RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection kit for various aspergillus and candida and use method of RT-PCR detection kit

Abstract

The invention belongs to the technical field of molecular biology, and particularly relates to an RT-PCR (reverse transcription-polymerase chain reaction) detection kit for various aspergillus and candida and a use method of the RT-PCR detection kit, specifically, the detection kit comprises an RT-PCR primer probe, a buffer solution and Taq enzyme, the primer probes comprise forward and reverse amplification primers and detection probes respectively aiming at aspergillus fumigatus, aspergillus niger, aspergillus flavus, aspergillus terreus, aspergillus nidulans, candida auricula and candida albicans; the sequences of the primers are respectively shown as SEQ ID NO.1-SEQ ID NO.17. The invention also discloses a method for The kit disclosed by the invention can be used for simultaneously detecting and identifying the five types of aspergillus and the two types of candida and accurately identifying pathogens, has excellent sensitivity and detection accuracy, and has a guiding effect on further treatment and infection prevention.

Description

Technical Field

[0001] The invention belongs to the field of molecular biotechnology, and specifically relates to an RT-PCR detection kit for multiple Aspergillus and Candida and a use method thereof. Background Art

[0002] Respiratory fungal infection refers to an infectious disease caused by fungi invading the human respiratory system, including the nasal cavity, pharynx, trachea, bronchi and lungs. This infection can be local or systemic, and in severe cases may lead to organ dysfunction or even death. Respiratory fungal infection is an important public health problem worldwide, and its prevalence, number of infections and deaths each year show significant regional differences and temporal variations.

[0003] Aspergillus and Candida contamination and colonization of the upper respiratory tract are very common, and fungal colonization is an important risk factor for the development of invasive infection, which can lead to deep fungal infection when the host has predisposing factors. Domestic data show that the incidence of invasive fungal disease (IFI) in patients in general hospitals is 4.12%, and the infection site is the lower respiratory tract. The main fungal species detected are Candida, of which Candida albicans accounts for 67.29% and mold accounts for 6.20%. The incidence of nosocomial invasive Candida infection is 0.025% to 0.074%, and the mortality rate is as high as 37.7%. Candida albicans ranks first in nosocomial invasive Candida infection (57.1%). In recent years, the incidence of invasive Aspergillus infection has also gradually increased, accounting for 5.9% to 12.0% of all IFIs, with the most common Aspergillus fumigatus, Aspergillus flavus and Aspergillus niger.

[0004] The detection of respiratory fungal infections is of great significance for early diagnosis and treatment. Different detection methods have different characteristics in the diagnosis of respiratory fungal infections. The current detection methods are mainly divided into the following categories: fungal culture method, fluorescent staining method, fluorescent PCR method, serological detection, immunological detection method, etc. The fluorescent PCR method is increasingly widely used due to its high sensitivity and specificity, simple operation, and rapid results.

[0005] The technical difficulties that need to be improved for the fluorescent PCR detection method for fungal detection are mainly as follows: on the one hand, to improve the specificity of the detection, it is necessary to design highly specific primers and probes, and the variety of fungi and the diversity of gene sequences require that primers and probes must be very precise for the target fungi to avoid cross-reactions with other microorganisms, especially for fungal typing detection, it is necessary to find highly conserved regions of different fungi; on the other hand, to improve the sensitivity of the detection, it is well known that fungi have a relatively complex structure and hard cell walls, and nucleic acid extraction is relatively difficult, so the concentration of nucleic acids extracted is generally relatively low, so the sensitivity of the detection reagent can be improved to improve the detection rate and avoid the risk of missed detection. Therefore, there is a need in the art for primers and probes that can more efficiently realize the simultaneous detection of multiple indicators of fungi. Summary of the invention

[0006] In view of the problem mentioned in the background technology that the existing fluorescent PCR fungal detection technology has insufficient sensitivity and poor specificity, which leads to the inability to perform multiple fungal detections simultaneously, primers and probes are specifically designed to improve the sensitivity and specificity of detection.

