Protein variant combination for improving immune function of iNKT cells and application

Abstract

The invention discloses a protein variant combination for improving the immune function of iNKT cells and application, and relates to the technical field of tumor immunity. Comprising a protein variant combination consisting of a protein variant ANT A3, a protein variant GLUT3G1, a protein variant LDHB B2, a protein variant PC P4 and a protein variant PCK1K2; according to the invention, gene sequences of the five protein variants are simultaneously embedded into an iNKT cell genome in a fixed-point manner for the first time to form a metabolic reconstitution MetaR-iNKT cell, and it is found that when the MetaR-iNKT cell and an ATP mitochondrial transporter protein inhibitor PENAO are combined for use, lung cancer solid tumors can be synergistically and better killed.

Description

Technical Field

[0001] The present invention relates to the field of tumor immunity technology, and more specifically to a protein variant combination and application for improving the immune function of iNKT cells. Background Art

[0002] iNKT cells (invariant natural killer T cells) are a unique type of T cells that have both the innate immunity of NK cells and the acquired adaptive immunity of T cells. They recognize lipid antigens through TCR (T cell receptor) and respond rapidly within minutes. They release different types of cytokines and directly kill cells according to stimulation. At the same time, they can drive DC cells, NK cells, T cells and other immune cells to work together to exert a combined therapeutic effect. Because iNKT cells have anti-tumor effects, they have become an important immune cell type in clinical immunotherapy.

[0003] However, as a subpopulation of T cells, iNKT cells are often limited in their functional persistence by tumor metabolic immunosuppressive microenvironments such as glucose competition and high lactic acid acidic environments during the process of infiltrating solid tumors. In order to improve the competitiveness of iNKT cells with solid tumor cells for glucose, the present invention uses an ATP mitochondrial transporter inhibitor called PENAO in combination with iNKT cells. This inhibitor can effectively inhibit the metabolism of glucose by solid tumor cells and weaken the competition between tumor cells and iNKT cells for sugar. However, the energy metabolism function of iNKT cells themselves will also be inhibited to a certain extent by the influence of PENAO drugs, limiting the combined effect of iNKT cells and PENAO.

[0004] Therefore, how to improve the immune ability of iNKT cells is an urgent problem to be solved by those skilled in the art. Summary of the invention

[0005] In view of this, the present invention provides a protein variant combination and application for improving the immune function of iNKT cells.

[0006] In order to achieve the above object, the present invention adopts the following technical solution:

[0007] A protein variant combination for improving the immune function of iNKT cells, wherein the protein variant combination comprises protein variant ANT A3, protein variant GLUT3 G1, protein variant LDHB B2, protein variant PC P4 and protein variant PCK1K2;

[0008] The nucleotide sequence of the protein variant ANT A3 is shown in SEQ ID No. 1;

[0009] The nucleotide sequence of the protein variant GLUT3 G1 is shown in SEQ ID No. 2;

[0010] The nucleotide sequence of the protein variant LDHB B2 is shown in SEQ ID No. 3;

[0011] The nucleotide sequence of the protein variant PCK1 K2 is shown in SEQ ID No. 4;

[0012] The nucleotide sequence of the protein variant PC P4 is shown in SEQ ID No.5.

[0013] A vector combination for improving the immune function of iNKT cells, the vector combination comprising a gene variant combination vector iNKT-MetaR1, a gene variant combination vector iNKT-MetaR2 and a gene variant combination vector iNKT-MetaR3;

[0014] The gene variant combination vector iNKT-MetaR1 comprises: homology arm 1, HS4 insulator, CMV promoter, the protein variant ANT A3 gene of claim 1, P2A, the protein variant GLUT3 G1 gene of claim 1, P2A, mStayGold fluorescent reporter protein, poly (A) tail, HS4 insulator, homology arm 2, and the nucleotide sequence is shown in SEQ ID No. 6;

[0015] The gene variant combination vector iNKT-MetaR2 comprises: homology arm 3, HS4 insulator, PGK1 promoter, the protein variant LDHB B2 gene of claim 1, P2A, the protein variant PCK1 K2 gene of claim 1, P2A, mTagBFP2 fluorescent reporter protein, poly (A) tail, HS4 insulator, homology arm 4, and the nucleotide sequence is shown in SEQ ID No. 7;

[0016] The gene variant combination vector iNKT-MetaR3 includes: homology arm 5, HS4 insulator, EF1ɑcore promoter, protein variant PC P4 gene according to claim 1, P2A, mScarlet fluorescent reporter protein, poly (A) tail, HS4 insulator, homology arm 6, and the nucleotide sequence is shown in SEQ ID No.8.

