Nano platform based on attenuated bacterial outer membrane vesicles and capable of achieving co-delivery of siRNA and adriamycin and preparation method of nano platform

Abstract

The invention belongs to the technical field of drug co-delivery, and particularly relates to a nano-platform based on attenuated bacterial outer membrane vesicles and capable of achieving co-delivery of siRNA and adriamycin and a preparation method of the nano-platform. The preparation method comprises the following steps: synthesizing an ROS response type cationic polymer PTP; the preparation method comprises the following steps: preparing aptamer-DOX; preparing an ROS (reactive oxygen species) response type positive electric nano core PTP / 47aD; extracting and purifying the [delta] msbB OMVs; synthesizing a target functional unit DSPE-PEG2k-Angiopep-2 (Distearoyl Phosphate Polyethylene Glycol 2k-Angiopep-2); finally, the ROS response type co-delivery nano platform AO (at) PTP / 47aD is prepared and obtained. The co-delivery nano-platform prepared by the invention is relatively small in particle size, uniform in morphology and relatively high in biological safety, and has no obvious damage to various tissues and visceral organs. The glioblastoma immunopotentiator can be used as a general platform for gene delivery, can also be used as an immune activator, is suitable for intravenous injection administration, and can comprehensively overcome immune resistance of glioblastoma.

Description

Technical Field

[0001] The present invention belongs to the technical field of drug co-delivery, and in particular relates to a nano-platform based on attenuated bacterial outer membrane vesicles and capable of realizing co-delivery of siRNA and doxorubicin, and a preparation method thereof. Background Art

[0002] Immunotherapy is considered one of the most promising tumor treatments. However, current immunotherapy for glioblastoma (GBM) has not shown significant survival benefits for patients. In addition to the blocking effect of the blood-brain barrier (BBB), GBM is also classified as a highly "cold" tumor, characterized by "high intrinsic immune resistance" and "high adaptive immune resistance". These two forms of immune resistance are intricately intertwined and together reduce the effectiveness of external immune intervention. In simple terms, the intrinsic immune resistance of GBM is mainly manifested in its extremely low immunogenicity, characterized by less tumor mutation burden (TMB) and reduced major histocompatibility complex (MHC) expression levels. In contrast, adaptive immune resistance refers to the immune evasion and suppression mechanisms of GBM, including the overexpression of multiple checkpoint ligands and the infiltration of immunosuppressive cells within the tumor microenvironment (TME). The elucidation of the mechanism of GBM immune resistance shows that synergistically overcoming intrinsic and adaptive immune resistance in GBM is essential to enhance the efficacy of immunotherapy, which requires the co-delivery of multiple immunotherapeutic agents and the simultaneous regulation of different cells.

[0003] It has been reported that doxorubicin (DOX) can significantly increase the immunogenicity of tumors to overcome intrinsic immune resistance by inducing immunogenic cell death (ICD), and is widely used in the treatment of GBM. Given the key role of glioma-associated microglia and macrophages (GAMs) in adaptive immune resistance, regulating their functions can be used in immunotherapy strategies. Among these methods, small interfering RNA (siRNA) technology solves the limitations of current small molecule inhibitors targeting checkpoints and has significant advantages over large molecule antibodies in terms of precision, efficacy, safety and ease of preparation. However, the short half-life of siRNA and its susceptibility to enzymatic degradation greatly limit their application. The most common strategy for protecting and delivering siRNA is to use positively charged materials to bind to negatively charged siRNA through electrostatic interactions. Among the many cationic polymers, branched polyethyleneimine (PEI) with a molecular weight of 25kda is the most popular. 25k ) is known as the "gold standard" for gene delivery due to its extremely high transfection efficiency. However, due to its high molecular weight and strong positive charge, PEI 25kIt is not easily metabolized in the body, so it accumulates and causes physiological toxicity. Although PEI with a lower molecular weight has good biocompatibility, it is difficult to protect and compress siRNA due to insufficient surface positive charge density. Therefore, there is an urgent need for a strategy that can both efficiently deliver siRNA and achieve good biosafety. In addition, the differences in the physicochemical properties of DOX and siRNA (including molecular weight, lipid solubility, and stability) also pose considerable challenges to the selection of carriers and the design of a reasonable co-delivery system.

[0004] Outer membrane vesicles (OMVs) are nanoscale bilayer lipid vesicles spontaneously produced by Gram-negative bacteria. Similar to cellular exosomes, OMVs can serve as natural carriers to effectively load various drugs, including small-molecule hydrophobic chemotherapeutic drugs and large-molecule gene drugs, while ensuring their stability and long circulation in vivo. In addition, OMVs inherit many immunogenic components from the outer membrane and periplasm of parent bacteria, which makes them potential vaccines or immune adjuvants to stimulate the immune system and exert anti-tumor effects. It is worth noting that there is no research on the potential of OMVs to enhance the immune response against GBM. More importantly, OMVs can cross the BBB through various mechanisms (such as through the interaction between outer membrane proteins and gp96 and hitchhiking on neutrophils), which has unique natural advantages in the treatment of GBM. It should be pointed out that although OMVs are less toxic than direct use of bacteria, it is still necessary to pay attention to the large amount of toxic substances they carry, which may trigger cytokine storms. In addition, although OMVs can increase the permeability of BBB to a certain extent under the action of lipopolysaccharide (LPS), this is based on the destruction of tight junctions within the BBB. Summary of the invention In order to solve the above technical problems, the present invention provides a nano-platform based on attenuated bacterial outer membrane vesicles and capable of achieving co-delivery of siRNA and doxorubicin, and a preparation method thereof.