[0007] The specific technical solution of the present invention is:

[0008] A RT-PCR detection kit for multiple Aspergillus and Candida, the detection kit comprises a reagent I and a reagent II, both of which comprise a buffer solution, a taq enzyme, and primers and probes for detection; the reagent I is used for detecting Aspergillus terreus, Aspergillus niger, Aspergillus fumigatus and Aspergillus flavus, and the reagent II is used for detecting Aspergillus nidulans, Candida albicans and Candida auris.

[0009] Further, the primers in the reagent I include forward amplification primers of Aspergillus terreus, Aspergillus niger, Aspergillus fumigatus and Aspergillus flavus: 5'-GTCCGRTCCTCGAGCGTA+TG-3', as shown in SEQ ID No.1; reverse amplification primer: 5'-ATCCCTACCTGATCCGAG+GTCA-3', as shown in SEQ ID No.2;

[0010] The reagent I probe includes Aspergillus terreus detection probes: 5'-CTTCGTCTTCCGCTCCG-3', 5'-CTTTGTCTTCCGCTCTG-3', as shown in SEQ ID No.10 and SEQ ID No.11;

[0011] Aspergillus niger detection probe: 5'-ACATGCTCTGTAGGATTG-3', as shown in SEQ ID No. 12;

[0012] Aflatoxin detection probe: 5'-CGCTTGCCGAACGCAAATCAATC-3', as shown in SEQ ID No. 13;

[0013] Aspergillus fumigatus detection probe: 5′-CCAGCCGACACCCAACTATTTTTCTAAGGT-3′, as shown in SEQ ID No.14.

[0014] Furthermore, the 5' end of the Aspergillus terreus detection probe sequence is labeled with a FAM fluorescent group, and the 3' end is labeled with a fluorescent quenching group MGB;

[0015] The 5' end of the Aspergillus niger detection probe sequence is labeled with a VIC fluorescent group, and the 3' end is labeled with a fluorescent quenching group MGB;

[0016] The 5' end of the Aspergillus flavus detection probe sequence is labeled with a CY5 fluorescent group, and the 3' end is labeled with a fluorescent quenching group BHQ2;

[0017] The 5' end of the Aspergillus fumigatus detection probe sequence is labeled with a ROX fluorescent group, and the 3' end is labeled with a fluorescent quenching group BHQ2.

[0018] Furthermore, the primers in the reagent II include a forward amplification primer of Aspergillus nidulans: 5'-GGCTTGTGTGTTGGGTC+GT-3', as shown in SEQ ID No.3; a reverse amplification primer: 5'-GCCCTAATGAGCGGGTGA+C-3', as shown in SEQ ID No.4;

[0019] Forward amplification primer of Candida albicans: 5'-GCTTGAAAGACGGTAGTGGTAA+GG-3', as shown in SEQ ID No.5; reverse amplification primer: 5'-CCGCCGCAAGCAATG+TTT-3', as shown in SEQ ID No.6;

[0020] Forward amplification primers for Candida auris:

[0021] 5'-CGATACGTAGTATGACTTGCAGA+CG-3',

[0022] 5'-GATACGTCGTACGACTTGCAGA+C-3', as shown in SEQ ID No.7 and SEQ ID No.8; reverse amplification primer: 5'-ACCGCGAAGATTGGTGAGAAGAC+AT-3', as shown in SEQ ID No.9;

[0023] The reagent II probe includes an Aspergillus nidulans detection probe: 5'-ACCGGACACGGTGCC-3', as shown in SEQ ID No. 15;

[0024] Candida albicans detection probe: 5'-CTAAGCCATTGTCAAAGC-3', as shown in SEQ ID No. 16;

[0025] Candida auris detection probe: 5′-CACATTGCGCCTTGGGGTATTCCC-3′, as shown in SEQ ID No.17.

[0026] Furthermore, the 5' end of the Aspergillus nidulans detection probe sequence is labeled with a FAM fluorescent group, and the 3' end is labeled with a fluorescent quenching group MGB;

[0027] The 5' end of the Candida albicans detection probe sequence is labeled with a VIC fluorescent group, and the 3' end is labeled with a fluorescent quenching group MGB;

[0028] The 5' end of the Candida auris detection probe sequence is labeled with a ROX fluorescent group, and the 3' end is labeled with a fluorescent quenching group BHQ2.

