Primer composition, kit, detection method and application thereof

Abstract

The invention discloses a semi-nested RT-PCR (Reverse Transcription-Polymerase Chain Reaction) primer composition for detecting bovine viral diarrhea virus, a kit as well as a detection method and application of the semi-nested RT-PCR primer composition and the kit. An upstream primer sequence and a downstream primer sequence of an RT-PCR primer are sequentially shown as SEQ ID NO: 01 and SEQ ID NO: 02 and are sequentially shown as SEQ ID NO: 01 and SEQ ID NO: 04. The method provided by the invention can specifically detect the BVDV, and the sensitivity is 1.42 * 10 < 1 > copies / [mu] L, which is 10 times of the sensitivity of common PCR, and is consistent with the sensitivity of a fluorescent quantitative PCR detection method. Detection tests on 42 bovine clinical samples show that the semi-nested RT-PCR method is efficient in clinical detection method and accurate and reliable in result, and has a great application prospect.

Description

Technical Field

[0001] The invention belongs to the technical field of virus detection, and in particular relates to a semi-nested RT-PCR primer composition for detecting bovine viral diarrhea virus, a kit and a detection method and application thereof. Background Art

[0002] Bovine viral diarrhea virus (BVDV) is the pathogen of bovine viral diarrhea / mucosal disease (BVD-MD). It is an important viral pathogen that causes disease in cattle worldwide. It can cause fever, diarrhea, respiratory symptoms, mucosal erosion, immunosuppression and reduced reproductive capacity in infected animals. Pregnant animals may experience miscarriage, stillbirth or fetal abnormalities. BVDV infection types are divided into transient infection (TI) and persistent infection (PI). Persistent infection in cattle is the main reason for the prevalence of the disease and the difficulty in purification. Although PI cattle have no obvious clinical manifestations, Ma Chong et al. found that the growth and development status and reproductive performance of PI cattle are significantly lower than those of healthy cattle of the same age. PI cattle can continue to be infected and excrete toxins throughout their lives, which not only expands the spread of the disease, but also increases the probability of mixed infection with the disease. In addition, BVDV has a wide range of susceptible hosts, including cattle, pigs, sheep and deer, with calves being the most vulnerable and susceptible hosts, causing significant economic losses to the cattle industry.

[0003] BVDV is a single-stranded positive-sense RNA virus belonging to the Flaviviridae family. It belongs to the same genus as the classical swine fever virus (CSFV) and border disease virus (BDV). The BVDV genome is about 12.3 kb in length and contains an open reading frame (ORF) encoding a polyprotein, which is processed into mature viral proteins through co-translation and post-translation. A total of 12 viral proteins are generated, including 4 structural proteins (capsid protein C, envelope proteins Erns, E1 and E2) and 8 non-structural proteins (Npro, p7, NS2, NS3, NS4A, NS4B, NS5A and NS5B). BVDV is currently divided into three genotypes: BVDV-1, BVDV-2, and BVDV-3 (HOBI-like). Studies have shown that the main BVDV subtypes prevalent in China are BVDV-1a, BVDV-1c and BVDV1m. BVDV-1 is the dominant strain worldwide, while BVDV-2 is mainly found in the United States, Canada and South America. The epidemiology of BVDV infection in Chinese dairy cows was analyzed, and the results showed that the total prevalence of BVDV in dairy cows in China was 53%. The mixed positive rate of BVDV in dairy cows in the northern region was higher than that in other parts of the country, with a rate of more than 70%, followed by 69.8% in Central China and 58.3% in East China. The BVDV positive rate in dairy cows in Fujian Province, China was the highest, reaching 90.0%, followed by Shaanxi (88.9%) and Shandong (83.3%), while the provinces or municipalities with a prevalence between 70-80% included Henan, Tianjin, Hunan, Hubei, Inner Mongolia and Shanxi, and the lowest prevalence was estimated to be 14.7% in Ningxia Hui Autonomous Region.

