Application of FOXO3a expression inhibitor in preparation of medicine for treating acute brain injury after subarachnoid hemorrhage

Abstract

The invention provides application of an expression inhibitor of FOXO3a in preparation of a medicine for treating acute brain injury after subarachnoid hemorrhage. The research finds that FOXO3a is highly expressed in acute brain injury after subarachnoid hemorrhage, and further finds that knock-down of FOXO3a improves SAH mouse neurological function impairment and encephaledema and reduces lipid peroxidation injury. The results show that FOXO3a is a new target spot for treating acute brain injury after subarachnoid hemorrhage. It is indicated that the FOXO3a knockout reagent or / and the FOXO3a inhibitor is a potential novel medicine for treating acute brain injury after subarachnoid hemorrhage.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to the use of an expression inhibitor of FOXO3a in the preparation of a medicine for treating acute brain injury after subarachnoid hemorrhage. Background Art

[0002] Subarachnoid hemorrhage (SAH) refers to a clinical syndrome caused by blood flowing into the subarachnoid space after rupture of blood vessels on the surface or bottom of the brain. It is a very serious common disease, accounting for about 10% of acute stroke. Studies have found that early brain injury (EBI) plays an important role in the recovery of neurological function and is an important factor causing poor neurological prognosis in SAH patients. There is currently no effective drug for the treatment of subarachnoid hemorrhage. Therefore, exploring potential targets and possible pathways for the treatment of SAH can provide important ideas for the subsequent treatment of SAH. As a cell death mode different from apoptosis, pyroptosis, autophagy, etc., ferroptosis has gradually entered the field of vision of stroke research, mainly manifested as iron ion metabolism disorders, glutathione depletion and lipid peroxidation enrichment. Iron accumulation and iron metabolism disorders caused by hemoglobin degradation after hemorrhagic stroke are important causes of neuronal damage, and excessive intracellular iron accumulation is an important prerequisite for ferroptosis. Therefore, ferroptosis may have an important potential role in brain damage after SAH. Ferroptosis is an important cause of neuronal damage or death after SAH, and intervening in the ferroptosis process may have important potential value.

[0003] Therefore, there is an urgent need to develop effective therapeutic targets for acute brain injury after subarachnoid hemorrhage and drugs for the treatment of acute brain injury after subarachnoid hemorrhage. Summary of the invention

[0004] The purpose of the present invention is to provide an application of FOXO3a as a target in the preparation of a drug for treating acute brain injury after subarachnoid hemorrhage. The present invention has found through experiments that FOXO3a is highly expressed in acute brain injury after subarachnoid hemorrhage, and further found that knocking down FOXO3a improves neurological function damage and brain edema in SAH mice and reduces lipid peroxidation damage. Therefore, the expression inhibitor of FOXO3a can be used to prepare a drug for treating acute brain injury after subarachnoid hemorrhage.

[0005] In order to achieve the above object, the present invention adopts the following technical solution:

[0006] In a first aspect of the present invention, there is provided the use of FOXO3a as a target in screening drugs for preventing, alleviating and / or treating acute brain injury after subarachnoid hemorrhage, wherein the screening method comprises screening substances capable of inhibiting the expression of FOXO3a gene.

[0007] In a second aspect of the present invention, there is provided a use of an expression inhibitor of FOXO3a in the preparation of a medicament for treating acute brain injury after subarachnoid hemorrhage.

[0008] Furthermore, the FOXO3a expression inhibitor comprises at least one of the following components:

[0009] FOXO3a inhibitors;

[0010] Knockdown reagent for FOXO3a.

[0011] Furthermore, the FOXO3a knockout reagent includes: shRNA and / or gRNA targeting the target gene, and the shRNA nucleotide sequence is shown in SED ID NO.1-SED ID NO.2.

[0012] Furthermore, the drug for treating acute brain injury after subarachnoid hemorrhage is a drug that improves neurological damage and brain edema in SAH mice and reduces lipid peroxidation damage.

[0013] In a third aspect of the present invention, a drug for treating acute brain injury after subarachnoid hemorrhage is provided, the drug comprising at least one of a FOXO3a inhibitor and a FOXO3a knockout agent. The FOXO3a inhibitor comprises MN58b. The FOXO3a knockout agent comprises: shRNA and / or gRNA targeting a target gene, the shRNA nucleotide sequence being as shown in SED ID NO.1-SED ID NO.2.