[0029] Furthermore, the bases "A+", "C+" and "G+" in the primer sequence are locked nucleic acid modified bases.

[0030] Furthermore, in the reagent I, the final concentration of primers for Aspergillus terreus, Aspergillus niger, Aspergillus flavus, and Aspergillus fumigatus was 444 nM, and the final concentration of each index probe was 111 nM. In the reagent II, the final concentration of primers for Aspergillus nidulans, Candida albicans, and Candida auris was 444 nM, and the final concentration of each index probe was 222 nM.

[0031] The present invention also provides a method for using a RT-PCR detection kit for multiple Aspergillus and Candida, comprising the following steps:

[0032] Step 1: Extract sample nucleic acid

[0033] Step 2: Mix Reagent I and Reagent II and dispense them directly into test tubes. Then add the extracted sample template, negative control, and positive quality control products into different PCR reaction tubes and set the reaction conditions.

[0034] Step 3: After the reaction in step 1 is completed, set the automatic baseline adjustment and analyze the test results according to the amplification curve and Ct value.

[0035] Furthermore, the reaction conditions are: 95° C., 2 min in the pre-denaturation stage; 95° C., 5 s, 56° C., 30 s in the amplification stage, and 40 cycles.

[0036] Compared with the prior art, the kit of the present invention has the following advantages:

[0037] (1) The present invention can achieve simultaneous typing detection and identification of 5 types of Aspergillus and 2 types of Candida through the specific design of detection primers and probes, can accurately determine the specific pathogens, guide further antibiotic treatment, and improve the scientificity and effectiveness of the treatment plan. At the same time, the kit provided by the present invention helps to statistically analyze the types of infected pathogens and the prevalence of infected pathogens through the identification of specific pathogens, understand the detection rate and prevalence trend of infected pathogens, and then take scientific preventive measures. And compared with other detection kits currently on the market, the detection limit of the kit provided in the present invention for Aspergillus and Candida can reach as low as 250 copies / mL, which greatly improves the sensitivity of detection.

[0038] (2) The reagents in the kit provided in the present invention are in the form of a fully premixed solution, that is, the primer probe, buffer and Taq enzyme are premixed in one tube, and only need to be thawed, mixed and dispensed for use, eliminating the step of preparing the reaction system and greatly improving work efficiency. In addition, the present invention optimizes the amplification procedure and the fluorescence acquisition time, greatly shortening the detection reaction time, and can achieve the detection time shortened to within 1 hour.

[0039] (3) The kit provided in the present invention uses locked nucleic acid to modify the bases at specific sites on the primers, thereby improving the amplification efficiency of the primers and further improving the detection sensitivity while ensuring specificity. Compared with the primer sequence not modified with locked nucleic acid, the detection sensitivity of the present invention is improved by about 5 times. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 This is a graph showing the detection results of reagent I in a RT-PCR detection kit for multiple Aspergillus and Candida species according to an embodiment of the present invention;

[0041] Figure 2 This is a graph showing the detection results of reagent II in a RT-PCR detection kit for multiple Aspergillus and Candida species according to an embodiment of the present invention;

[0042] Figure 3 This is a result diagram of using the primers and probes of the present invention in Experimental Example 1 of the present invention to detect the detection limit reference substances of the detection index target sequences of Aspergillus niger, Aspergillus terreus, Aspergillus flavus and Aspergillus fumigatus;

[0043] Figure 4 This is a result diagram of using the primers and probes of the present invention to detect the detection limit reference substances of the detection index target sequences of Aspergillus nidulans, Candida albicans and Candida auris in Experimental Example 1 of the present invention;

[0044] Figure 5This is a comparison diagram of the results of the locked nucleic acid modified primer system and the conventional primer system for the detection of Aspergillus terreus samples in Experimental Example 2 of the present invention;