[0017] Furthermore, the gene variant combination vector iNKT-MetaR1 corresponds to the human genome CCR5 safe insertion site to cut sgRNA1, and the gene sequence of sgRNA1 is:

[0018] AGGCTTCCCGCATTCAAAAT, as shown in SEQ ID No.9;

[0019] The gene variant combination vector iNKT-MetaR2 corresponds to the safe insertion site of human genome chromosome 15 (15q25.3) to cut sgRNA2, and the gene sequence of sgRNA2 is:

[0020] AAAGCTATTACACGGTTCTG, as shown in SEQ ID No. 11;

[0021] The gene variant combination vector iNKT-MetaR3 corresponds to the safe insertion site of human genome chromosome 14 (14q32.3) to cut sgRNA3, and the gene sequence of sgRNA3 is:

[0022] GTCGGGCCAGTGATCTTGTA, as shown in SEQ ID No.13.

[0023] A transgenic iNKT cell, comprising the gene variant combination vector iNKT-MetaR1, the gene variant combination vector iNKT-MetaR2 and the gene variant combination vector iNKT-MetaR3 as claimed in claim 2.

[0024] Application of protein variant combinations in the preparation of tumor immunotherapy drugs.

[0025] It can be seen from the above technical solution that, compared with the prior art, the beneficial effects of the present invention are:

[0026] The present invention provides a protein variant ANT A3 of the ATP mitochondrial transporter ANT, which can effectively improve the glucose glycolysis activity of iNKT cells, has higher iNKT cell mitochondrial ATP generation activity than the wild-type ANT protein, and improves the drug tolerance of iNKT cells to the wild-type ANT inhibitor PENAO;

[0027] The present invention provides a protein variant of glucose transporter 3, GLUT3 G1, which has a higher iNKT cell glucose uptake capacity than wild-type GLUT3 and can effectively enhance the iNKT cell glucose uptake capacity;

[0028] The present invention provides a protein variant LDHB B2 of lactate dehydrogenase B, which has a higher iNKT cell lactate metabolism efficiency than wild-type LDHB and can effectively improve the iNKT cell lactate metabolism efficiency.

[0029] The present invention provides a protein variant PCK1 K2 of phosphoenolpyruvate carboxykinase 1, which has a stronger iNKT cell gluconeogenesis effect than wild-type PCK1 and can effectively improve the iNKT cell gluconeogenesis effect;

[0030] The present invention provides a protein variant PC P4 of pyruvate carboxylase, which has higher cell antioxidant capacity than wild-type PC protein and can promote the production of cell antioxidant metabolite oxaloacetate;

[0031] The present invention is the first to simultaneously and site-specifically embed the gene sequences of these five protein variants into the iNKT cell genome to form metabolically reconstructed MetaR-iNKT cells, and finds that MetaR-iNKT cells combined with the ATP mitochondrial transporter protein inhibitor PENAO can synergistically better kill lung cancer solid tumors. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0033] Figure 1 This is a comparison of the extracellular glucose uptake efficiency of 7 iNKT cell lines and H1299 lung cancer cell line;

[0034] Figure 2 It is a Welch's t test p value comparison diagram of the extracellular glucose uptake efficiency of iNKT-MetaR1, GLUT3 G1 and other cell lines;

[0035] Figure 3 This is a comparison chart of the intracellular ATP generation efficiency of seven iNKT cells including iNKT-MetaR1 and ANT A3 and H1299 lung cancer cell line;

[0036] Figure 4 This is a Welch's t test p value comparison diagram of the intracellular ATP generation efficiency of iNKT-MetaR1, ANT A3 and other cell lines;

[0037] Figure 5 This is a comparison of the intracellular ATP production efficiency of seven iNKT cells including iNKT-MetaR2 and H1299 lung cancer cell line;

[0038] Figure 6 This is a heat map showing the significance of the Welch's t test for the intracellular ATP generation efficiency between iNKT-MetaR2 and other cell lines;