[0005] In order to achieve the above-mentioned invention object, the present invention provides the following technical solutions: A method for preparing a nano-platform based on attenuated bacterial outer membrane vesicles and capable of achieving co-delivery of siRNA and doxorubicin comprises the following steps: (1) Preparation of cross-linked products S1. The reactive oxygen species (ROS) responsive linker 3-(propane-2,2-diylbis(sulfanediyl))dipropionic acid (TK-COOH) and an amidation reagent were dissolved in an organic solvent, and the carboxyl group was activated at room temperature for 2 h under the protection of an inert gas to obtain an activated ROS responsive linker; S2. The activated ROS-responsive linker is connected to a branched polyethyleneimine (PEI) having a molecular weight of 1800. 1.8k ) were dissolved in organic solvents respectively, and PEI was added under the protection of inert gas.1.8k The solution is slowly dripped into the activated ROS-responsive linker solution. After reacting at room temperature for 22 to 24 hours, the reaction solution is transferred to a dialysis bag and then dialyzed in deionized water until the organic solvent and impurities are completely removed. The liquid in the dialysis bag is filtered through a membrane and then freeze-dried to obtain a cross-linked product. The reaction process is shown in Formula I: ; (2) The cross-linked product and polyethylene glycol (PEG) with a molecular weight of 3500 and a succinimidyl ester at the end were 3.5k -NHS) is dissolved in PBS solution, and the reaction is carried out at room temperature for 6 to 24 hours under the protection of inert gas. The reaction solution is then transferred to a dialysis bag and dialyzed in deionized water until the impurities are completely removed. The liquid in the dialysis bag is filtered through a membrane and freeze-dried to obtain a cationic polymer. The reaction process is shown in Formula II: ; (3) The adenosine triphosphate (ATP)-responsive aptamer and DOX were dissolved in ultrapure water treated with diethyl pyrocarbonate (DEPC) and sterilized by high temperature and high pressure, mixed and blown evenly in an enzyme-free environment, and then allowed to stand at room temperature for 1 to 2 hours for co-incubation to prepare an aptamer-doxorubicin complex (aptamer-DOX). The reaction process is shown in Formula III: ; (4) The aptamer-DOX, siRNA and the cationic polymer described in step (1) are dissolved in DEPC water. After the siRNA and aptamer-DOX are mixed with the cationic polymer respectively in an enzyme-free environment, the two systems are quickly combined and vortexed for 10 to 60 seconds, and then left to stand in an ice water bath for 20 to 40 minutes to obtain a positively charged nanocore. The reaction process is shown in Formula IV: ; (5) Add LB medium to the Erlenmeyer flask and inoculate the knockout oeLh The gene of Escherichia coli BL21 (Δ msbBE.coli BL21), after shaking the bacteria on an air shaker for a period of time, the bacteria were removed by centrifugation and filtration. The filtrate was concentrated by ultrafiltration and then ultracentrifuged to obtain Δ oeLh OMVs were treated with phosphate-buffered saline (PBS) oeLh After repeated washing, the OMVs oeLh OMVs were resuspended in deionized water, and the reaction process was shown in Formula V: ; (6) The positively charged nano-core of step (4) and the Δ oeLhAfter the OMVs are mixed, they are ultrasonicated in an ultrasonicator to prepare coated nanoparticles. The reaction process is shown in Formula VI: ; (7) The amphiphilic block with maleimide and PEG molecular weight of 2000 (DSPE-PEG 2k -Mal) and the targeting functional peptide Angiopep-2 were dissolved in an organic solvent, reacted at room temperature for 20 to 24 hours under the protection of inert gas, and then the reaction solution was transferred to a dialysis bag, and then dialyzed in deionized water until the organic solvent and impurities were completely removed. The liquid in the dialysis bag was freeze-dried to obtain the targeting functional unit DSPE-PEG 2k -Angiopep-2, the reaction process is shown in Formula VII: ; (8) The targeting functional unit DSPE-PEG described in step (7) 2k -Angiopep-2 is dissolved in an organic solvent, and then mixed with the coated nanoparticles described in step (6), and incubated for 0.5 to 1 h to prepare a co-delivery nanoplatform. The reaction process is shown in Formula VIII: .

[0006] Preferably, the amidation reagent in step (1) S1 is a mixture of 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC·HCl) and N-hydroxysuccinimide (NHS); the molar ratio of TK-COOH, EDC·HCl and NHS is 2:5:5.

[0007] Preferably, the organic solvent in step (1) S1 is anhydrous N'N-dimethylformamide (DMF).

[0008] Preferably, the organic solvent in step (1) S2 is anhydrous DMF.

[0009] Preferably, in step (1) S2, PEI 1.8k The molar ratio with TK-COOH is 5:2.

[0010] Preferably, in step (1) S2, PEI 1.8k The dripping rate of the activated ROS-responsive linker was 1 mL / min.

[0011] Preferably, in step (1) S2, the dialysis bag is made of regenerated cellulose and has a molecular weight cutoff of 8000; the total dialysis time is 48 h and the dialysis fluid is replaced every 8 h.

[0012] Preferably, the pore size of the filter membrane selected for filtration in step (1) S2 is 450 nm.

[0013] Preferably, in step (2), the cross-linked product and PEG 3.5k The molar ratio between NHS and NH is 1:1.

[0014] Preferably, the concentration of the PBS solution in step (2) is 2 mol / L, the pH is 7.4, and the PEG 3.5k The concentration of -NHS in PBS solution was 2.4 mg / mL.

[0015] Preferably, in step (2), the dialysis bag is made of regenerated cellulose and has a molecular weight cutoff of 8000; further preferably, the total dialysis time is 24 h and the dialysis fluid is replaced every 8 h.

[0016] Preferably, the pore size of the filter membrane selected for filtration in step (2) is 220 nm.

[0017] Preferably, the sequences of the two DNA single strands constituting the ATP-responsive aptamer in step (3) are ACCTGGGGGAGTATTGCGGAGGAAGGT and ACCTTCCTCCGCAATACTCCCCCAGGT, respectively.

[0018] Preferably, in step (3), DOX is in a desalted form; and the molar ratio between the aptamer and DOX is 1:16.

[0019] Preferably, in step (4), the mass ratios of siRNA and aptamer-DOX to the cationic polymer are 1:2 and 1:1.88 respectively; and the molar ratio of siRNA to aptamer-DOX is 1:1.82.

[0020] Preferably, in step (5), the ratio between the volume of the LB culture medium and the volume of the conical flask is 1:5.

[0021] Preferably, in step (5), Δ msbBE.coli The inoculation ratio of BL21 was 1%.

[0022] Preferably, the shaking conditions in step (5) are 220 rpm and 37 °C, and the shaking time is 18 h.

[0023] Preferably, the centrifugation conditions in step (5) are 4000 g, 25 °C, 10 min, and a total of 2 centrifugations; the pore size of the filter membrane selected for removing bacteria is 450 nm.

[0024] Preferably, the ultrafiltration conditions in step (5) are 3500 rpm and 4 °C.

[0025] Preferably, the ultracentrifugation conditions in step (5) are 150,000 g, 4 °C, and 2 h.

[0026] Preferably, the concentration of the PBS solution in step (5) is 0.1 mol / L and the pH is 7.4; oeLh OMVs were washed at least 3 times.

[0027] Preferably, in step (6), the positively charged nano core and Δ oeLh The mass ratio between OMVs was 1:2; the ultrasound program was set as follows: power 324 W, working 99 s, stopping 10 s, total duration 2 min, and temperature maintained at 4 °C.

[0028] Preferably, in step (7), DSPE-PEG 2k The molar ratio between -Mal and Angiopep-2 was 1:3.

[0029] Preferably, the organic solvent in step (7) is anhydrous dimethyl sulfoxide (DMSO).

[0030] Preferably, in step (7), the dialysis bag is made of regenerated cellulose and has a molecular weight cutoff of 3500; further preferably, the total dialysis time is 48 h and the dialysis fluid is replaced every 12 h.

[0031] Preferably, the organic solvent in step (8) is DMSO.

[0032] Preferably, in step (8), the concentration of Angiopep-2 in DMSO is 2 mg / mL; the coated nanoparticles contain Δ oeLh The mass ratio between OMVs and Angiopep-2 contained in the targeting functional unit was 20:1; the co-incubation temperature was 37 °C.

[0033] The room temperature mentioned in the present invention refers to 25°C; the inert gas refers to argon; and the enzyme-free environment refers to the surrounding environment and the EP tube and gun tip used do not contain RNase and DNase.

[0034] The present invention also provides a nano-platform based on attenuated bacterial outer membrane vesicles prepared by the above method and capable of achieving co-delivery of siRNA and doxorubicin, wherein the diameter of the nano-platform is 80-100 nm.