[0045] Figure 6 This is a comparison diagram of the results of the locked nucleic acid modified primer system and the conventional primer system for the detection of Aspergillus niger samples in Experimental Example 2 of the present invention;

[0046] Figure 7 This is a comparison diagram of the results of the locked nucleic acid modified primer system and the conventional primer system for the detection of Aspergillus fumigatus samples in Experimental Example 2 of the present invention;

[0047] Figure 8 This is a comparison result diagram of the detection of Aspergillus flavus samples using the locked nucleic acid modified primer system and the conventional primer system in Experimental Example 2 of the present invention;

[0048] Fig. 9 This is a comparison diagram of the results of the locked nucleic acid modified primer system and the conventional primer system for the detection of Aspergillus nidulans samples in Experimental Example 2 of the present invention;

[0049] Fig.10 This is a comparison result diagram of the locked nucleic acid modified primer system and the conventional primer system for the detection of Candida albicans samples in Experimental Example 2 of the present invention;

[0050] Fig.11 This is a comparison result diagram of the locked nucleic acid modified primer system and the conventional primer system for the detection of Candida auris samples in Experimental Example 2 of the present invention;

[0051] Fig.12 This is a diagram showing the cross-reaction results between the primer-probe detection system and common respiratory pathogens in Experimental Example 5 of the present invention. DETAILED DESCRIPTION

[0052] In order to make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all of the embodiments.

[0053] Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative work shall fall within the scope of protection of the present invention.

[0054] Example

[0055] This embodiment provides an RT-PCR detection kit for a variety of Aspergillus and Candida, wherein the detection kit is prepared using a 20 μL amplification reaction system as an example. The preparation scheme of reagent I is shown in Table 1 below, and the preparation scheme of reagent II is shown in Table 2 below:

[0056] Table 1: Reagent I preparation table

[0057]

[0058] Table 2: Reagent II preparation table

[0059]

[0060]

[0061] The RT-PCR premix is ​​a mixed solution of buffer solution and taq enzyme, purchased from Novozymes, product name: PureAmp U+Super Multiple Probe qPCR PreMix (Low DNA), catalog number: UQN221-C1. The corresponding sequences of the primer probe names in Tables 1 and 2 are shown in Table 3 below, where the bases "A+", "C+" and "G+" in the sequence are bases modified with locked nucleic acid:

[0062] Table 3: Primer probe sequence table of the present invention

[0063]

[0064]

[0065] This embodiment also provides a method for using the above detection kit, comprising the following steps:

[0066] Step 1: Extract sample nucleic acid,

[0067] Specifically, nucleic acids of positive samples of Aspergillus terreus, Aspergillus niger, Aspergillus fumigatus, Aspergillus flavus, Aspergillus nidulans, Candida albicans and Candida auris were extracted for verification of the detection system, and each positive sample index was confirmed by sequencing. The target sequence nucleic acid samples of each index were artificially synthesized and accurately quantified nucleic acid samples.

[0068] Step 2: Mix Reagent I and Reagent II and dispense them directly into test tubes. Then add the extracted sample template, negative control, and positive control to different PCR reaction tubes and set the reaction conditions.

[0069] Specifically, the prepared reagents I and II are vortexed to mix, centrifuged instantaneously, and dispensed into 8-tube strips or 96-well PCR reaction plates; the dispensed reagents are brought to the sample loading room, and the sample nucleic acid prepared in advance is added to the reaction wells, 2 μL per well, and the tubes are covered with caps or sealing films, and after instant centrifugation, the reagents are brought to the amplification room for on-machine testing.

[0070] Step 3: After the reaction in step 2 is completed, set the automatic baseline adjustment and analyze the test results according to the amplification curve and Ct value.

[0071] Specifically, the reaction conditions were set as 95°C for 2 min in the pre-denaturation phase, 95°C for 5 s, 56°C for 30 s in the amplification phase, and 40 cycles. After the settings were completed, the detection program was run. The criteria for interpreting the amplification curve and Ct value results were as follows:

[0072] Positive: "S"-shaped amplification curve appears, Ct value ≤ 35; Suspicious: "S"-shaped amplification curve appears, but Ct value > 35;

[0073] Negative: No Ct value; or the curve exceeds the threshold, but does not show an "S" shape. For suspicious results, the experiment should be repeated. If an "S"-shaped amplification curve appears in the repeated experiment, and the negative control is not contaminated, it can be judged as positive.