[0014] The drug also includes pharmaceutically acceptable excipients. The excipients include at least one of a filler, a disintegrant, a binder, an excipient, a diluent, a lubricant, a sweetener or a colorant. The dosage form of the drug includes at least one of granules, tablets, pills, capsules, injections or dispersants.

[0015] In a fourth aspect of the present invention, there is provided the use of FOXO3a as a molecular marker in the preparation of a diagnostic and / or prognostic product for acute brain injury after subarachnoid hemorrhage.

[0016] Furthermore, the detection reagent of FOXO3a is used in the preparation of diagnostic and / or prognostic products for acute brain injury after subarachnoid hemorrhage.

[0017] Furthermore, the FOXO3a detection reagent includes a FOXO3a protein detection reagent (such as an ELISA detection kit). In other embodiments, the FOXO3a detection reagent also includes a FOXO3a detection primer or an immunohistochemistry detection reagent.

[0018] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

[0019] The present invention provides the use of FOXO3a as a target in the preparation of a drug for treating acute brain injury after subarachnoid hemorrhage. The present invention finds through research that FOXO3a is highly expressed in acute brain injury after subarachnoid hemorrhage, and further finds that knocking down FOXO3a improves neurological function damage and brain edema in SAH mice and reduces lipid peroxidation damage. These results indicate that FOXO3a is a new target for the treatment of acute brain injury after subarachnoid hemorrhage. It indicates that a knockout agent of FOXO3a or / and a FOXO3a inhibitor is a potential new drug for the treatment of acute brain injury after subarachnoid hemorrhage. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0021] Figure 1 The FOXO3a protein concentration in the cerebrospinal fluid of SAH patients was positively correlated with the BAP1 concentration and prognosis. A. ELISA was used to detect the FOXO3a protein level in the cerebrospinal fluid of each group; B. The difference in FOXO3a levels in the cerebrospinal fluid between the good prognosis group (mRS 0-3) and the poor prognosis group (mRS 4-5); C. Correlation analysis showed the correlation between the FOXO3a concentration in the cerebrospinal fluid of SAH patients and the mRS score; D. ROC analysis showed the accuracy of the FOXO3a concentration in the cerebrospinal fluid of SAH patients in assessing prognosis.

[0022] Figure 2 The expression of FOXO3a protein in neurons of SAH mice was increased. AB. Western blot experiment and bar graph showed the level of FOXO3a protein in the ipsilateral cerebral cortex of mice at different times after SAH; C. Fluorescence staining of cerebral cortical tissues in each group was used to observe the expression of FOXO3a protein in neurons.

[0023] Figure 3 To silence FOXO3a and reduce neurological damage in SAH mice. A. Modified Garcia score was used to detect changes in neurological function in each group of mice; B. Dry-wet method was used to detect changes in brain tissue water content in each group; C. HE staining was used to detect changes in cerebral cortex damage in each group.

[0024] Figure 4To silence FOXO3a and reduce the level of lipid peroxidation in brain tissue of SAH mice. A. MDA detection kit was used to detect the MDA level in the ipsilateral cerebral cortex of each group (n=5 / group); B. SOD detection kit was used to detect the SOD activity in the ipsilateral cerebral cortex of each group (n=5 / group); C. GSH-Px detection kit was used to detect the GSH-Px level in the ipsilateral cerebral cortex of each group (n=5 / group); D. 4-HNE immunohistochemical staining was used to detect the changes in lipid peroxidation damage in the cerebral cortex of each group; EF. Western blot and bar graphs showed the changes in the levels of SLC7A11 and GPX4 proteins in the cerebral cortex of each group (n=5 / group). DETAILED DESCRIPTION

[0025] The present invention will be described in detail below in conjunction with specific implementations and examples, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these specific implementations and examples are used to illustrate the present invention, rather than to limit the present invention.

[0026] Throughout the specification, unless otherwise specifically stated, the terms used herein should be understood as meanings commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art to which the present invention belongs. In the event of a conflict, the present specification takes precedence.

[0027] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or obtained by existing methods.