[0004] At present, the commonly used methods for BVDV detection include etiological diagnosis, serological methods and molecular biological methods. However, due to the biodiversity and antigenic diversity of BVDV strains, new variants and strains continue to emerge, and the most effective measure to prevent and control BVDV is to promptly detect and completely eliminate BVDV-PI cattle. Therefore, the pathogenic genes should be continuously analyzed comprehensively and the detection methods should be updated in a timely manner to improve the sensitivity of the detection, develop accurate, reliable and widely applicable diagnostic methods, avoid the missed detection of weakly positive infected cattle, so as to timely detect BVDV-PI cattle and effectively control the further spread of the disease. At present, virus isolation, immunofluorescence test, real-time fluorescence quantitative PCR, enzyme-linked immunosorbent assay, serum neutralization test, electron microscopy, nano-antibody ELISA and CRISPR / Cas12a have been established in the diagnosis of the disease at home and abroad, but there are shortcomings such as long diagnosis cycle, cumbersome operation, low detection rate, high requirements for experimental equipment and high cost to varying degrees. Summary of the invention

[0005] The present invention provides a primer composition, which comprises at least one of the following 1)-8): 1) a nucleotide sequence as shown in SEQ ID NO: 01, or a nucleotide sequence having the same function as the nucleotide sequence as shown in SEQ ID NO: 01 after one or several nucleotides are substituted and / or deleted and / or added; 2) a nucleotide sequence as shown in SEQ ID NO: 02, or a nucleotide sequence having the same function as the nucleotide sequence as shown in SEQ ID NO: 02 after one or several nucleotides are substituted and / or deleted and / or added; 3) a nucleotide sequence as shown in SEQ ID NO: 03, or a nucleotide sequence having the same function as the nucleotide sequence as shown in SEQ ID NO: 03 after one or several nucleotides are substituted and / or deleted and / or added; 4) a nucleotide sequence as shown in SEQ ID NO: 04, or a nucleotide sequence having the same function as the nucleotide sequence as shown in SEQ ID NO: 04 after one or several nucleotides are substituted and / or deleted and / or added; NO:4; 5) the nucleotide sequence as shown in SEQ ID NO:05, or a nucleotide sequence having the same function as the nucleotide sequence as shown in SEQ ID NO:5 after one or more nucleotides are substituted and / or deleted and / or added; 6) the nucleotide sequence as shown in SEQ ID NO:06, or a nucleotide sequence having the same function as the nucleotide sequence as shown in SEQ ID NO:6 after one or more nucleotides are substituted and / or deleted and / or added; 7) the nucleotide sequence as shown in SEQ ID NO:07, or a nucleotide sequence having the same function as the nucleotide sequence as shown in SEQ ID NO:07 after one or more nucleotides are substituted and / or deleted and / or added; 8) the nucleotide sequence as shown in SEQ ID NO:08, or a nucleotide sequence having the same function as the nucleotide sequence as shown in SEQ ID NO:08 after one or more nucleotides are substituted and / or deleted and / or added.

[0006] Specifically, the primer composition includes at least one of the following 1)-8): 1) a nucleotide sequence as shown in SEQ ID NO: 01 and / or SEQ ID NO: 04; 2) a nucleotide sequence as shown in SEQ ID NO: 01 and / or SEQ ID NO: 05; 3) a nucleotide sequence as shown in SEQ ID NO: 01 and / or SEQ ID NO: 08; 4) a nucleotide sequence as shown in SEQ ID NO: 02 and / or SEQ ID NO: 04; 5) a nucleotide sequence as shown in SEQ ID NO: 02 and / or SEQ ID NO: 06; 6) a nucleotide sequence as shown in SEQ ID NO: 03 and / or SEQ ID NO: 04; 7) a nucleotide sequence as shown in SEQ ID NO: 03 and / or SEQ ID NO: 05; 8) a nucleotide sequence as shown in SEQ ID NO: 03 and / or SEQ ID NO: 08.

[0007] Specifically, the primer composition includes: 1) the nucleotide sequences shown in SEQ ID NO: 01 and SEQ ID NO: 04; and 2) the nucleotide sequences shown in SEQ ID NO: 02 and SEQ ID NO: 04.

[0008] Another object of the present invention is to provide a kit, which comprises any one of the primer compositions of the present invention.

[0009] Another object of the present invention is to provide a method for detecting bovine viral diarrhea virus, which comprises using any primer composition of the present invention to perform a PCR amplification reaction.

[0010] Specifically, the PCR amplification reaction comprises the following steps: S1. extracting the RNA of the sample to be tested and reverse transcribing it into cDNA; S2. using the cDNA described in S1 as a template, using any primer combination of the present invention to perform a PCR amplification reaction A to obtain a PCR product 1; S3. using the PCR product 1 described in S2 as a template, using any primer combination of claims 1 to 3 to perform a PCR amplification reaction B to obtain a PCR product 2; S4. judging the results.