[0035] The nano-platform prepared by the present invention is composed of modular assembly of different components. Firstly, inspired by the interaction between DOX and DNA, ATP-responsive aptamer is used to load DOX and transform it into a "gene drug". Then, PEI is connected to the DNA through a ROS-responsive connector. 1.8k Cross-linked and modified with polyethylene glycol to obtain a cationic polymer with good water solubility; the cationic polymer is then used to simultaneously compress siRNA and aptamer-DOX through electrostatic interaction to obtain a nanocore; further, Δ msbBE.coli BL21, and extracted and purified from the attenuated E. coli to obtain Δ oeLh OMVs were transduced into oeLh OMVs were wrapped on the surface of the nanocore; finally, the targeting functional peptide Angiopep-2 was inserted into the Δ oeLh OMVs were then placed on the surface of the cells to prepare the final co-delivery nanoplatform.

[0036] The present invention introduces Angiopep-2 into the co-delivery nanoplatform, which can assist the nanoplatform in achieving continuous BBB crossing and GBM targeting; oeLh OMVs can not only shield the positive charge on the surface of the nanocore and improve its stability, but the engineered attenuated design also enhances the biosafety of the nanoplatform and avoids the systemic cytokine storm caused by strong toxicity. In addition, more importantly, Δ oeLh OMVs still retain some immunostimulatory ability, and some of the immunogenic substances they contain can serve as immune adjuvants to promote GAMs transformation; when the nanoplatform is taken up by GBM cells and enters the cell, the positively charged nanocore can quickly escape from the lysosome by triggering the proton sponge effect, and under the action of high intracellular ROS concentrations, the cationic polymer disintegrates and releases the compressed aptamer-DOX and siRNA, among which siRNA binds to the corresponding mRNA to play a gene silencing role, thereby reducing the expression level of the checkpoint, and aptamer-DOX further releases the loaded DOX under the action of ATP to induce ICD; after the disintegration of PEI 1.8k The toxicity to cells is reduced due to the reduced positive charge density, and it can also be easily metabolized and cleared by the body due to its small molecular weight. This co-delivery nanoplatform provides a paradigm and new insights for the immunotherapy of GBM.

[0037] Compared with the prior art, the effective effects of the present invention include: (1) The co-delivery nanoplatform prepared by the present invention has a small particle size and uniform morphology, and it can be clearly seen that Δ oeLh OMVs are characterized by encapsulating a positively charged core.

[0038] (2) The co-delivery nanoplatform prepared by the present invention has high biosafety and does not cause significant damage to any tissue or organ. oeLh The toxic side effects of OMVs are reduced due to the reduction of endotoxins. On the other hand, the cross-linked cationic polymers can quickly disintegrate into small molecular positively charged units under the action of ROS, and then be quickly metabolized and excreted.

[0039] (3) The co-delivery nanoplatform prepared by the present invention can be used as a universal platform for gene delivery and as an immune activator. It is suitable for intravenous administration and can completely overcome the immune resistance of glioblastoma. The co-delivery nanoplatform can continuously achieve BBB crossing and GBM targeting with the help of Angiopep-2. After being taken up by GBM cells, the positively charged nanocore can quickly escape from the lysosome by triggering the proton sponge effect. Under the action of high intracellular ROS concentrations, the cationic polymer disintegrates and releases the compressed aptamer-DOX and siRNA, wherein siRNA binds to the corresponding mRNA to exert a gene silencing effect, thereby reducing the expression level of the checkpoint, and aptamer-DOX further releases the loaded DOX under the action of ATP to induce ICD; in addition, in the process of enrichment in the GBM lesion area, Δ oeLh Certain immunogenic substances on OMVs can also initiate the reprogramming of GAMs, thereby exerting their anti-tumor immune effects. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 ROS-responsive cationic polymer PEG 3.5k -TK-PEI 1.8k (PTP) synthetic route; Figure 2 Schematic diagram of ATP-responsive aptamer loaded with DOX to form aptamer-DOX; Figure 3 Simultaneous compression of si for PTP CD47 and aptamer-DOX to form ROS-responsive positively charged nanocore PEG 3.5k -TK-PEI 1.8k / si CD47 &Schematic diagram of aptamer-DOX (PTP / 47aD); Figure 4 From Δ msbBE.coli Extraction and purification of Δ oeLh Schematic diagram of OMVs; Figure 5 DSPE-PEG is a targeting functional unit 2k -Synthesis route of Angiopep-2; Figure 6 is Δ oeLh OMVs encapsulate the ROS-responsive positively charged nanocore PTP / 47aD and modify the targeting functional peptide Angiopep-2 to construct the ROS-responsive co-delivery nanoplatform Angiopep-2-OMVs@PEG 3.5k -TK-PEI 1.8k / si CD47 &Schematic diagram of aptamer-DOX (AO@PTP / 47aD); Figure 7 PEG is a ROS-insensitive cationic polymer 3.5k -AA-PEI 1.8k (PAP) synthesis route; Figure 8 Angiopep-2-OMVs@PEG is a ROS-insensitive co-delivery nanoplatform 3.5k -AA-PEI 1.8k / si CD47 Schematic diagram of the construction process of aptamer-DOX (AO@PAP / 47aD); Fig. 9 This is an investigation of the changes in DOX fluorescence intensity after the ATP-responsive aptamer was co-incubated with different concentrations of DOX; Fig.10 To investigate the recovery of DOX fluorescence intensity after aptamer-DOX was co-incubated with different concentrations of ATP; Fig.11 The ROS-responsive positively charged nanocore PTP / 47aD and the ROS-insensitive positively charged nanocore PEG 3.5k -AA-PEI 1.8k / si CD47 &Schematic diagram of aptamer-DOX (PAP / 47aD) disintegrating or remaining stable under the action of intracellular ROS; Fig.12 The changes in the dynamic light scattering particle size of ROS-responsive positively charged nanocore PTP / 47aD and ROS-insensitive positively charged nanocore PAP / 47aD after co-incubation with different concentrations of hydrogen peroxide (H2O2) at 37 °C for different periods of time; Fig.13 Dynamic light scattering particle size, polydispersity index (PDI), and potential distribution of the ROS-responsive co-delivery nanoplatform AO@PTP / 47aD; Fig.14 It is a ROS-responsive positively charged nanocore PTP / 47aD, Δ oeLh Transmission electron microscopy morphology of OMVs and ROS-responsive co-delivery nanoplatform AO@PTP / 47aD; Fig.15 AO@PTP / 47aD is a ROS-responsive co-delivery nanoplatform CD47 With Δ oeLh Investigation of co-localization of OMVs; Fig.16 The changes of dynamic light scattering particle size and PDI of the ROS-responsive co-delivery nanoplatform AO@PTP / 47aD when placed in PBS 7.4 and 4 °C for 7 days; Fig.17 To investigate the uptake pathway of the ROS-responsive co-delivery nanoplatform AO@PTP / 47aD by G422 cells; Fig.18 To investigate the intracellular fate of the ROS-responsive co-delivery nanoplatform AO@PTP / 47aD after being taken up by G422 cells; Fig.19 The ROS-responsive co-delivery nanoplatform AO@PTP / 47aD and the ROS-responsive nanoplatform Angiopep-2-OMVs@PEG without DOX 3.5k -TK-PEI 1.8k / si CD47 &aptamer (AO@PTP / 47a) and ROS-insensitive co-delivery nanoplatform AO@PAP / 47aD induced calreticulin (CRT) exposure and high-mobility group box 1 (HMGB1) nuclear translocation in G422 cells; Fig. 20 The ROS-responsive nanoplatform AO@PTP / 47a without DOX and the ROS-insensitive nanoplatform Angiopep-2-OMVs@PEG without DOX 3.5k -AA-PEI 1.8k / si CD47 & Investigation of the knockout efficiency of CD47 in G422 cells by aptamer (AO@PAP / 47a); Fig.21 The ROS-responsive co-delivery nanoplatform AO@PTP / 47aD and Δ oeLh Investigation of OMVs promoting the transformation of BV2 cells and bone marrow-derived macrophages (BMDMs). DETAILED DESCRIPTION

[0041] The present invention will be further described below in conjunction with specific embodiments and reference examples, and the advantages and features of the present invention will become clearer as the description proceeds. However, the embodiments and reference examples are exemplary only and do not constitute any limitation to the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the technical solution of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications and replacements all fall within the scope of protection of the present invention.