[0028] The application of FOXO3a as a target in the preparation of a drug for treating acute brain injury after subarachnoid hemorrhage will be described in detail below in combination with examples and experimental data.

[0029] Example 1: Ethanolamine kinase 2 (FOXO3a) is highly expressed in acute brain injury after subarachnoid hemorrhage

[0030] 1. Research objects and materials

[0031] 1. Research subjects: All patients admitted to the neurosurgery department of our hospital and diagnosed with SAH in this study. The cerebrospinal fluid (CSF) of the control group came from patients without intracranial or spinal lesions but who required spinal anesthesia for other reasons. This study has been approved by the Ethics Committee of Renmin Hospital of Wuhan University. All patients are aware of and sign informed consent. If the patient is unconscious, the informed consent is signed by their authorized agent, and the neurological function score (mRS score) is collected 6 months after discharge.

[0032] 2. Inclusion criteria:

[0033] (1) Aged between 18 and 75 years old;

[0034] (2) meet the diagnostic criteria for SAH, seek medical attention within 72 hours, and have CSF collected;

[0035] (3) All patients received the same treatment medication and did not experience complications such as cerebral infarction and intracranial hemorrhage.

[0036] 3. Exclusion criteria:

[0037] (1) Age <18 or >75 years old;

[0038] (2) met the diagnostic criteria for SAH but presented to the doctor after 72 hours;

[0039] (3) the presence of neurological diseases such as cerebral infarction, cerebral vascular malformation, and brain tumor;

[0040] (4) Other serious systemic diseases (malignant tumors, systemic lupus erythematosus, ankylosing spondylitis, etc.).

[0041] 4. Diagnostic criteria for SAH patients:

[0042] (1) Sudden severe headache, accompanied by neurological dysfunction such as nausea, vomiting, neck stiffness, photophobia and transient loss of consciousness;

[0043] (2) If the brain CT scan shows SAH, lumbar puncture should be performed to assist in the diagnosis of SAH in patients with negative brain CT scan.

[0044] (3) Head CT angiography (CTA) and / or head DSA confirms intracranial aneurysm.

[0045] (4) CSF in this study was obtained from 25 SAH patients by lumbar puncture (LP) and external ventricular drainage (EVD) within 72 hours after SAH. CSF from 10 control groups came from patients without intracranial or spinal lesions and from patients without intracranial or spinal lesions who required spinal anesthesia for other reasons. After CSF samples were collected, they were quickly centrifuged at 3000 rpm for 10 minutes, and the supernatant was stored in a -80℃ refrigerator until it was taken out for use.

[0046] 2. Experimental Methods

[0047] The FOXO3a protein concentration in the cerebrospinal fluid of each group of people was detected according to the instructions of the ELISA kit (HM11015, Bioswamp).

[0048] Statistical methods: The difference in FOXO3a protein concentration in cerebrospinal fluid between the control group and the SAH group was expressed as mean ± standard error. The t test was used for comparison between the two groups. The ROC curve was used to analyze the diagnostic accuracy. The area under the ROC curve (AUC) was used to measure the model performance. * indicates statistically significant when P < 0.05;

[0049] 3. Experimental Results

[0050] The concentration of FOXO3a protein in the cerebrospinal fluid of SAH patients was significantly higher than that in the control group (see Figure 1 A).

[0051] To further analyze the relationship between FOXO3a concentration and mRS score, patients were divided into two groups according to mRS score, namely good prognosis (0-3 points) and poor prognosis (4-5 points). The results showed that compared with the good prognosis group, the FOXO3a level in the poor prognosis group was increased (see Figure 1 B), Pearson correlation analysis showed that FOXO3a levels were positively correlated with mRS scores (see Figure 1 C, r=0.1951, P=0.0271). This indicates that the expression of FOXO3a is related to the prognosis of acute brain injury after subarachnoid hemorrhage.

[0052] Further receiver operating characteristic curve (ROC) analysis of FOXO3a level and mRS score showed that the area under the curve (AUC) was 0.767, the sensitivity was 100%, and the specificity was 47.06% (see Figure 1 D, P<0.05), and the closer the AUC is to 1, the higher the accuracy. The diagnostic threshold of FOXO3a level in the cerebrospinal fluid of SAH patients when the Youden index is the largest is 772.5 pg / ml. These results show that FOXO3a concentration has a certain diagnostic value for the prognosis of SAH patients.