[0011] Specifically, the system of the PCR amplification reaction A is: 10 μL of 2×Taq, 2 μL of primer combination, 2 μL of cDNA template, and finally supplemented to 20 μL with ddH2O; the reaction conditions of the PCR amplification reaction A are: 95°C for 5 min, 95°C for 30 s, 58°C for 45 s, 72°C for 20 s, 33 cycles; total extension at 72°C for 8 min.

[0012] Specifically, the system of the PCR amplification reaction B is: 2×Taq 10 μL, primer combination 2 μL, PCR product 1 template 2 μL, and finally supplemented to 20 μL with ddH2O; the reaction conditions of PCR amplification reaction B are: 95°C 5 min, 95°C 30 s, 58°C 45 s, 72°C 20 s, 33 cycles; 72°C total extension 8 min.

[0013] Specifically, the result is determined by electrophoresis analysis, and a band of 600 bp is present, which is determined to be positive.

[0014] The above methods do not include the diagnosis and treatment methods for diseases as stated in Article 25 of the Patent Law.

[0015] Another object of the present invention is to provide the use of any primer composition of the present invention, any kit of the present invention, and any method of the present invention.

[0016] Specifically, the application includes application in at least one of the following 1)-6): 1) identifying bovine viral diarrhea virus; 2) preparing a kit or related product for identifying bovine viral diarrhea virus; 3) detecting whether the pathogenic microorganism to be tested is bovine viral diarrhea virus; 4) preparing a kit or related product for detecting whether the pathogenic microorganism to be tested is bovine viral diarrhea virus; 5) detecting whether the sample to be tested contains bovine viral diarrhea virus; 6) preparing a kit or related product for detecting whether the sample to be tested contains bovine viral diarrhea virus.

[0017] Any of the above applications do not include the diagnosis and treatment methods for diseases as stated in Article 25 of the Patent Law.

[0018] The beneficial effects of the present invention include: based on the first round of ordinary PCR amplification, a second pair of shorter and more specific primers are used to perform a second round of PCR amplification on the target sequence, which has higher sensitivity, specificity and efficiency than the commonly used ordinary PCR.

[0019] The minimum detection limit of the sensitivity test was 10 1 The sensitivity of real-time fluorescence RT-PCR was consistent. There was no cross reaction with rotavirus (RV), Salmonella (SL1344), and Escherichia coli (AH50), and it had good specificity. In the nucleic acid detection of 42 cow dung samples, the detection method of the present invention detected 20 positive samples with a positive rate of 47.62%, and the real-time fluorescence quantitative detection detected 17 positive samples with a positive rate of 40.48%. The consistency rate of the two detection methods was 92.9%, and 3 sample bands detected as positive by the detection method of the present invention and negative by fluorescence quantitative detection were recovered for sequencing identification, and the results showed that they were BVDV genome sequences.

[0020] It can be seen that the method established in this study can quickly, accurately and sensitively detect and distinguish bovine viral diarrhea virus. The two-round primer amplification reduces the possibility of sequence mismatch and improves the accuracy of virus detection. It provides another better method for clinical differential diagnosis of bovine viral diarrhea virus infection in cattle. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 : Electrophoresis diagram of each primer pair in Example 1.

[0022] Figure 2 : Electrophoretogram of specificity test in Example 2.

[0023] Figure 3 : Standard curve and melting curve of fluorescent quantitative RT-PCR in Example 2.

[0024] Figure 4 : Detection electrophoresis diagram of clinical samples in Example 2. DETAILED DESCRIPTION

[0025] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0026] The molecular biology experimental methods not specifically described in the following examples were all performed with reference to the specific methods listed in the book Molecular Cloning Experiment Guide by J. Sambrook, or in accordance with the kits and product instructions.

[0027] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0028] The following examples and their specific descriptions are used to explain and understand the present invention and do not constitute improper limitations of the present invention.