[0042] Example 1 A method for preparing a nanoplatform based on attenuated bacterial outer membrane vesicles that can achieve co-delivery of siRNA and doxorubicin: (1) Synthesis of ROS-responsive cationic polymer PTP according to Figure 1 According to the synthetic route, 115 mg EDC·HCl (0.6 mmol), 69 mg NHS (0.6 mmol) and 60.48 mg TK-COOH (0.24 mmol) were dissolved in 2 mL anhydrous DMF, mixed and reacted at room temperature for 2 h under the protection of argon. Then 1 g PEI 1.8k (1 mmol) was dissolved in 10 mL of anhydrous DMF and slowly dripped into the above reaction system at a rate of 1 mL / min. After the reaction was continued at room temperature for 22 h, the reaction solution was transferred to an 8K regenerated cellulose dialysis bag and dialyzed against pure water for 48 h (the dialysis solution was replaced every 8 h). Finally, the liquid in the dialysis bag was filtered through a 450 nm filter membrane and freeze-dried to obtain a transparent colloidal liquid, which was the ROS-responsive crosslinker TK-PEI. 1.8k (TP).

[0043] 12.48 mg TP (1.35 μmol) and 4.72 mg PEG 3.5k -NHS (1.35 μmol) was dissolved in 2 mL 20×PBS (pH 7.4), and the two were mixed and reacted at room temperature for 6 h under the protection of argon. The reaction solution was then transferred to an 8K regenerated cellulose dialysis bag and dialyzed with pure water for 24 h (the dialysis solution was replaced every 8 h). Finally, the liquid in the dialysis bag was filtered through a 220 nm filter membrane and freeze-dried to obtain a white flocculent solid, which is the ROS-responsive cationic polymer PTP.

[0044] (2) Preparation of aptamer-DOX according to Figure 2According to the synthetic route, desalted DOX and ATP-responsive aptamer were dissolved in DEPC water to the concentrations of 320 μmol / L and 200 μmol / L, respectively, in an enzyme-free environment. 400 μL of DOX solution and 40 μL of ATP-responsive aptamer solution were mixed and gently blown evenly, and then allowed to stand at room temperature for 2 h to obtain aptamer-DOX.

[0045] (3) Preparation of ROS-responsive positively charged nanocore PTP / 47aD according to Figure 3 The synthetic route of ROS-responsive cationic polymer PTP, si CD47 (siRNA targeting silencing CD47 protein) and aptamer-DOX were dissolved in DEPC water to prepare concentrations of 5.28 mg / mL, 0.528 mg / mL (i.e. 40 μmol / L), and 0.459 mg / mL (i.e. 18.18 μmol / L), respectively. 40 μL of aptamer-DOX solution and 10 μL of siRNA were taken. CD47 The solution was mixed with 6.54 μL and 2 μL PTP solution respectively, and then the two were quickly combined into the same system. After vortexing for 30 s, the mixture was placed on ice for 30 min to obtain the ROS-responsive positively charged nanocore PTP / 47aD.

[0046] (4) Δ oeLh Extraction and purification of OMVs according to Figure 4 According to the synthetic route, 200 mL of LB medium was added to a 1 L conical flask, and 2 mL of Δ msbBE.coli BL21 bacterial suspension (strain purchased from Baosai Plasmid Strain Company) was shaken on an air shaker at 220 rpm and 37 °C for 18 h, and then the bacteria were removed by centrifugation (4000 g, 25 °C, 10 min, 2 times) and filtration through a 450 nm filter. The filtrate was ultrafiltered and concentrated using a 100 kDa ultrafiltration tube (3500 rpm, 4 °C) to 50 mL, and Δ oeLh OMVs were precipitated and washed three times with 1× PBS (pH 7.4). oeLh The OMVs pellet was resuspended in deionized water.

[0047] (5) Targeting functional unit DSPE-PEG 2k -Synthesis route of Angiopep-2 according to Figure 5The synthetic route was to combine 10 mg Angiopep-2 (4.159 μmol) with 4.02 mg DSPE-PEG 2k -Mal (1.386 μmol) was dissolved in 2 mL of anhydrous DMSO. After reacting at room temperature for 24 h under the protection of argon, the reaction solution was transferred to a regenerated cellulose dialysis bag with a molecular weight cutoff of 3500 and dialyzed with pure water for 48 h (the dialysis solution was replaced every 12 h). Finally, the liquid in the dialysis bag was freeze-dried to obtain a white solid, which is the targeting functional unit DSPE-PEG. 2k -Angiopep-2.

[0048] (6) Preparation of ROS-responsive co-delivery nanoplatform AO@PTP / 47aD according to Figure 6 The synthetic route was to take 63 μL of 1.174 mg / mL ROS-responsive positively charged nanocore PTP / 47aD solution and 125.32 μL of 1.18 mg / mL Δ oeLh The OMVs solution was mixed, gently blown and then placed in an ultrasonic disruptor for ultrasonic treatment (the ultrasonic program was set to 324 watts, working for 99 s, stopping for 10 s, and lasting for a total of 2 min, and the temperature was maintained at 4 °C) to obtain ROS-responsive coated nanoparticles OMVs@PEG 3.5k -TK-PEI 1.8k / si CD47 &aptamer-DOX(O@PTP / 47aD).

[0049] Targeting functional unit DSPE-PEG 2k -Angiopep-2 was dissolved in DMSO and prepared to a concentration of 2 mg / mL. Then 1.68 μL was added to 188.32 μL of freshly prepared ROS-responsive coated nanoparticles O@PTP / 47aD solution. After gently blowing evenly, the system was placed in a 37 °C water bath and incubated for 30 min to obtain the final ROS-responsive co-delivery nanoplatform AO@PTP / 47aD.

[0050] Comparative Example 2 A method for preparing a nanoplatform based on attenuated bacterial outer membrane vesicles that can achieve co-delivery of siRNA and doxorubicin: The desalted doxorubicin solution in Example 1 was replaced with pure DEPC water, and the other steps were the same as in Example 1. The resulting ROS-responsive co-delivery nanoplatform without DOX was denoted as AO@PTP / 47a.