[0039] Figure 7 Comparison of intracellular lactic acid content between 7 iNKT cell lines and H1299 lung cancer cell line;

[0040] Figure 8 It is the Welch's t test significance heat map of intracellular lactate levels in iNKT-MetaR2, LDHB B4 and other cell lines;

[0041] Fig. 9 Comparison of intracellular ROS content between 7 iNKT cell lines and H1299 lung cancer cell line;

[0042] Fig.10 This is the Welch's t test significance heat map of intracellular ROS levels in iNKT-MetaR3, iNKT-MetaR2 and other cell lines;

[0043] Fig.11 This is a comparison of the number of tumor infiltrating cells of each iNKT cell line in lung adenocarcinoma organoid sample No. 1;

[0044] Fig.12 This is a comparison of the number of tumor infiltrating cells of each iNKT cell line in lung adenocarcinoma organoid sample No. 2;

[0045] Fig.13 This is a comparison of the number of tumor-infiltrating cells of each iNKT cell line in lung adenocarcinoma organoid sample No. 3;

[0046] Fig.14 This is a comparison of the number of tumor infiltrating cells of each iNKT cell line in lung squamous cell carcinoma organoid sample No. 1;

[0047] Fig.15 This is a comparison of the number of tumor-infiltrating cells of each iNKT cell line in lung squamous cell carcinoma organoid sample No. 2;

[0048] Fig.16 This is a comparison of the number of tumor-infiltrating cells of each iNKT cell line in lung squamous cell carcinoma organoid sample No. 3;

[0049] Fig.17 Box plot of the total data of the number of tumor-infiltrating cells of each iNKT cell line in the total lung cancer organoid sample statistics;

[0050] Fig.18 This is the p-value relationship diagram between MetaR-iNKT and each cell line in the infiltration of lung cancer tumor samples;

[0051] Fig.19 This is a graph showing the expression of activated anti-apoptotic genes in various iNKT cell lines infiltrating lung adenocarcinoma organoids under PENAO drug treatment;

[0052] Fig. 20 This is the Welch T test significance heat map of MetaR-iNKT and genes related to different cell lines;

[0053] Fig.21 This is a graph showing the expression of activated anti-apoptotic genes in various iNKT cell lines infiltrating lung adenocarcinoma organoids without PENAO drug treatment;

[0054] Fig. 22 This is the Welch T test significance heat map of MetaR-iNKT and genes related to different cell lines;

[0055] Fig.23 This is a graph showing the expression of activated stemness and anti-apoptotic genes in various iNKT cell lines infiltrating lung squamous cell carcinoma organoids under PENAO drug treatment;

[0056] Fig.24 This is the Welch T test significance heat map of MetaR-iNKT and genes related to different cell lines;

[0057] Fig.25 This is a graph showing the expression of activated stemness and anti-apoptotic genes in various iNKT cell lines infiltrating lung squamous cell carcinoma organoids without PENAO drug treatment;

[0058] Fig.26 The Welch T test significance heat map of MetaR-iNKT. and genes related to different cell lines;

[0059] Fig. 27 This is a comparison of the tumor killing ability of MetaR-iNKT and other iNKT cell lines in the presence or absence of PENAO;

[0060] Fig.28 This is the Welch's t test significance relationship diagram between MetaR-iNKT and other iNKT cell lines. DETAILED DESCRIPTION

[0061] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0062] Example 1

[0063] In order to improve the metabolic adaptability of iNKT cells to the tumor microenvironment, the present invention sets and constructs three transgenic nucleic acid vectors iNKT-MetaR1, iNKT-MetaR2 and iNKT-MetaR3, and through CRISPR / Cas9 induction, multiple related gene variants such as ANT A3, GLUT3 G1, LDHB B2, PCK1 K2, PC P4, which can functionally compensate for the inhibition of ATP mitochondrial transporter ANT activity caused by PENAO, improve the antioxidant capacity of immune cells and promote the metabolic adaptability of tumor-infiltrating immune cells in the tumor microenvironment, are co-expressed in iNKT cells:

[0064] The nucleotide sequence of the protein variant ANT A3 (894 bp) is shown in SEQ ID No. 1;