[0029] The main experimental reagents used in the following examples are: total RNA rapid extraction kit, purchased from Shanghai Feijie Biotechnology Co., Ltd.; StarPrep DNA purification / gel recovery kit (StarPrep DNA Gel Extraction Kit), purchased from Beijing GenStar Company; endotoxin-free plasmid extraction kit ( Endo-free Plasmid MiniKit) was purchased from Omega Company, USA; reverse transcriptase RR036A was purchased from Takara; ×PCR PCR StarMix (Dye) was purchased from Beijing GenStar Company; PMD-19T vector was purchased from Takara; BPV, rotavirus (RV), Salmonella (SL1344), and Escherichia coli (AH50) were preserved by our laboratory.

[0030] The main experimental instruments used in the following examples are: fluorescent quantitative PCR instrument (CFX Connect™ Optics Module), purchased from Bio-Rad, USA; ordinary PCR instrument (T100™ Thermal Cycler), purchased from Takara, Japan; electrophoresis instrument (JY100C), purchased from Beijing Junyi Dongfang Electronic Equipment Co., Ltd.; gel imager, purchased from Shanghai Tianneng Life Sciences Co., Ltd.; desktop small centrifuge, Sigma, Germany; high-pressure steam sterilizer, Shanghai Shen'an Medical Equipment Factory; constant temperature shaker, Shanghai Zhicheng Analytical Instrument Manufacturing Co., Ltd.

[0031] As used herein, the terms "polynucleotide", "nucleic acid sequence", "nucleotide sequence" or "nucleic acid fragment" are used interchangeably and are single-stranded or double-stranded RNA or DNA polymers that optionally may contain synthetic, non-natural or altered nucleotide bases. Nucleotides are referred to by their single letter names as follows: "A" is adenosine or deoxyadenosine (RNA or DNA, respectively), "C" represents cytidine or deoxycytidine, "G" represents guanosine or deoxyguanosine, "U" represents uridine, "T" represents deoxythymidine, "R" represents purine (A or G), "Y" represents pyrimidine (C or T), "K" represents G or T, "H" represents A or C or T, "I" represents inosine, and "N" represents any nucleotide.

[0032] In the sequences used in the present invention, degenerate bases are sometimes used to represent bases at one or more positions. Degenerate bases can be represented by letters R, Y, M, K, S, W, H, B, V, D, and N, wherein R represents A / G, Y represents C / T, M represents A / C, K represents G / T, S represents C / G, W represents A / T, H represents A / T / C, B represents G / T / C, V represents G / A / C, D represents G / A / T, and N represents A / T / C / G.

[0033] As used herein, the terms "polypeptide", "peptide", and "protein" are used interchangeably in this application to refer to polymers of amino acid residues. The term is applicable to amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids, and to naturally occurring amino acid polymers. The terms "polypeptide", "peptide", "amino acid sequence" and "protein" may also include modified forms, including but not limited to glycosylation, lipid attachment, sulfation, gamma carboxylation of glutamic acid residues, hydroxylation and ADP-ribosylation.

[0034] The term "vector" as used herein refers to a nucleic acid delivery vehicle into which a polynucleotide can be inserted. When the vector can express the protein encoded by the inserted polynucleotide, or when the vector can transcribe the inserted polynucleotide (for example, transcribe to generate mRNA or functional RNA), the vector is called an expression vector. The vector can be introduced into a host cell by transformation, transduction or transfection, so that the genetic material elements it carries are expressed in the host cell. Vectors are well known to those skilled in the art, including but not limited to plasmid vectors, viral vectors, etc. The vector can also contain a variety of regulatory sequences for regulating expression. "Regulatory sequence" and "regulatory element" are used interchangeably herein and refer to nucleotide sequences that are located upstream (5' non-coding sequence), in the middle or downstream (3' non-coding sequence) of a coding sequence and affect the transcription, RNA processing or stability or translation of the relevant coding sequence. Regulatory sequences can include but are not limited to promoter sequences, transcription start sequences, enhancer sequences, selection elements and reporter genes, etc. The regulatory sequences can be from different sources, or they can be from the same source but arranged in a manner different from that usually occurring naturally. In addition, the vector can also contain a replication initiation site.

[0035] "Introducing" a nucleic acid molecule (e.g., a plasmid, a linear nucleic acid fragment, RNA, etc.) or a protein into an organism refers to transforming an organism cell with the nucleic acid or protein so that the nucleic acid or protein can function in the cell. "Transformation" as used in the present invention includes stable transformation and transient transformation.