[0051] Comparative Example 3 A method for preparing a nanoplatform based on attenuated bacterial outer membrane vesicles that can achieve co-delivery of siRNA and doxorubicin: (1) Synthesis of ROS-insensitive cationic polymer PAP according to Figure 7 According to the synthetic route, 115 mg EDC·HCl (0.6 mmol), 69 mg NHS (0.6 mmol) and 45.2 mg azelaic acid (AA) (0.24 mmol) were dissolved in 2 mL anhydrous DMF, and the three were mixed and reacted at room temperature for 2 h. Then 1 g PEI 1.8k (1 mmol) was dissolved in 10 mL of anhydrous DMF and slowly dripped into the above reaction system at a rate of 1 mL / min. After continuing the reaction at room temperature for 22 h, the reaction solution was transferred to an 8K regenerated cellulose dialysis bag and dialyzed with pure water for 48 h (the dialysis solution was replaced every 8 h). Finally, the liquid in the dialysis bag was filtered through a 450 nm filter membrane and freeze-dried to obtain a transparent colloidal liquid, which is the ROS-non-responsive crosslinker AA-PEI. 1.8k (AP).

[0052] 18.93 mg TP (2.06 μmol) and 7.21 mg PEG 3.5k -NHS (1.35 μmol) was dissolved in 3 mL 20×PBS (pH 7.4), and the two were mixed and reacted at room temperature for 6 h under the protection of argon. The reaction solution was then transferred to an 8K regenerated cellulose dialysis bag and dialyzed with pure water for 24 h (the dialysis solution was replaced every 8 h). Finally, the liquid in the dialysis bag was filtered through a 220 nm filter membrane and freeze-dried to obtain a white flocculent solid, which was the ROS-non-responsive cationic polymer PAP.

[0053] (2) Preparation of ROS-insensitive co-delivery nanoplatform AO@PAP / 47aD according to Figure 8 The synthetic route is to replace the ROS-responsive cationic polymer PTP in Example 1 with the ROS-non-responsive cationic polymer PAP, and the remaining steps are the same as Example 1. The ROS-non-responsive positively charged nanocore obtained in this process is recorded as PAP / 47aD.

[0054] Comparative Example 4 A method for preparing a nanoplatform based on attenuated bacterial outer membrane vesicles that can achieve co-delivery of siRNA and doxorubicin: The desalted DOX solution in Control Example 3 was replaced with pure DEPC water, and the other steps were the same as Control Example 4. The resulting ROS-non-responsive co-delivery nanoplatform without DOX was recorded as AO@PAP / 47a.

[0055] Test Example 1 Investigation of the DOX loading capacity of the ATP-responsive aptamers obtained in Example 1 and Comparative Examples 2 to 4: 500 μL of 160 μmol / L DOX solution and 500 μL of 10, 5, 2.5, 1.25, and 0.625 μmol / L ATP-responsive aptamer solutions were mixed and gently blown evenly. The mixture was allowed to stand at room temperature for 2 h. The fluorescence emission intensity of DOX was detected by fluorescence spectrophotometry (excitation wavelength was 490 nm, emission wavelength was 590 nm). The results were as follows: Fig. 9 As shown, it can be seen that: with the increase of ATP-responsive aptamer, the fluorescence intensity of DOX gradually decreased. When the molar ratio between aptamer and DOX reached 1:16, the fluorescence intensity of DOX almost completely disappeared. This may be because there are a total of 16 GC base pairs in the aptamer for DOX to insert, and this also indicates that DOX has been completely loaded into the aptamer at this time.

[0056] Test Example 2 Investigation of the ability of aptamer-DOX obtained in Example 1 and Control Example 3 to release DOX in response to ATP: 93 μL of aptamer-DOX solution with a DOX concentration of 1.38 μmol / L was mixed with 12 μL of ATP solutions of different concentrations (the final ATP concentrations were 8, 1, and 0.2 μmol / L, respectively), and then 45 μL of buffer (final concentrations of 5 mmol / L HEPES, 10 mmol / L MgCl2, and 100 mmol / L NaCl) was added. After vortexing for 30 s, the solution was kept at room temperature in the dark for 15 min. A solution with the same DOX concentration but without aptamer or ATP was used as a control. The fluorescence intensity of DOX was detected using an ELISA reader (excitation wavelength of 490 nm, emission wavelength of 590 nm, fluorescence recovery degree (%) = (fluorescence intensity of target solution - fluorescence intensity of DOX solution without ATP) / (fluorescence intensity of DOX solution without aptamer - fluorescence intensity of DOX solution without ATP). The results are shown in Figure 2. Fig.10 As shown, it can be seen that: with the increase of ATP concentration, the fluorescence recovery degree of DOX is greater, indicating that aptamer-DOX has the ability to release DOX in a concentration-dependent manner in response to ATP, which lays the foundation for its intracellular release of DOX.

[0057] Test Example 3 In order to meet the needs of their own growth, metabolism and invasion, GBM cells usually have a high concentration of ROS. Therefore, under the action of high intracellular ROS concentration, the TK bond in the ROS-responsive positively charged nanocore PTP / 47aD in Example 1 will break, resulting in a decrease in the positive charge density of the cationic polymer PTP, which in turn causes the nanoparticles to disintegrate as a whole and release the internally compressed si CD47 and aptamer-DOX; while in the control example 1, the ROS non-responsive positively charged nanocore PAP / 47aD can remain stable in a high concentration ROS environment because the carbon chain in the middle of AA cannot be disconnected, and PAP is still a complete cationic polymer, so it can remain stable in a high concentration ROS environment, and the internally compressed siRNA and aptamer-DOX cannot be released; the specific schematic diagram is shown in Fig.11 shown.

[0058] Test Example 4 Investigation of the disintegration properties of the ROS-responsive positively charged nanocore PTP / 47aD obtained in Example 1 and the ROS-non-responsive positively charged nanocore PAP / 47aD obtained in Control Example 3 after reacting with different concentrations of H2O2 for different periods of time: 100 μL of freshly prepared PTP / 47aD and PAP / 47aD were mixed with 100 μL of 0.2 mmol / L and 100 μL of 2 mmol / L H2O2 solution, respectively, and then incubated on a shaker at 37 °C. After 12 h and 24 h, the dynamic light scattering particle size changes of PTP / 47aD and PAP / 47aD were measured by a dynamic light scattering nanoparticle size analyzer. The results are shown in Figure 2. Fig.12 As shown, it can be seen that: under the condition of simulating low extracellular ROS concentration (0.1 mmol / L H2O2) in GBM cells, the particle size of PTP / 47aD hardly changes; under the condition of simulating high intracellular ROS concentration (1 mmol / L H2O2) in GBM cells, the particle size of PTP / 47aD increases significantly with time; regardless of the simulation conditions, the particle size of PAP / 47aD does not change significantly. This difference suggests that the use of ROS-responsive linkers to construct cationic polymers can ensure the precise intracellular release of siRNA and aptamer-DOX.

[0059] Test Example 5 Determination of dynamic light scattering particle size, PDI and potential distribution of the ROS-responsive co-delivery nanoplatform AO@PTP / 47aD obtained in Example 1: 40 μL and 800 μL of freshly prepared AO@PTP / 47aD solution were taken in the particle size dish and potential dish respectively, and tested in the dynamic light scattering nanoparticle size analyzer. The results are shown in Fig.13As shown, it can be seen that the particle size of AO@PTP / 47aD is about 93.71 nm, the PDI is about 0.186, and the potential is about -21.8 mV.