[0053] Therefore, FOXO3a can be used as a molecular marker in the preparation of diagnostic and / or prognostic products for acute brain injury after subarachnoid hemorrhage. The ELISA kit can detect the concentration of FOXO3a protein in cerebrospinal fluid. If the FOXO3a level is greater than 772.5 pg / ml, it can predict the risk of poor prognosis after subarachnoid hemorrhage.

[0054] Example 2: FOXO3a protein is highly expressed in neurons after SAH

[0055] 1. Materials: C57BL / 6J mice;

[0056] 2. Methods: 8-week-old mice were selected and the SAH mouse model was established by intravascular puncture with sutures. After different treatment times (0h, 3h, 6h, 12h, 24h and 72h), the mice were killed, and brain tissue was obtained after cardiac perfusion and brain tissue protein was extracted from the bleeding site. The brain tissue of the sham group and 24h after SAH was fixed with formaldehyde and then paraffin sectioned, and then immunofluorescence staining was used to detect FOXO3a protein expression.

[0057] 3. Results: In order to verify the expression changes of FOXO3a protein after SAH, the protein expression of FOXO3a was detected in the brain tissue of SAH mouse model. First, the protein was extracted from the ipsilateral cerebral cortex of Sham mice and SAH mice at 3h, 6h, 12h, 24h and 72h, and then WB experiment was performed. The experimental results showed that FOXO3a protein gradually increased after SAH, with obvious expression at 6h, reaching the peak at 24h, and significantly decreased at 72h, but still higher than the Sham group (see Figure 2 ).

[0058] Immunofluorescence showed that the expression of FOXO3a protein in neurons of the sham group was low and mainly concentrated in the nucleus; compared with the sham group brain tissue slices, the expression of FOXO3a protein in the cerebral cortex neurons 24 hours after SAH was significantly increased, mainly expressed in the nucleus of neurons, and also expressed to a certain extent in the cytoplasm (see Figure 2 C).

[0059] Example 3: FOXO3a inhibitor can improve neurological impairment and brain edema in SAH mice

[0060] 1. Vector construction

[0061] (1) The mouse FOXO3 gene was selected, the gene sequence number was NM_019740, provided by Shanghai GeneCare Gene Co., Ltd., the target sequence was: 5'-GGAACGTGATGCTTCGCAATT-3', and the sequence of FOXO3a-shRNA was shown in Table 1.

[0062] Table 1

[0063] FOXO3a-shRNA Sequence (5'-3') Chain of Justice GGAACGTGATGCTTCGCAATT(SEQ ID NO.1) Antisense strand AATTGCGAAGCATCACGTTCC(SEQ ID NO.2)

[0064] (2) The sense and antisense strands of FOXO3a-shRNA were annealed separately, and the oligonucleotide double strands obtained after annealing were inserted into the pLKO.1 vector (the pLKO.1 vector was linearized by double digestion with EcoR1 and Age1 endonucleases, and then enzymatically ligated) to obtain the FOXO3a shRNA knockdown plasmid, which contained the GFP or mCherry gene sequence.

[0065] 2. Lentiviral packaging and cell transduction

[0066] Plasmids were extracted using the DP118 (Tiangen Biotech) kit. Lentivirus packaging was performed using HEK293T cells. The specific method is as follows:

[0067] (1) HEK293T cells were plated in a 10 cm culture plate and cultured with DMEM complete medium to ensure that the cells reached 80%-90% confluence when transfected the next day;

[0068] (2) Add 20 μg of vesicular stomatitis virus G plasmid, pCMV-Δ8.9 packaging plasmid and target plasmid to 950 μL Opti-MEM at a mass ratio of 5:3:2, mix well, add 60 μL PEI transfection reagent, shake again to mix well and let stand for 15 min;

[0069] (3) Transfection of HEK293T cells: Evenly drop the plasmid into the HEK293T culture medium. After 6-8 hours, remove the culture medium and add 10 mL of fresh DMEM complete culture medium. Continue culturing until 48 hours after transfection, and collect the cell supernatant. After centrifugation at 4000 rpm for 10 minutes, filter the supernatant with a 0.45 μm filter membrane to obtain the lentiviral solution.

