

[0088] The spore-immobilized enzyme and free enzyme were placed in different pH buffer solutions (pH 3, 4, 5, 6, 7, and 8, respectively). After incubation at 4°C for 8 h, the enzyme activity with the highest conversion rate in the group was defined as 100%, and the percentage of the conversion rate of each group of samples relative to the highest conversion rate was recorded as the relative activity.

[0089] The results are as follows Fig. 9 As shown in Figure B, the immobilized enzyme exhibited a wider pH tolerance than the free enzyme and effectively catalyzed the reaction between pH 3.0 and 7.0. At pH 7.0, the immobilized enzyme still exhibited 80% of the maximum activity, while the free enzyme almost completely lost its activity at this pH.

[0090] (4) Number of times it can be reused

[0091] The reusability of spore-immobilized enzyme was studied by referring to the reaction conditions. First, the spores were collected by centrifugation at 6000×g for 3 minutes after the reaction, and the supernatant was saved as the result of the first reaction for testing. The collected spores were washed twice, and the liquid required for the reaction was added again, and the second reaction was repeated. After the reaction was completed, the spores were collected by centrifugation, and the supernatant was saved as the second reaction liquid for testing. The reaction was repeated 8 times. The results are shown in Fig.10 As shown, the immobilized mannanase exhibited good reusability, as the enzyme activity remained approximately 80% even after 8 cycles.

[0092] Example 4 Performance comparison of immobilized β-xylanase and free enzyme

[0093] (1) Enzyme activity

[0094] Referring to Example 2, wild-type spores were used to immobilize β-xylanase, and the enzyme activities of the spore-immobilized enzyme and the free enzyme were compared.

[0095] Source of free xylanase: The xylanase gene was introduced into the plasmid pPIC9K to construct the recombinant plasmid pPIC9K-xynB, which was transformed into Pichia pastoris to obtain the recombinant strain pPIC9K-xynB-GS115. The free xylanase secreted into the supernatant was obtained by methanol-induced expression, and the free xylanase powder was obtained by concentration and freeze-drying.

[0096] Weigh 10 mg of spore-immobilized enzyme, add 1000 μL of 1% beechwood xylan (10 mg / mL) buffer at pH 5.0 to dilute and mix, react at 50°C for 10 min, then add 1.5 mL of DNS solution, heat in a boiling water bath for 5 min, cool immediately, and measure OD 540 , calculate the enzyme activity.

[0097] The control group weighed 10 mg of freeze-dried free xylanase powder, and added 1000 μL of 1% beechwood xylan (10 mg / mL) buffer at pH 5.0 to dilute and mix. After reacting at 50°C for 10 min, 1.5 mL of DNS solution was added, and the mixture was heated in a boiling water bath for 5 min, cooled immediately, and the OD was measured. 540 , the enzyme activity calculation formula is:

[0098]

[0099] Where: A is the amount of xylose calculated based on the enzyme activity standard curve (μmoL);

[0100] 10 a : Conversion factor for converting the amount of enzyme in the reaction system to 1g;

[0101] 10 b : Enzyme reaction time;

[0102] The calculation results are shown in Table 5 below.

[0103] Table 5

[0104] Enzyme type Enzyme activity (U / g) Spore-immobilized xylanase 98.4 Free enzyme 173.1

[0105] (2) Temperature stability

[0106] The spore-immobilized enzyme and free enzyme were placed at different temperatures of 30°C, 35°C, 40°C, 45°C, 50°C, 55°C, 60°C, 65°C, 70°C and 75°C for 10 h, and the residual relative activity was detected using a standard reaction system. The results are shown in Fig.11 As shown in A in FIG, the enzyme has the highest activity at 50°C. Compared with the free enzyme, the immobilized enzyme can tolerate a wider temperature range, and the relative activity at 75°C remains about 68% of the maximum activity.

[0107] (3) pH stability

[0108] The spore-immobilized enzyme and free enzyme were placed in different pH buffers (pH 2, 3, 4, 5, 6, 7, 8, 9, 10), and incubated at 4°C for 8 hours. The residual relative activity was detected using a standard reaction system. The enzyme activity with the highest conversion rate in the group was defined as 100%, and the percentage of the conversion rate of each group of samples relative to the highest conversion rate was recorded as the relative activity.

[0109] The results are as follows Fig.11 As shown in Figure B, xylanase has high activity under low pH conditions and is particularly suitable for acidic environments. Compared with the free enzyme, the immobilized enzyme exhibits a wider pH tolerance and effectively catalyzes the reaction between pH values ​​of 3.0 and 10.0. At pH 10.0, the immobilized enzyme still exhibits 60% of the maximum activity, while the free enzyme almost completely loses its activity at this pH value.

[0110] (4) Number of times it can be reused

[0111] The reusability of spore-immobilized enzyme was studied by referring to the reaction conditions. First, the spores were collected by centrifugation at 6000×g for 3 minutes after the reaction, and the supernatant was saved as the result of the first reaction for testing. The collected spores were washed twice, and the liquid required for the reaction was added again, and the second reaction was repeated. After the reaction was completed, the spores were collected by centrifugation, and the supernatant was saved as the second reaction liquid for testing. The reaction was repeated 8 times. The results are shown in Fig.12 As shown, the immobilized xylanase exhibited good reusability, as the enzyme activity remained approximately 75% even after 8 cycles.

[0112] The above specific implementations do not constitute a limitation on the protection scope of the present invention. It should be understood by those skilled in the art that various modifications, combinations, sub-combinations and substitutions can be made according to design requirements and other factors. Any modification, equivalent substitution and improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. The use of β-mannanase and β-xylanase in yeast spore fixation, characterized in that: The application is achieved by immobilizing β-mannanase and β-xylanase into yeast chitosan layer and dityrosine layer.

2. A method for immobilizing β-mannanase and β-xylanase on yeast spores, characterized in that: The method comprises the following steps: (1) Synthesis of β-mannanase and β-xylanase target genes; (2) constructing recombinant plasmids and transforming them into expression strains; (3) Induce the expression strain to produce spores and immobilize β-mannanase and β-xylanase.

3. The method according to claim 2, characterized in that The β-mannanase is derived from Aspergillus niger, and its nucleotide sequence is shown in SED ID NO:

1.

4. The method according to claim 2, characterized in that: The β-xylanase is derived from Aspergillus niger, and its nucleotide sequence is shown in SED ID NO:

2.

5. The method according to claim 2, characterized in that: The recombinant plasmid is pRS424 or pRS426.

6. The method according to claim 2, characterized in that The expression strain is a wild-type Saccharomyces cerevisiae strain or a defective Saccharomyces cerevisiae strain.

7. The method according to claim 6, characterized in that The expression strain is wild-type Saccharomyces cerevisiae strain AN120.

8. The method according to claim 2, characterized in that: The spore production in step (3) also includes culturing the recombinant strain in a culture medium, collecting bacterial cells by sedimentation, and collecting spore precipitates by sedimentation.

9. The method according to claim 8, characterized in that The culture medium components include: peptone, yeast extract, potassium acetate and adenine.

10. A biomaterial, characterized in that: The invention comprises the use according to claim 1 or yeast spores prepared by any one of the methods of claims 1 to 9.

Images