[0060] Test Example 6 The ROS-responsive positively charged nanocore PTP / 47aD obtained in Example 1, and the Δ oeLh Transmission electron microscopy morphology of OMVs and the ROS-responsive co-delivery nanoplatform AO@PTP / 47aD obtained in Example 1: Take freshly prepared PTP / 47aD, Δ oeLh OMVs and 10 μL of AO@PTP / 47aD solution were dropped on the carbon film surface of the copper mesh and left to stand at room temperature for 1 min. The excess sample was removed from the edge of the copper mesh with filter paper. A drop of 3% uranyl acetate dye solution was taken and dropped on the cover of the culture dish, 10 μL per drop, and the copper mesh was placed in the dye solution and floated for 1 min. The excess dye solution was then removed with filter paper and washed twice with deionized water. After drying at room temperature, it was observed under a transmission electron microscope. The results are as follows: Fig.14 As shown in the figure, it can be seen that PTP / 47aD presents a complete and uniform spherical shape with a particle size between 70 and 80 nm, while Δ oeLh OMVs present a typical bowl-shaped vesicle-like structure with a particle size between 80 and 100 nm, while AO@PTP / 47aD presents a core-shell-like structure with obvious Δ oeLh The OMVs encapsulate the nanocore PTP / 47aD with a particle size between 70 and 100 nm. It is worth mentioning that the transmission electron microscopy sizes of the three are close to their dynamic light scattering particle size results.

[0061] Test Example 7 The ROS-responsive co-delivery nanoplatform AO@PTP / 47aD obtained in Example 1 CD47 Investigation of co-localization with OMVs: 100 μL of freshly prepared AO@PTP / 47aD (si CD47 0.45 μL 1,1'-dioctadecyl-3,3,3',3'-tetramethylindocyanine perchlorate (DiI) (final concentration 1 μmol / L) was added to the 47aD (labeled with FAM), and the mixture was gently blown and allowed to stand at room temperature for 20 min. 20 μL DiI-labeled AO@PTP / 47aD was mixed with 20 μL Matrigel on ice, and then 10 μL was dropped onto the slide, and then covered with a coverslip. After waiting for Matrigel to solidify at room temperature, the co-localization situation can be observed under the spinning disk confocal microscope. The results are shown in Fig.15 As shown, it can be seen that: represents si CD47The green fluorescence signal represents Δ oeLh The red fluorescence signals of OMVs almost completely overlapped, emitting a strong yellow fluorescence signal, indicating that si CD47 With Δ oeLh OMVs were highly colocalized, further indicating that Δ oeLh Successful encapsulation of PTP / 47aD by OMVs.

[0062] Test Example 8 In vitro stability test of the ROS-responsive co-delivery nanoplatform AO@PTP / 47aD obtained in Example 1: 190 μL of freshly prepared AO@PTP / 47aD solution was mixed with 10 μL of 20×PBS (pH 7.4) solution and gently blown to mix. Then, it was placed at 4 °C for 7 days, and 40 μL was taken every day to monitor the dynamic light scattering particle size and polydispersity index of AO@PTP / 47aD. The results are shown in Fig.16 As shown, it can be seen that under the above conditions, the dynamic light scattering particle size of AO@PTP / 47aD is always maintained at about 90 nm, and the polydispersity index is always below 0.2, indicating that the ROS-responsive co-delivery nanoplatform has good stability.

[0063] Test Example 9 Investigation of the uptake pathway of the ROS-responsive co-delivery nanoplatform AO@PTP / 47aD obtained in Example 1 by G422 cells: G422 cells were plated in 12-well plates (6 w / well), and 15 h later, various uptake inhibitors were pre-incubated for 20 min (uptake inhibitors were diluted with Hank's balanced salt solution (HBSS)), with a final concentration of 0.5 μg / mL of filipin (inhibiting caveolin pathway); a final concentration of 5 μg / mL of chlorpromazine (inhibiting clathrin pathway); and a concentration of 1 μg / mL of colchicine (inhibiting macropinocytosis pathway). The 4 °C group was treated with HBSS and the cells were placed at 4 °C for 20 min. After that, each group was washed with HBSS and AO@PTP / 47aD (si CD47 The cells were labeled with Cy5 and diluted in Dulbecco's modified Eagle's medium (DMEM) basal medium), incubated at 37 °C for 30 min, and the 4 °C group was kept at 4 °C for 30 min. The medium was then removed, washed twice with HBSS, and 200 μL of ethylenediaminetetraacetic acid (EDTA)-containing trypsin was added for digestion. The digestion was stopped after 1.5 min, and the cells were blown evenly for flow cytometry analysis. The results are shown in Fig.17As shown, it can be seen that under the action of 4 °C and chlorpromazine, the uptake of AO@PTP / 47aD by G422 cells was significantly reduced, indicating that AO@PTP / 47aD entered the cell through energy-dependent and clathrin-mediated endocytosis, further indicating that it may enter the lysosome in the cell.

[0064] Test Example 10 Investigation of the intracellular fate of the ROS-responsive co-delivery nanoplatform AO@PTP / 47aD obtained in Example 1 after being taken up by G422 cells: G422 cells were plated in four-grid confocal dishes (2 w / grid), and 15 h later was recorded as a new time starting point. AO@PTP / 47aD (si CD47 The cells were labeled with Cy5, and the culture medium was removed 2 h after each administration and new DMEM complete culture medium was added. The culture medium was removed uniformly 0.5 h after the last administration, and 500 μL of prepared HBSS solution containing Hoechst and LysoTracker (Hoechst concentration was 5 μg / mL, LysoTracker concentration was 50nmol / L) was added. After incubation for 15 min, the culture medium was removed, HBSS was added to wash once, and the distribution of AO@PTP / 47aD in the cell was observed using a spinning disk confocal microscope. The results are shown in Fig.18 As shown, it can be seen that: at 0.5 h, the Cy5 red fluorescence signal representing the nanoplatform is basically located on the cell membrane, indicating that most of the AO@PTP / 47aD has not been or is in the state of being taken up by the cell; at 2 h, a large number of red fluorescence signals appear in the cell and do not overlap with the green fluorescence signal representing the lysosome, indicating that AO@PTP / 47aD has been taken up but has not yet entered the lysosome; at 4 h, the red fluorescence signal and the green fluorescence signal are obviously co-localized, proving that the nanoparticles are in the lysosome at this time, which corresponds to the results of the previous uptake pathway; at 6 h, the co-localization and the green fluorescence intensity of the lysosome are significantly weakened, and a large number of red fluorescence signals are diffused in the cytoplasm, indicating that the nanoplatform has escaped from the lysosome and even disintegrated under the action of high concentrations of ROS in the cell to release si CD47 , which may be attributed to the strong proton sponge effect induced by the positively charged nanocore PTP / 47aD.