[0036] Example 1: Establishment of a semi-nested RT-PCR detection method for detecting bovine viral diarrhea virus

[0037] (I) Primer design and screening

[0038] The conserved sequences of the 5'UTR and Npro fragments of BVDV-1 and BVDV-2 were used as targets, and primers for the fragments were designed using Oligo.7 and synthesized by Beijing Qingke Biotechnology Co., Ltd. The primer information is shown in Table 1. In order to ensure that the primer sequence has a wider match with the template sequence, degenerate bases were introduced into the primers.

[0039] Table 1. Primer sequences

[0040] name Amino acid sequence serial number BVDV-F1 AAGCCCTGAGTACAGGGHAG SEQ ID NO:01 BVDV-F2 TAGTCGTCAGTGGTTCGACGCC SEQ ID NO:02 BVDV-F3 GTGGACGAGGGCAYGCCCA SEQ ID NO:03 BVDV-R1 TCTATRCACACAWARATATGGT SEQ ID NO:04 BVDV-R2 TGGGCRTGCCCTCGTCCAC SEQ ID NO:05 BVDV-R3 CATGTGCCATGTACAGCAGAG SEQ ID NO:06 BVDV-R4 CCTCTGCAGCACCCTATCAG SEQ ID NO:07 BVDV-R5 TGADATCAACTCCATGTGCC SEQ ID NO:08

[0041] Select 2 primers from the 8 primers to form 8 sets of PCR primer pairs, as shown in Table 2. Amplify the BVDV genome. Use primers BVDV-F and BVDV-R to PCR amplify the BVDV genome. The PCR amplification system (total volume of 50 μL): 2×Taq 25 μL, BVDV1-F (10 μmol / L) 2 μL, BVDV1-R (10 μmol / L) 2 μL, BVDV-E2 cDNA (as a template) 1 μL, and finally add ddH2O to 50 μL. The reaction conditions are: 95℃5min, 95℃30s, 55℃30s, 72℃30s, 33 cycles; 72℃ total extension 5min. The amplified product was electrophoresed by 1% agarose gel.

[0042] Table 2. Primer pair sequences

[0043]

[0044] The results are as follows Figure 1 As shown, the electrophoresis bands of primer pairs 01 and 04 performed better and the primers had stronger specificity.

[0045] (II) Establishment of semi-nested RT-PCR reaction system

[0046] Primer pairs 01 and 04 were used as primers for the first and second rounds of nested RT-PCR. According to the instructions of the 2×Taq PCR StarMix (Dye) kit, the annealing temperature, template amount, primer concentration, etc. of the first and second rounds of nested RT-PCR were optimized to determine the optimal amplification system and reaction conditions.

[0047] After optimizing factors such as the amount of template, annealing temperature, and primer ratio, the first round of RT-PCR amplification reaction system for the BVDV gene was finally determined (total volume of 20 μL): 2×Taq 10 μL, BVDV-F1 (10 μmol / L) 1 μL, BVDV-R1 (10 μmol / L) 1 μL, BVDV-E2 cDNA (as a template) 2 μL, and finally supplemented to 20 μL with ddH2O. The reaction conditions were: 95℃5min, 95℃30s, 58℃45s, 72℃20s, 33 cycles; 72℃ total extension 8min. The second round of nested RT-PCR amplification reaction system (total volume of 20 μL): 2×Taq 10 μL, BVDV-F2 (10 μmol / L) 1 μL, BVDV-R1 (10 μmol / L) 1 μL, 100-fold diluted first round product (as template) 2 μL, and finally supplemented to 20 μL with ddH2O. The reaction conditions are: 95℃5min, 95℃30s, 58℃45s, 72℃20s, 33 cycles; 72℃ total extension 8min.

[0048] Example 2: Experimental verification of the effect of the method

[0049] (I) Sensitivity test

[0050] The positive plasmid pMD19-BVDV (1.42×10 8 copies / μL-1.42×10 0 The minimum detection limit was determined by nested RT-PCR with 9 different dilutions of template plasmids (100 copies / μL) as template and enzyme-free water as negative control. The sensitivity of the established method was evaluated by comparing it with that of ordinary RT-PCR and fluorescent quantitative RT-PCR.