[0065] The nucleotide sequence of the protein variant GLUT3 G1 (1470 bp) is shown in SEQ ID No. 2;

[0066] The nucleotide sequence of the protein variant LDHB B2 (993 bp) is shown in SEQ ID No. 3;

[0067] The nucleotide sequence of the protein variant PCK1 K2 (1866 bp) is shown in SEQ ID No. 4;

[0068] The nucleotide sequence of protein variant PC P4 (3435 bp) is shown in SEQ ID No. 5;

[0069] (1) Gene variant combination vector iNKT-MetaR1: homology arm 1-HS4 insulator-CMV promoter-ANT A3-P2A-GLUT3 G1-P2A-mStayGold fluorescent reporter protein-poly (A) tail-HS4 insulator-homology arm 2;

[0070] The sequence information of the gene variant combination vector iNKT-MetaR1 (4639 bp) is shown in SEQ ID No. 6;

[0071] (2) Gene variant combination vector iNKT-MetaR2: homology arm 3-HS4 insulator-PGK1 promoter-LDHBB2-P2A-PCK1 K2-P2A-mTagBFP2 fluorescent reporter protein-poly (A) tail-HS4 insulator-homology arm 4;

[0072] The sequence information of the gene variant combination vector iNKT-MetaR2 (5134 bp) is shown in SEQ ID No. 7;

[0073] (3) Gene variant combination vector iNKT-MetaR3: homology arm 5-HS4 insulator-EF1ɑcore promoter-PCP4-P2A-mScarlet fluorescent reporter protein-poly (A) tail-HS4 insulator-homology arm 6;

[0074] The sequence information of gene variant combination vector iNKT-MetaR3 (5340 bp) is shown in SEQ ID No.8. 3. Specific implementation methods

[0076] (1) Site-specific insertion of gene variant expression vector into the iNKT cell genome

[0077] Synthesize guide4iNKT, which contains sgRNA1, sgRNA2, and sgRNA3 that guide eSpCas9-plus to locate to the three insertion sites of the gene variant combination;

[0078] The guide4iNKT structure is:

[0079] U6 promoter-insertion site sgRNA1-poly T tail-H1 promoter-insertion site sgRNA2-poly T tail-7SK promoter-insertion site sgRNA3-poly T tail;

[0080] The gene variant combination vector iNKT-MetaR1 corresponds to the human genome CCR5 safe insertion site to cut sgRNA1, and the gene sequence of sgRNA1 is:

[0081] AGGCTTCCCGCATTCAAAAT, as shown in SEQ ID No.9;

[0082] A gene insertion site (156 bp) containing sgRNA1, as shown in SEQ ID No. 10;

[0083] (>hg38_dna range=chr3: 46371907-463720625'pad=03'pad=0strand=+repeatMasking=none)

[0084] The gene variant combination vector iNKT-MetaR2 corresponds to the safe insertion site of human genome chromosome 15 (15q25.3) to cut sgRNA2. The gene sequence of sgRNA2 is:

[0085] AAAGCTATTACACGGTTCTG, as shown in SEQ ID No. 11;

[0086] A gene insertion site (200 bp) containing sgRNA2, as shown in SEQ ID No. 12;

[0087] (>hg38_dna range=chr15:85922854-859230535'pad=03'pad=0strand=+repeatMasking=none)

[0088] The gene variant combination vector iNKT-MetaR3 corresponds to the safe insertion site of human genome chromosome 14 (14q32.3) to cut sgRNA3. The gene sequence of sgRNA3 is:

[0089] GTCGGGCCAGTGATCTTGTA, as shown in SEQ ID No.13.

[0090] A gene insertion site (200 bp) containing sgRNA3, as shown in SEQ ID No. 14;

[0091] (>hg38_dna range=chr14: 101467601-101467800 5'pad=0 3'pad=0strand=+repeatMasking=none)

[0092] Guide4iNKT was mixed with the vector expressing eSpCas9-plus (Addgene No. 126767) and the above three gene variant combination vectors iNKT-MetaR1, iNKT-MetaR2, and iNKT-MetaR3 in a ratio of 3:3:1:1:1 and electroporated by Nucleofector TM Technology (Lonza) was transfected into iNKT cells according to the following steps. Material preparation:

[0093] 1) Plasmid DNA: prepare guide4iNKT, eSpCas9-plus, iNKT-MetaR1, iNKT-MetaR2, iNKT-MetaR3 plasmids. The concentration of each plasmid should be 1-5 μg;

[0094] 2) iNKT cells: prepare 1x 106-5x 106 iNKT cells, the cells should be at 70-85% confluence;

[0095] 3) Nucleofector TM Solution: Use Nucleofector suitable for iNKT cells TM Solution;

[0096] 4) Nucleofector TM Device: Make sure the device is calibrated and ready to use;

[0097] 5) Nucleocuvette TM : Use suitable Nucleofector TM Nucleocuvette for Device TM .