[0065] Test Example 11 Investigation of the ROS-responsive co-delivery nanoplatform AO@PTP / 47aD obtained in Example 1 and the ROS-inresponsive co-delivery nanoplatform AO@PAP / 47aD obtained in Control Example 3 inducing CRT production and HMGB1 nuclear translocation in G422 cells: G422 was plated on four-grid confocal dishes (1.5 w / well). After 18 h, the supernatant was discarded, the cells were washed once with HBSS, and different preparations (DOX final concentration was 0.6 μM) were given. After 6 h, each group was supplemented with 400 μL DMEM complete medium, and the cells were incubated until the 24th hour. For CRT: Wash cells three times with ice-cold 1× PBS (pH 7.4), fix with 0.25% paraformaldehyde at room temperature for 10 min; wash cells three times with ice-cold 1× PBS (pH 7.4), block with 2% goat serum on ice for 15 min; incubate with CRT primary antibody (diluted in 1× PBS (pH 7.4)) containing 2% goat serum at 4 °C for 1 h; wash twice with ice-cold 1× PBS (pH 7.4); incubate with Hoechst (diluted in 1× PBS (pH 7.4), final concentration 5 μg / mL) for 15 min, wash twice with 1× PBS (pH 7.4), and detect CRT exposure using spinning disk confocal. For HMGB1: Wash cells three times with ice-cold HBSS, fix with 4% paraformaldehyde at room temperature for 20 min. Permeabilize with 0.1% Triton (diluted in HBSS) for 10 min, and wash three times with HBSS. Blocked with 2% goat serum on ice for 1 h; incubated with HMGB1 primary antibody (diluted with HBSS) containing 2% goat serum at 4 °C overnight. Washed twice with HBSS, incubated with corresponding secondary antibody at room temperature for 2 h. Washed twice with HBSS, incubated with Hoechst (diluted with HBSS, 5 μg / mL) for 15 min; after washing twice with HBSS, HMGB1 nuclear translocation was detected using spinning disk confocal microscope. The results are shown in Fig.19 As shown in the figure, it can be seen that compared with the ROS non-responsive co-delivery nanoplatform AO@PAP / 47aD, the ROS responsive co-delivery nanoplatform AO@PTP / 47aD has a stronger CRT exposure and more obvious HMGB1 nuclear translocation, and its effect is comparable to or even slightly better than that of free DOX. This shows that the ROS responsive co-delivery nanoplatform AO@PTP / 47aD designed by us can effectively deliver DOX into cells to play the role of inducing ICD.

[0066] Test Example 12 Investigation of the knockout efficiency of CD47 in G422 cells by the ROS-responsive nanoplatform AO@PTP / 47a without DOX obtained in Control Example 2 and the ROS-non-responsive nanoplatform AO@PAP / 47a without DOX obtained in Control Example 4: G422 cells were plated in 6-well plates (10 w / well), and AO@PTP / 47a and AO@PAP / 47a (diluted with 2 mL DMEM basal medium, si CD47 The concentration was 100 nmol / L), using the commercial transfection reagent siRNA-Mate and si CD47 The formed complex was used as a positive control and was recorded as Mate / si CD47 After 5 h, 1 mL of DMEM complete medium was added and the cells were treated until the 36th h. The cells were digested with trypsin and centrifuged at 2000 rpm and 4 °C for 5 min. The cell pellet obtained by centrifugation was resuspended in 1× PBS (pH 7.4) containing 2% bovine serum albumin (BSA). After blocking at room temperature for 20 min, APC-coupled CD47 primary antibody was added and incubated for 30 min. Finally, the cell suspension was transferred to a 96-well plate and detected on a Beckman flow cytometer. The results are shown in Fig. 20 As shown, it can be seen that: in the same si CD47 At the same concentration, the CD47 silencing efficiency caused by the ROS-responsive nanoplatform AO@PTP / 47a without DOX was much higher than that of the ROS-inresponsive nanoplatform AO@PAP / 47a without DOX, and even better than the commercial transfection reagent siRNA-Mate. This may be due to the fact that si CD47 It is worth mentioning that previous studies have shown that DOX can cause upregulation of CD47 in tumor cells, which may be an immune resistance mechanism activated by tumor cells when facing external killing effects. Therefore, in order to fully investigate the effect of the nanoplatform we constructed on si CD47 In order to achieve efficient delivery of , we did not introduce DOX in this experiment.

[0067] Test Example 13 The ROS-responsive co-delivery nanoplatform AO@PTP / 47aD obtained in Example 1, and the Δ oeLh Investigation of the ability of OMVs to promote transformation of BV2 cells and BMDMs: BV2 cells or BMDMs were plated in 6-well plates (15 w / well for BV2 cells and 65 w / well for BMDMs). After 24 h, the medium was removed, the cells were washed once with HBSS, and then replaced with DMEM or MEM complete medium containing different preparations (the final concentration of LPS in the M1 positive control group was 5 ng / mL, and the final concentration of interferon γ (IFN-γ) was 30 ng / mL; the final concentration of interleukin 4 (IL-4) in the M2 positive control group was 10 ng / mL; and the final concentration of Δ oeLh OMVs and AO@PTP / 47aD group oeLhThe final concentration of OMVs was 1 μg / mL. After incubation for 24 h, the cells were scraped with a cell scraper and lysed in RIPA (strong) lysis buffer (containing 1% phenylmethylsulfonyl fluoride (PMSF)) for 10 min in an ice bath. The cells were centrifuged at 14,000 g and 4 °C for 10 min and the supernatant was aspirated. The protein concentration in the supernatant was determined using a BCA protein quantification kit and leveled. The sample was diluted with 5× loading buffer and heated in hot water at 95 °C for 10 min to prepare the sample. The prepared sample was passed through a sodium dodecyl sulfate polyacrylamide gel After (SDS-PAGE) electrophoresis separation for 2 h (total protein amount of 20 μg), the protein was transferred to a polyvinylidene fluoride (PVDF) membrane, then blocked in a 5% skim milk solution at room temperature for 2 h and washed three times with 1× Tris-buffered saline containing Tween 20 (TBST). Add the primary antibody for overnight incubation and wash three times with 1× TBST. Add the corresponding secondary antibody labeled with horseradish peroxidase (HRP) and incubate at room temperature for 1.5 h and wash three times with 1× TBST. Finally, the membrane was incubated in the developer for 10 min and chemiluminescence imaging was performed in a Bio-Rad gel imager. The results are shown in Figure 2. Fig.21 As shown, it can be seen that: consistent with the M1 positive control group, Δ oeLh After OMVs and AO@PTP / 47aD treatment, the expression levels of M1 markers CD80 and iNOS increased significantly, while the expression levels of M2 markers CD206 and Arg-1 were very low or even almost absent. oeLh Although OMVs have been engineered to be attenuated, they still retain a certain immune stimulation ability and can effectively promote the transformation of GAMs to the M1 phenotype to exert an anti-tumor effect.