[0074] The experimental results are as attached Figure 1 and attached Figure 2 As shown, from the results, it can be seen that the detection kit of the present invention can be used to simultaneously detect nucleic acids of Aspergillus terreus, Aspergillus niger, Aspergillus fumigatus, Aspergillus flavus, Aspergillus nidulans, Candida albicans and Candida auris samples, all of which can be accurately detected with good linearity.

[0075] Experimental Example 1: Detection Limit Experiment

[0076] Experimental method: According to the detection kit and detection method provided in the embodiments of the present invention, the positive samples of Aspergillus terreus, Aspergillus niger, Aspergillus fumigatus, Aspergillus flavus, Aspergillus nidulans, Candida albicans and Candida auris that need to be detected are gradiently diluted after sequencing confirmation, and solutions with concentrations of 5000 copies / mL, 1000 copies / mL, 500 copies / mL, 250 copies / mL, and 100 copies / mL are selected for machine detection to verify the minimum detection limit and linearity of the kit.

[0077] The experimental results are as attached Figure 3 and 4 As shown, the detection limit reference of each index detected by the primers and probes of the present invention shows good linearity of the detection system, and the minimum detection limit of each index of the present invention can reach 250 copies / mL, while the minimum detection limit of similar multiple detection kits on the market or similar multiple detection methods reported in the literature is claimed to be 500 copies / mL. The detection using the primers and probes of the present invention has better sensitivity.

[0078] Experimental Example 2: Effect of Locked Nucleic Acid on Detection Sensitivity

[0079] Experimental method: According to the detection kit and detection method provided in the embodiment of the present invention, conventional primers that have not been modified with locked nucleic acid are set as control group 1, and Aspergillus terreus, Aspergillus niger, Aspergillus fumigatus, Aspergillus flavus, Aspergillus nidulans, Candida albicans and Candida auris are detected respectively. The sample is consistent with the detection kit in the embodiment. This experimental example detects the positive sample nucleic acid of each index with a sample concentration of 500 copies / mL to verify whether the locked nucleic acid modification can effectively improve the detection sensitivity of the detection kit of the present invention.

[0080] The experimental results are shown in Table 4 and Appendix Figure 5-11 As shown in Table 4, the present invention adopts the locked nucleic acid modified primer system to advance the Ct value of each index channel detection by 1-3 compared with the primer system of the control group 1, reflecting that the detection sensitivity of the present invention is improved by about 5 times compared with the control group 1. Figure 5-11 It can be seen that the test signal value of the kit of the present invention is also significantly improved compared with the conventional primer testing method. The signal value of the modified primer system of the present invention is distributed between 1200-2400, and the signal value of the conventional primer system is between 600-1800.

[0081] Table 4: Comparison of the test results of the primer system of the present invention and the primer system without locked nucleic acid modification

[0082]

[0083] Experimental Example 3: Probe Specificity Experiment

[0084] Experimental method: According to the detection kit and detection method provided in the embodiment of the present invention, the probe sequence used was replaced as the control group 2, and Aspergillus terreus, Aspergillus niger, Aspergillus fumigatus, Aspergillus flavus, Aspergillus nidulans, Candida albicans and Candida auris were detected respectively to verify that the probe sequence used in the present invention has specificity. The specific probe sequence information of the control group 2 is shown in Table 5 below:

[0085] Table 5: Probe sequence list used in control group 2

[0086]

[0087]

[0088] The embodiment and control group 2 were compared in the experiment. The reaction system was prepared as in the reference embodiment, and the template loading amount was 2 μL. The loading template was the target sequence solution of each index, with a concentration of 1000 copies / μl. The ABI 7500 fluorescent PCR instrument was used for on-machine detection, and the detection Ct value and signal value difference between the embodiment and control group 2 were compared. The experimental results are shown in Table 6 below:

[0089] Table 6: Test results of Example and Control Group 2

[0090] Detection indicators Example Signal Value Control group 2 signal value Signal value difference Aspergillus terreus 2808 2110 698 Aspergillus niger 1808 1360 448 Aspergillus flavus 1260 1090 170 Aspergillus fumigatus 2930 2500 430 Aspergillus nidulans 2703 2370 333 Candida albicans 1710 1500 210 Candida auris 2700 2340 360

[0091] Analysis of experimental results: It can be seen from Table 6 that the probe sequence selected in the present invention is superior to the control group 2 in terms of signal value. The high signal value can indirectly improve the sensitivity. At the same time, the high signal value amplification curve is more standard, which makes it easier to interpret the results when detecting low-concentration samples. In addition, it has better specificity.

[0092] Experimental Example 4: Specificity Experiment

[0093] Experimental method: According to the detection kit and detection method provided in the embodiment of the present invention, 12 common respiratory bacteria and 12 common virus cultures were selected as samples to test whether the detection kit provided by the present invention is specific to Aspergillus terreus, Aspergillus niger, Aspergillus fumigatus, Aspergillus flavus, Aspergillus nidulans, Candida albicans and Candida auris. Among them, the 12 common respiratory bacteria are: Stenotrophomonas maltophilia, Streptococcus pyogenes, Staphylococcus aureus, Klebsiella pneumoniae, Haemophilus influenzae, Legionella pneumophila, Mycobacterium tuberculosis, Acinetobacter baumannii, Moraxella catarrhalis, Escherichia coli, Streptococcus pneumoniae, Pseudomonas aeruginosa. The 12 common viruses are: new influenza A (H1N1) virus, influenza A (H3N2) virus, influenza B virus V system, influenza B virus Y system, new coronavirus, human metapneumovirus, adenovirus type 14, enterovirus type 71, respiratory syncytial virus, rhinovirus, parainfluenza virus type 3, coronavirus OC43.

[0094] The experimental results are as attached Fig.12 As shown. Fig.12 It can be seen that the detection kit provided by the present invention has no cross reaction with common respiratory pathogens and has good specificity.

Claims

1. A RT-PCR detection kit for multiple Aspergillus and Candida species, characterized in that: The detection kit comprises reagent I and reagent II, both of which comprise a buffer solution, a taq enzyme, and primers and probes for detection; the reagent I is used for detecting Aspergillus terreus, Aspergillus niger, Aspergillus fumigatus and Aspergillus flavus, and the reagent II is used for detecting Aspergillus nidulans, Candida albicans and Candida auris.

2. The RT-PCR detection kit for multiple Aspergillus and Candida according to claim 1, characterized in that: The primers in the reagent I include forward amplification primers for Aspergillus terreus, Aspergillus niger, Aspergillus fumigatus and Aspergillus flavus: 5'-GTCCGRTCCTCGAGCGTA+TG-3', as shown in SEQ ID No.1; reverse amplification primers: 5'-ATCCCTACCTGATCCGAG+GTCA-3', as shown in SEQ ID No.2; The reagent I probe includes Aspergillus terreus detection probes: 5'-CTTCGTCTTCCGCTCCG -3', 5'-CTTTGTCTTCCGCTCTG-3', as shown in SEQ ID No.10 and SEQ ID No.11; Aspergillus niger detection probe: 5'-ACATGCTCTGTAGGATTG-3', as shown in SEQ ID No. 12; Aflatoxin detection probe: 5'-CGCTTGCCGAACGCAAATCAATC-3', as shown in SEQ ID No. 13; Aspergillus fumigatus detection probe: 5′-CCAGCCGACACCCAACTATTTTTCTAAGGT-3′, as shown in SEQ ID No.

14.