[0098] Steps:

[0099] 1) Cell preparation: iNKT cells were collected by centrifugation and the culture medium was removed; the cells were washed twice with PBS and then resuspended in an appropriate amount of Nucleofector TM Solution;

[0100] 2) Plasmid mixing: 5 plasmids (guide4iNKT, eSpCas9-plus, iNKT-MetaR1, iNKT-MetaR2, iNKT-MetaR;

[0101] 3) Mix together, the total amount does not exceed 5μg; add the plasmid mixture to the cell suspension, ensuring that the plasmid volume does not exceed 10% of the total reaction volume; 3) Electrotransfection: 1 Transfer the cells and plasmid mixture to the Nucleocuvette TM Insert Nucleocuvette TM To Nucleofector TM Device; select Nucleofector suitable for iNKT cells TM Program (you can refer to the optimization program provided by Lonza, or use the Cell Line Optimization Nucleofector TM Kit for optimization); press the "Start" button to start the electro-transfection process;

[0102] 4) Post-transfection treatment: After electro-transfection is completed, immediately remove the sample from the Nucleocuvette with 500 μL of pre-warmed culture medium. TM Remove from the culture medium; transfer the cells to pre-warmed culture medium and incubate in a 37°C, 5% CO2 incubator;

[0103] 5) Subsequent culture: Continue to culture the cells and add selective agents (such as antibiotics) after 24-72 hours to screen for successfully transfected cells; analyze gene expression at different time points according to experimental requirements.

[0104] Note: Make sure all reagents and equipment are preheated to 37°C before use. Use highly pure plasmid DNA with an A260 / A280 ratio of at least 1.8. Minimize the number of cells in the Nucleofector after electroporation. TM The residence time in the solution can improve the cell survival rate.

[0105] Through the above steps, the five plasmids were co-transfected into iNKT cells, and a higher site-specific co-knock-in efficiency of iNKT-MetaR1, iNKT-MetaR2, and iNKT-MetaR3 gene fragments was obtained.

[0106] (2) Overexpression plasmids of iNKT-MetaR1, ANT A3, GLUT3 G1, wild-type ANT+wild-type GLUT3, wild-type ANT (NCBI Reference Sequence: NM_001152.5) ​​or wild-type GLUT3 (NCBI Reference Sequence: NM_006931.3) were respectively introduced into iNKT cells (see the figure for the plasmid structure) to construct 6 cell lines. The glucose uptake and ATP generation efficiencies of the above cell lines, wild-type iNKT cell line and lung cancer H1299 cell line were compared under the condition of 5 μM PENAO drug.

[0107] The present invention uses Glucose Uptake-Glo TM The detection kit quantitatively detects the glucose uptake capacity of each cell line sample treated with PENAO drug; 2.0 kit (supplier Promega, catalog number G9242) was used to detect the intracellular ATP content of each cell line sample treated with PENAO drug.

[0108] The results are as follows Figure 1-4 As shown, Figure 1 Box plot quantitative analysis of the extracellular glucose uptake capacity of 7 iNKT cell lines and H1299 lung cancer cell line; Figure 2 Two-tailed Welch's t test was used to compare the significant differences in the ability of iNKT-MetaR1, GLUT3 G1 and other cell lines to uptake extracellular glucose in the presence or absence of PENAO drug; Figure 3 Box plot quantitative analysis of the intracellular ATP production capacity of 7 iNKT cells and H1299 lung cancer cell line; Figure 4 Two-tailed Welch's t test was used to compare the significant differences in the ability of iNKT-MetaR1, ANT A3 and other cell lines to generate intracellular ATP in the presence or absence of PENAO.