Claims

1. A method for preparing a nanoplatform based on attenuated bacterial outer membrane vesicles that can achieve co-delivery of siRNA and doxorubicin, characterized in that: The following steps are involved: (1) Preparation of crosslinkers: S1. Dissolve the reactive oxygen species (ROS) responsive linker 3-(propane-2,2-diylbis(sulfanediyl))dipropionic acid (TK-COOH) and an amidation reagent in an organic solvent, and activate the carboxyl group at room temperature for 2 h under the protection of an inert gas to obtain an activated ROS responsive linker; S2. The activated ROS-responsive linker is connected to a branched polyethyleneimine (PEI) having a molecular weight of 1800. 1.8k ) were dissolved in organic solvents respectively, and PEI was added under the protection of inert gas. 1.8k The solution is slowly dripped into the activated ROS-responsive linker solution. After reacting at room temperature for 22 to 24 hours, the reaction solution is transferred to a dialysis bag and then dialyzed in deionized water until the organic solvent and impurities are completely removed. The liquid in the dialysis bag is filtered through a membrane and then freeze-dried to obtain a cross-linked product. The reaction process is shown in Formula I: ； (2) The cross-linked product and polyethylene glycol (PEG) with a molecular weight of 3500 and a succinimidyl ester at the end were 3.5k -NHS) is dissolved in PBS solution, and the reaction is carried out at room temperature for 6 to 24 hours under the protection of inert gas. The reaction solution is then transferred to a dialysis bag and dialyzed in deionized water until the impurities are completely removed. The liquid in the dialysis bag is filtered through a membrane and freeze-dried to obtain a cationic polymer. The reaction process is shown in Formula II: ； (3) The adenosine triphosphate (ATP)-responsive aptamer and DOX were dissolved in ultrapure water treated with diethyl pyrocarbonate (DEPC) and sterilized by high temperature and high pressure, mixed and blown evenly in an enzyme-free environment, and then allowed to stand at room temperature for 1 to 2 hours for co-incubation to prepare an aptamer-doxorubicin complex (aptamer-DOX). The reaction process is shown in Formula III: ； (4) The aptamer-DOX, siRNA and the cationic polymer described in step (1) are dissolved in DEPC water. After the siRNA and aptamer-DOX are mixed with the cationic polymer respectively in an enzyme-free environment, the two systems are quickly combined and vortexed for 10 to 60 seconds, and then left to stand in an ice water bath for 20 to 40 minutes to obtain a positively charged nanocore. The reaction process is shown in Formula IV: ； (5) Add LB medium to the Erlenmeyer flask and inoculate the knockout mB The gene of Escherichia coli BL21 (Δ msbBE. coli BL21), after shaking the bacteria on an air shaker for a period of time, the bacteria were removed by centrifugation and filtration. The filtrate was concentrated by ultrafiltration and then ultracentrifuged to obtain Δ mB OMVs were treated with phosphate-buffered saline (PBS) mB After repeated washing, the OMVs mB OMVs were resuspended in deionized water, and the reaction process was shown in Formula V: ； (6) The positively charged nanocore described in step (4) and the Δ mB After the OMVs are mixed, they are ultrasonicated in an ultrasonicator to prepare coated nanoparticles. The reaction process is shown in Formula VI: ； (7) The amphiphilic block with maleimide and PEG molecular weight of 2000 (DSPE-PEG 2k -Mal) and the targeting functional peptide Angiopep-2 were dissolved in an organic solvent, reacted at room temperature for 20 to 24 hours under the protection of inert gas, and then the reaction solution was transferred to a dialysis bag, and then dialyzed in deionized water until the organic solvent and impurities were completely removed. The liquid in the dialysis bag was freeze-dried to obtain the targeting functional unit DSPE-PEG 2k -Angiopep-2, the reaction process is shown in Formula VII: ； (8) The targeting functional unit DSPE-PEG described in step (7) 2k -Angiopep-2 is dissolved in an organic solvent, and then mixed with the coated nanoparticles described in step (6), and incubated for 0.5 to 1 h to prepare a nanoplatform based on attenuated bacterial outer membrane vesicles that can achieve co-delivery of siRNA and doxorubicin. The reaction process is shown in Formula VIII: 。 2. The preparation method according to claim 1, characterized in that: In step (1) S1, the amidating reagent is 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC·HCl) and N-hydroxysuccinimide (NHS); the molar ratio of TK-COOH, EDC·HCl and NHS is 2:5:5; in step (1) S1, the organic solvent is anhydrous N'N-dimethylformamide (DMF); and in S2, the organic solvent is anhydrous DMF.

3. The preparation method according to claim 1, characterized in that In step (1) S2, PEI 1.8k The molar ratio between PEI and TK-COOH is 5:2; 1.8k The drip rate into the activated ROS-responsive connector is 1 mL / min; the dialysis bag is made of regenerated cellulose and has a molecular weight cutoff of 8000; the total dialysis time is 48 h and the dialysate is replaced every 8 h; the pore size of the filter membrane selected for filtration is 450 nm.

4. The preparation method according to claim 1, characterized in that In the step (2), the cross-linked product and PEG 3.5k The molar ratio of PEG-NHS is 1:1; the concentration of the PBS solution is 2 mol / L, the pH is 7.4, and the 3.5k -NHS concentration in PBS solution is 2.4 mg / mL; the dialysis bag is made of regenerated cellulose and has a molecular weight cutoff of 8000; further preferably, the total dialysis time is 24 h and the dialysate is replaced every 8 h; the pore size of the filter membrane selected for filtration is 220 nm.

5. The preparation method according to claim 1, characterized in that: In the step (3), the sequences of the two DNA single strands constituting the ATP-responsive aptamer are ACCTGGGGGAGTATTGCGGAGGAAGGT and ACCTTCCTCCGCAATACTCCCCCAGGT respectively; the DOX is in a desalted form; the molar ratio between the aptamer and DOX is 1:16; in the step (4), the mass ratios between siRNA and aptamer-DOX and the cationic polymer are 1:2 and 1:1.88 respectively; further preferably, the molar ratio between siRNA and aptamer-DOX is 1:1.

82.

6. The preparation method according to claim 1, characterized in that In the step (5), the ratio between the volume of the LB culture medium and the volume of the conical flask is 1:5; msbBE.coli The inoculation ratio of BL21 was 1%; the shaking conditions were 220 rpm and 37 °C, and the shaking time was 18 h; the centrifugation conditions were 4000 g, 25 °C, 10 min, and a total of 2 centrifugations; the pore size of the filter membrane selected for removing bacteria was 450 nm; the ultrafiltration conditions were 3500 rpm, 4 °C; the ultracentrifugation conditions were 150000 g, 4 °C, 2 h; the concentration of the PBS solution was 0.1 mol / L, and the pH was 7.4; PBS was used to remove Δ mB OMVs were washed at least 3 times.

7. The preparation method according to claim 1, characterized in that In step (6), the positively charged nanocore and Δ mB The mass ratio between OMVs was 1:2; the ultrasound program was set as follows: power 324 W, working 99 s, stopping 10 s, total duration 2 min, and temperature maintained at 4 °C.

8. The preparation method according to claim 1, characterized in that In step (7), DSPE-PEG 2k The molar ratio of -Mal to Angiopep-2 is 1:3; the organic solvent is anhydrous dimethyl sulfoxide (DMSO); the dialysis bag in step (7) is made of regenerated cellulose and has a molecular weight cutoff of 3500; the total dialysis time is 48 h and the dialysate is replaced every 12 h.

9. The preparation method according to claim 1, characterized in that The organic solvent in step (8) is DMSO; the concentration of Angiopep-2 in DMSO in step (8) is 2 mg / mL; the coated nanoparticles contain Δ mB The mass ratio between OMVs and Angiopep-2 contained in the targeting functional unit was 20:1; the co-incubation temperature was 37 °C.

10. A nanoplatform based on attenuated bacterial outer membrane vesicles and capable of co-delivering siRNA and doxorubicin, prepared according to the preparation method of any one of claims 1 to 9, wherein the diameter of the nanoplatform is 80 to 100 nm.

Images