[0051] The results showed that the minimum detection limit of the first round of RT-PCR was 10 2 The first round of RT-PCR amplification products diluted 100 times were used as templates for the second round of nested RT-PCR. The minimum detection limit of the second round of nested RT-PCR was 10 1 The minimum detection limit of real-time fluorescence RT-PCR was 10 1 The results showed that the sensitivity of nested RT-PCR was 10 times that of ordinary RT-PCR, which was consistent with the sensitivity of the fluorescent RT-PCR detection method. This showed that the semi-nested RT-PCR detection method established in this study had high sensitivity.

[0052] (II) Specificity test

[0053] The established nested RT-PCR detection method was used to amplify the nucleic acids of rotavirus (RV), Salmonella (SL1344), and Escherichia coli (AH50). The recombinant standard plasmid pMD19-BVDV was used as a positive control, and enzyme-free water was used as a negative control to evaluate the specificity of the established method.

[0054] The results are as follows Figure 2 Lane 1 is a positive control; Lanes 2-4 are RV, Salmonella (SL1344), and Escherichia coli (AH50) DNA samples; Lane 5 is a negative control. Only Lane 1 (recombinant standard plasmid pMD19-BVDV, positive control) has the target band, and the other lanes have no bands. The results show that the semi-nested RT-PCR detection method established in this study has good specificity.

[0055] (III) Comparison of clinical samples and fluorescent quantitative RT-PCR

[0056] The recombinant plasmid pMD19-BVDV was diluted to 1.42×10 8copies / μL-1.42×10 0 copies / μL, respectively, as templates, and enzyme-free water as negative control. Fluorescence quantitative RT-PCR detection was performed, and standard curves and melting curves were drawn. The results are shown in Figure 3 The results were compared with the semi-nested RT-PCR detection method established in this application.

[0057] The semi-nested RT-PCR detection method and fluorescent quantitative RT-PCR established in this experiment were used to detect nucleic acid in 42 cow dung samples. Sample processing: Take an appropriate amount of each sample and add 500 μL sterile PBS buffer, vortex and shake, freeze and thaw repeatedly 3 times, centrifuge at 4°C and 12000×g for 10 minutes, take the supernatant, use the viral genome RNA extraction kit to extract the total RNA of the sample, and reverse transcribe it into cDNA. Using this as a template, the practicality of the established method was evaluated.

[0058] The results showed that the semi-nested RT-PCR method detected 20 positive samples with a positive rate of 47.62%, and the real-time fluorescence quantitative method detected 17 positive samples with a positive rate of 40.48%. Figure 4 The agreement rate between the two detection methods was 92.9%, and the three sample bands that were positive in semi-nested RT-PCR detection and negative in fluorescence quantitative detection were recovered for sequencing identification, and the results showed that they were BVDV genome sequences.

[0059] Although the embodiments of the present invention are disclosed for illustrative purposes, those skilled in the art will appreciate that various substitutions, changes and modifications are possible without departing from the spirit and scope of the present invention and the appended claims. Therefore, the scope of the present invention is not limited to the contents disclosed in the embodiments.

Claims

1. A primer composition, characterized in that The primer composition comprises at least one of the following 1)-8): 1) The nucleotide sequence as shown in SEQ ID NO: 01, or a nucleotide sequence in which one or more nucleotides are substituted and / or deleted and / or added and which has the same function as the nucleotide sequence as shown in SEQ ID NO: 01; 2) the nucleotide sequence as shown in SEQ ID NO: 02, or a nucleotide sequence in which one or more nucleotides are substituted and / or deleted and / or added and which has the same function as the nucleotide sequence as shown in SEQ ID NO: 02; 3) the nucleotide sequence as shown in SEQ ID NO: 03, or a nucleotide sequence in which one or more nucleotides are substituted and / or deleted and / or added and which has the same function as the nucleotide sequence as shown in SEQ ID NO: 03; 4) the nucleotide sequence as shown in SEQ ID NO: 04, or a nucleotide sequence having the same function as the nucleotide sequence as shown in SEQ ID NO: 4 by substitution and / or deletion and / or addition of one or more nucleotides of the nucleotide sequence as shown in SEQ ID NO: 04; 5) the nucleotide sequence as shown in SEQ ID NO: 05, or a nucleotide sequence in which one or more nucleotides are substituted and / or deleted and / or added and which has the same function as the nucleotide sequence as shown in SEQ ID NO: 5; 6) the nucleotide sequence as shown in SEQ ID NO: 06, or a nucleotide sequence in which one or more nucleotides are substituted and / or deleted and / or added and which has the same function as the nucleotide sequence as shown in SEQ ID NO: 6; 7) The nucleotide sequence as shown in SEQ ID NO: 07, or a nucleotide sequence in which one or more nucleotides are substituted and / or deleted and / or added and which has the same function as the nucleotide sequence as shown in SEQ ID NO: 07; 8) The nucleotide sequence as shown in SEQ ID NO: 08, or a nucleotide sequence in which one or more nucleotides are substituted and / or deleted and / or added and which has the same function as the nucleotide sequence as shown in SEQ ID NO:

08.

2. The primer composition according to claim 1, characterized in that The primer composition comprises at least one of the following 1)-8): 1) the nucleotide sequence shown in SEQ ID NO: 01 and / or SEQ ID NO: 04; 2) the nucleotide sequence shown in SEQ ID NO: 01 and / or SEQ ID NO: 05; 3) the nucleotide sequence shown in SEQ ID NO: 01 and / or SEQ ID NO: 08; 4) the nucleotide sequence shown in SEQ ID NO: 02 and / or SEQ ID NO: 04; 5) the nucleotide sequence shown in SEQ ID NO: 02 and / or SEQ ID NO: 06; 6) the nucleotide sequence shown in SEQ ID NO: 03 and / or SEQ ID NO: 04; 7) the nucleotide sequence shown in SEQ ID NO: 03 and / or SEQ ID NO: 05; 8) The nucleotide sequence shown in SEQ ID NO: 03 and / or SEQ ID NO:

08.

3. The primer composition according to claim 1 or 2, characterized in that: The primer composition comprises: 1) the nucleotide sequence shown in SEQ ID NO: 01 and SEQ ID NO: 04; and / or 2) The nucleotide sequences shown in SEQ ID NO: 02 and SEQ ID NO:

04.

4. A kit, characterized in that: The kit comprises the primer composition according to any one of claims 1 to 3.

5. A method for detecting bovine viral diarrhea virus, characterized in that: The method comprises performing a PCR amplification reaction using the primer composition according to any one of claims 1 to 3.

6. The method according to claim 5, characterized in that The PCR amplification reaction comprises the following steps: S1. Extract RNA from the sample to be tested and reverse transcribe it into cDNA; S2. Using the cDNA described in S1 as a template, a PCR amplification reaction A is performed using the primer composition described in any one of claims 1 to 3 to obtain a PCR product 1; S3. Using the PCR product 1 described in S2 as a template, a PCR amplification reaction B is performed using the primer composition described in any one of claims 1 to 3 to obtain a PCR product 2; S4. Result judgment.

7. The method according to claim 6, characterized in that The system of the PCR amplification reaction A is: 10 μL of 2×Taq, 2 μL of primer combination, 2 μL of cDNA template, and finally supplemented with ddH2O to 20 μL; The reaction conditions of PCR amplification reaction A were: 95°C for 5 min, 95°C for 30 s, 58°C for 45 s, 72°C for 20 s, 33 cycles; total extension at 72°C for 8 min.

8. The method according to claim 6 or 7, characterized in that: The system of the PCR amplification reaction B is: 2×Taq 10 μL, primer combination 2 μL, PCR product 1 template 2 μL, and finally supplemented with ddH2O to 20 μL; The reaction conditions of PCR amplification reaction B were: 95°C for 5 min, 95°C for 30 s, 58°C for 45 s, 72°C for 20 s, 33 cycles; total extension at 72°C for 8 min.

9. Use of the primer composition according to any one of claims 1 to 3, the kit according to claim 4, or the method according to any one of claims 5 to 8.

10. The use according to claim 9, characterized in that: The application includes at least one of the following 1)-6): 1) Identification of bovine viral diarrhea virus; 2) Prepare a kit or related products for identifying bovine viral diarrhea virus; 3) Detecting whether the pathogenic microorganism to be tested is bovine viral diarrhea virus; 4) preparing a kit or related products for detecting whether the pathogenic microorganism to be tested is bovine viral diarrhea virus; 5) Detecting whether the sample to be tested contains bovine viral diarrhea virus; 6) Prepare a kit or related products for detecting whether a sample to be tested contains bovine viral diarrhea virus.

Images