[0109] It can be observed that in the presence or absence of PENAO, the two cell lines containing GLUT3 G1 protein variants, MetaR1-iNKT and GLUT3 G1, showed significantly enhanced extracellular glucose uptake capacity compared with the wild-type GLUT3 cell line and the H1299 lung cancer cell line ( Figure 1-2 ); and the two cell lines MetaR1-iNKT and ANT A3 containing ANT A3 protein variants showed significantly enhanced intracellular ATP production capacity compared with wild-type GLUT3 cell lines and H1299 lung cancer cell lines ( Figure 3-4 ). Therefore, GLUT3 G1, ANT ANT3 and iNKT-MetaR1 all show that iNKT cells have a stronger glucose competition advantage over tumor cells.

[0110] (3) Overexpression plasmids of iNKT-MetaR2, iNKT-MetaR3, LDHB B2, PCK1 K2, wild-type LDHB + wild-type PCK1, wild-type LDHB, wild-type PCK1, or wild-type PC were transferred into iNKT cells (see the figure for plasmid structure) to construct 6 cell lines. The ATP production efficiency, lactate metabolism rate, and intracellular ROS oxide abundance of the above cell lines, wild-type iNKT cell line, and lung cancer H1299 cell line were compared in the presence of 5 μM PENAO and 20 mmol / L lactate at pH < 6.7;

[0111] The present invention uses 2.0 kit (supplier Promega, catalog number G9242) was used to detect the intracellular ATP content of each cell line sample treated with PENAO drug; Lactate-Glo TM Kit (supplier Promega, catalog number J5021) was used to detect the intracellular lactate content of each cell line sample treated with PENAO drug and lactic acid; DCFDA-cell ROS content detection kit (supplier Abcam, catalog number ab113851) was used to detect the intracellular ROS content of each cell line sample treated with PENAO drug and lactic acid.

[0112] The results are as follows Figure 5-10 As shown, Figure 5 Box plot quantitative analysis of the intracellular ATP production capacity of 7 iNKT cells and H1299 lung cancer cell line; Figure 6 Two-tailed Welch's t test was used to compare the significant difference in the ability of iNKT-MetaR2 and other cell lines to generate intracellular ATP in the presence or absence of PENAO drug; Figure 7Box plot quantitative analysis of intracellular lactate content in seven iNKT cell lines and H1299 lung cancer cell line; Figure 8 Two-tailed Welch's t test was used to compare the significant differences in intracellular lactate content between iNKT-MetaR2, LDHB B2 and other cell lines with or without PENAO drug; Fig. 9 Box plot quantitative analysis of intracellular ROS content in 7 iNKT cell lines and H1299 lung cancer cell line; Fig.10 Two-tailed Welch's t test was used to compare the significant differences in intracellular ROS content between iNKT-MetaR3, iNKT-MetaR2 and other cell lines in the presence or absence of PENAO.

[0113] It can be found that in the presence or absence of PENAO drugs, the MetaR2-iNKT cell line containing LDHB B2 and PCK1 K2 protein variants performed best in both ATP generation efficiency and intracellular lactate content tests ( Figure 5-8 ); MetaR3-iNKT cell line containing PC P4 protein variant performed best in the test of intracellular ROS content ( Figure 9-10 ).

[0114] (4) The present invention mixes equal amounts of iNKT gene-modified cell lines overexpressing metabolic remodeling MetaR-iNKT cells (iNKT-MetaR1 / R2 / R3), iNKT-MetaR1 / R2, iNKT-MetaR1 / R3, iNKT-MetaR2 / R3, iNKT-MetaR1, iNKT-MetaR2, and iNKT-MetaR3, and wild-type iNKT cell lines, and adds these iNKT cells mixed in equal amounts to three lung adenocarcinoma organoids LUAD-Orga1, LUAD-Orga2, and LUAD-Orga3 and three lung squamous cell carcinomas LUSC-Orga1 , LUSC-Orga2, and LUSC-Orga3 organoids were treated. After 7 days of co-culture in the presence or absence of PENAO drug environment (PENAO concentration was 2 μM), the suspended cells in the culture medium were washed away, and the tumor organoid tissue DNA was extracted. After sequencing, the relative numbers of 8 cell lines including metabolically remodeled MetaR-iNKT cells (iNKT-MetaR1 / R2 / R3), iNKT-MetaR1 / R2, iNKT-MetaR1 / R3, iNKT-MetaR2 / R3, iNKT-MetaR1, iNKT-MetaR2, iNKT-MetaR3, and wild-type iNKT were obtained.