3. The RT-PCR detection kit for multiple Aspergillus and Candida according to claim 2, characterized in that: The 5' end of the Aspergillus terreus detection probe sequence is labeled with a FAM fluorescent group, and the 3' end is labeled with a fluorescent quenching group MGB; The 5' end of the Aspergillus niger detection probe sequence is labeled with a VIC fluorescent group, and the 3' end is labeled with a fluorescent quenching group MGB; The 5' end of the Aspergillus flavus detection probe sequence is labeled with a CY5 fluorescent group, and the 3' end is labeled with a fluorescent quenching group BHQ2; The 5' end of the Aspergillus fumigatus detection probe sequence is labeled with a ROX fluorescent group, and the 3' end is labeled with a fluorescent quenching group BHQ2.

4. The RT-PCR detection kit for multiple Aspergillus and Candida according to claim 3, characterized in that: The primers in the reagent II include a forward amplification primer of Aspergillus nidulans: 5'- GGCTTGTGTGTTGGGTC+GT-3', as shown in SEQ ID No.3; a reverse amplification primer: 5'- GCCCTAATGAGCGGGTGA+C-3', as shown in SEQ ID No.4; Forward amplification primer of Candida albicans: 5'- GCTTGAAAGACGGTAGTGGTAA+GG -3', as shown in SEQ ID No.5; reverse amplification primer: 5'- CCGCCGCAAGCAATG+TTT -3', as shown in SEQ ID No.6; Forward amplification primers for Candida auris: 5'-CGATACGTAGTATGACTTGCAGA+CG-3', 5'- GATACGTCGTACGACTTGCAGA+C-3', as shown in SEQ ID No.7 and SEQ ID No.8; reverse amplification primer: 5'- ACCGCGAAGATTGGTGAGAAGAC+AT -3', as shown in SEQ ID No.9; The reagent II probe includes an Aspergillus nidulans detection probe: 5'-ACCGGACACGGTGCC -3', as shown in SEQ ID No. 15; Candida albicans detection probe: 5'- CTAAGCCATTGTCAAAGC -3', as shown in SEQ ID No. 16; Candida auris detection probe: 5′- CACATTGCGCCTTGGGGTATTCCC -3′, as shown in SEQ ID No.

17.

5. The RT-PCR detection kit for multiple Aspergillus and Candida according to claim 4, characterized in that: The 5' end of the Aspergillus nidulans detection probe sequence is labeled with a FAM fluorescent group, and the 3' end is labeled with a fluorescent quenching group MGB; The 5' end of the Candida albicans detection probe sequence is labeled with a VIC fluorescent group, and the 3' end is labeled with a fluorescent quenching group MGB; The 5' end of the Candida auris detection probe sequence is labeled with a ROX fluorescent group, and the 3' end is labeled with a fluorescent quenching group BHQ2.

6. The RT-PCR detection kit for multiple Aspergillus and Candida according to claim 5, characterized in that: The bases "A+", "C+" and "G+" in the primer sequence are locked nucleic acid modified bases.

7. The RT-PCR detection kit for multiple Aspergillus and Candida according to claim 5, characterized in that: In the reagent I, the final concentration of primers for Aspergillus terreus, Aspergillus niger, Aspergillus flavus, and Aspergillus fumigatus is 444 nM, and the final concentration of each indicator probe is 111 nM; in the reagent II, the final concentration of primers for Aspergillus nidulans, Candida albicans, and Candida auris is 444 nM, and the final concentration of each indicator probe is 222 nM.

8. A method for using a RT-PCR detection kit for multiple Aspergillus and Candida according to any one of claims 1 to 7, characterized in that: The steps include: Step 1: Extract sample nucleic acid; Step 2: Mix Reagent I and Reagent II and dispense them directly into test tubes. Then add the extracted sample template, negative control, and positive control into different PCR reaction tubes and set the reaction conditions. Step 3: After the reaction in step 2 is completed, set the automatic baseline adjustment and analyze the test results according to the amplification curve and Ct value.

9. The method for using the RT-PCR detection kit for multiple Aspergillus and Candida according to claim 8, characterized in that: The reaction conditions in step 2 are as follows: 95° C. for 2 min in the pre-denaturation stage; 95° C. for 5 s and 56° C. for 30 s in the amplification stage, and 40 cycles.

Images