[0115] The results are as follows Figure 11-18 As shown, Figure 11-16Comparison of the number of tumor-infiltrating cells of each iNKT cell line in each sample of lung squamous cell carcinoma and lung adenocarcinoma organoids; Fig.17 In order to summarize the above sample data for quantitative analysis of the box plot obtained by analyzing the total sample data of lung cancer organoids, Fig.18 Two-tailed Welch's t test was used to analyze the statistical significance of MetaR-iNKT cell line and other iNKT cell lines in the infiltration of lung cancer tumor samples.

[0116] The results showed that in the environment with the addition of PENAO drug, the number of cells infiltrating tumor tissues of metabolically reconstructed MetaR-iNKT cells increased significantly compared with the other 7 iNKT gene-modified cell lines and wild-type iNKT cell lines, and the number of tumor infiltrations of multiple combination iNKT-MetaR1 / R2, iNKT-MetaR1 / R3, and iNKT-MetaR2 / R3 cells was also higher than that of iNKT-MetaR1, iNKT-MetaR2, iNKT-MetaR3 and wild-type iNKT cells.

[0117] The present invention further performed single-cell sequencing on 5 LUAD-Orga1 lung adenocarcinoma and 5 LUSC-Orga1 lung squamous cell carcinoma organoid samples co-cultured with metabolically remodeled MetaR-iNKT cells (iNKT-MetaR1 / R2 / R3), iNKT-MetaR1 / R2, iNKT-MetaR1 / R3, iNKT-MetaR2 / R3, and wild-type iNKT in the PENAO drug environment.

[0118] The results are as follows Figure 19-26 As shown, Figure 19-20 The expression of IFNγ, CD25, HLA-DR, FOXO1 and BCL2 genes in each infiltrating iNKT cell line in lung adenocarcinoma organoids treated with PENAO drug; Figure 21-22 The expression of IFNγ, CD25, HLA-DR, FOXO1 and BCL2 genes in each infiltrating iNKT cell line in lung adenocarcinoma organoids without PENAO drug treatment; Figure 23-24 The expression of IFNγ, CD25, HLA-DR, FOXO1 and BCL2 genes in each infiltrating iNKT cell line in lung squamous cell carcinoma organoids treated with PENAO drug; Figure 25-26 The expression of IFNγ, CD25, HLA-DR, FOXO1 and BCL2 genes in each iNKT cell line infiltrating lung squamous cell carcinoma organoids without PENAO drug treatment. The above statistical analysis used the two-tailed Welch's t test method to analyze the statistical significance of MetaR-iNKT cell line and other iNKT cell lines in infiltrating lung cancer tumor samples.

[0119] The results showed that the expression of activation indicators IFNγ, CD25, HLA-DR, cell stemness indicator FOXO1 and anti-apoptosis indicator BCL2 of metabolic remodeling MetaR-iNKT tumor-infiltrating cells showed superior cell state with or without PENAO drugs, and in the case of lung adenocarcinoma or lung squamous cell carcinoma. The expression of IFNγ, CD25, HLA-DR, cell stemness indicator FOXO1 and anti-apoptosis indicator BCL2 produced by them combined the respective advantages of MetaR1-iNKT, MetaR2-iNKT, MetaR3-iNKT, MetaR1 / 2-iNKT, MetaR1 / 3-iNKT, MetaR2 / 3-iNKT and other cell lines.

[0120] (5) 2×106 iNKT gene-modified cell lines overexpressing iNKT-MetaR1 / R2 / R3 (metabolic remodeling MetaR-iNKT cells), iNKT-MetaR1 / R2, iNKT-MetaR1 / R3, iNKT-MetaR2 / R3, iNKT-MetaR1, iNKT-MetaR2, and iNKT-MetaR3, as well as wild-type iNKT cell lines, were added to 1×107 cells of LUAD-Orga1, LUAD-Orga2, and LUAD-Orga3 lung adenocarcinoma and LUSC-Orga1, LUSC-Orga2, and LUSC-Orga3 lung squamous cell carcinoma organoids, respectively. After 14 days of co-culture in the presence or absence of PENAO (PENAO concentration of 4 μM), the suspended cells were removed and used. 2.0 kit (supplier Promega, catalog number G9242) was used to detect the cell viability of tumor organoid tissues.

[0121] The results are as follows Figure 27-28 As shown, Fig. 27 To compare the killing effects of MetaR-iNKT cells and other iNKT cells on lung cancer tumor organoids with or without the combination of PENAO drugs; Fig.28 The cell viability values ​​of each iNKT cell line were analyzed for significance using Welch's t test.

[0122] The results showed that metabolically remodeled MetaR-iNKT cells, in all six lung cancer organoid tissues, showed a significantly more significant synergistic tumor cell killing effect when combined with PENAO compared with the other six partially genetically modified iNKT cell lines and the wild-type iNKT cell line, compared with the absence of PENAO.

[0123] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A protein variant combination for improving the immune function of iNKT cells, characterized in that: The protein variant combination is protein variant ANT A3, protein variant GLUT3 G1, protein variant LDHB B2, protein variant PC P4 and protein variant PCK1 K2; The nucleotide sequence of the protein variant ANT A3 is shown in SEQ ID No. 1; The nucleotide sequence of the protein variant GLUT3 G1 is shown in SEQ ID No. 2; The nucleotide sequence of the protein variant LDHB B2 is shown in SEQ ID No. 3; The nucleotide sequence of the protein variant PCK1 K2 is shown in SEQ ID No. 4; The nucleotide sequence of the protein variant PC P4 is shown in SEQ ID No.

5.

2. A vector combination for improving the immune function of iNKT cells, characterized in that: The vector combination is a gene variant combination vector iNKT-MetaR1, a gene variant combination vector iNKT-MetaR2 and a gene variant combination vector iNKT-MetaR3; The gene variant combination vector iNKT-MetaR1 comprises: homology arm 1, HS4 insulator, CMV promoter, the protein variant ANT A3 gene of claim 1, P2A, the protein variant GLUT3 G1 gene of claim 1, P2A, mStayGold fluorescent reporter protein, poly (A) tail, HS4 insulator, homology arm 2, and the nucleotide sequence is shown in SEQ ID No. 6; The gene variant combination vector iNKT-MetaR2 comprises: homology arm 3, HS4 insulator, PGK1 promoter, the protein variant LDHB B2 gene of claim 1, P2A, the protein variant PCK1 K2 gene of claim 1, P2A, mTagBFP2 fluorescent reporter protein, poly (A) tail, HS4 insulator, homology arm 4, and the nucleotide sequence is shown in SEQ ID No. 7; The gene variant combination vector iNKT-MetaR3 includes: homology arm 5, HS4 insulator, EF1ɑcore promoter, protein variant PC P4 gene according to claim 1, P2A, mScarlet fluorescent reporter protein, poly (A) tail, HS4 insulator, homology arm 6, and the nucleotide sequence is shown in SEQ ID No.

8.

3. A vector combination for improving the immune function of iNKT cells according to claim 2, characterized in that: The gene variant combination vector iNKT-MetaR1 corresponds to the human genome CCR5 safe insertion site to cut sgRNA1, and the gene sequence of sgRNA1 is: AGGCTTCCCGCATTCAAAAT, as shown in SEQ ID No.9; The gene variant combination vector iNKT-MetaR2 corresponds to the safe insertion site of human genome chromosome 15 (15q25.3) to cut sgRNA2, and the gene sequence of sgRNA2 is: AAAGCTATTACACGGTTCTG, as shown in SEQ ID No. 11; The gene variant combination vector iNKT-MetaR3 corresponds to the safe insertion site of human genome chromosome 14 (14q32.3) to cut sgRNA3, and the gene sequence of sgRNA3 is: GTCGGGCCAGTGATCTTGTA, as shown in SEQ ID No.

13.

4. A transgenic iNKT cell, characterized in that: The cell comprises the gene variant combination vector iNKT-MetaR1, the gene variant combination vector iNKT-MetaR2 and the gene variant combination vector iNKT-MetaR3 as claimed in claim 2.

5. Use of the protein variant combination according to claim 1 in the preparation of tumor immunotherapy drugs.

Images