[0070] (4) Lentivirus infection of tumor cells: For infection of cell lines, cells were plated in 6-well plates and cultured for 24 hours. After the cells adhered to the wall, the culture medium was aspirated and replaced with lentivirus solution. After 24 hours, fresh culture medium was replaced and cultured for another 24 hours. Cell fluorescence was observed under a fluorescence microscope, and positive cells were sorted out by flow cytometry to establish a line for expansion for subsequent experiments. For infection of primary cells of patients, primary tumor single cells were isolated from patient tissues, plated in 6-well plates or culture dishes, and lentivirus solution was added. After suspension infection for 24 hours, the cells were collected by centrifugation, and positive cells were sorted out by flow cytometry for the construction of PDX or PDO models in Example 3.

[0071] Its knockdown efficiency was verified by RT-qPCR, and the lentiviral vector pLKO.1-shRNA could effectively reduce the expression level of FOXO3a in cell lines with acute brain injury after subarachnoid hemorrhage.

[0072] 3. Mouse Experiment

[0073] The mice in the experimental group and the control group were stereotaxically injected with sh-FOXO3a and sh-NC viruses in the ipsilateral cerebral cortex, respectively. 4ul of the virus was injected, and the gradient concentration of the virus was 5×10 8TU / ml. After 7 days of treatment, SAH mice were modeled, and the neurological function scores of mice in each group were observed and counted 24 hours after modeling. The experiment was divided into 3 groups: Sham (control group), SAH+sh-NC (experimental group) and SAH+sh-FOXO3a (treatment group). The Garcia neurological function score was used, with a maximum total score of 18 points, divided into 6 parts, each with a score of 0-3 points: spontaneous activity, symmetry of forelimb movements, outward extension of forepaws, body proprioception, and response to touch of tentacles. Brain tissue was collected 24 hours after SAH and divided into left and right cerebral hemispheres and brainstem, and the water content of brain tissue was detected by dry and wet method. Brain tissue sections of each group were stained with HE to observe brain tissue damage.

[0074] Statistical methods: Neurological function scores, brain edema, Western blot, HE staining and 4-HNE histochemical staining of mice in the control group, SAH experimental group (sh-NC) and SAH treatment group (sh-FOXO3a). Data are expressed as mean ± standard error, t test was used for comparison between two groups, one-way analysis of variance (ANOVA) and Tukey test were used for comparison among multiple groups, * indicates statistical difference when P < 0.05.

[0075] 3. Experimental results

[0076] Compared with the control group, the neurological function of mice in the experimental group was significantly reduced, the water content of the ipsilateral brain was significantly increased, and HE staining showed cell damage and sparse tissue. Compared with the experimental group, the neurological function of mice in the treatment group was improved to a certain extent, the water content of the ipsilateral brain was reduced, and HE staining showed that cell and tissue damage was reduced (see Figure 3 AC). The results showed that inhibition of FOXO3a could improve neurological damage and reduce brain edema in SAH mice.

[0077] Example 4: FOXO3a inhibitors can reduce lipid peroxidation damage in SAH mice

[0078] 1. Materials: C57BL / 6J mice;

[0079] 2. Methods: The experiment was divided into 3 groups: Sham (control group), SAH+sh-NC (experimental group) and SAH+sh-FOXO3a (treatment group). Brain tissues were collected from the same side 24 hours after SAH, and the levels of SLC7A11 and GPX4 were detected by Western blot. The levels of lipid peroxidation were detected by MDA kit, SOD kit and GSH-Px kit. 4-HNE immunohistochemical staining was used to detect lipid peroxidation damage in brain tissues of each group.

[0080] 3. Results: Compared with the control group, the expression of SLC7A11 and GPX4 in the ipsilateral cerebral cortex of the experimental group was significantly decreased, MDA increased, SOD and GSH-Px levels decreased, and 4-HNE expression increased significantly. Compared with the experimental group, the expression of SLC7A11 and GPX4 in the ipsilateral cerebral cortex of the treated group mice was significantly increased, MDA decreased, SOD and GSH-Px levels increased, and 4-HNE level decreased ( Figure 4 AF). These results indicate that inhibition of FOXO3a can reduce lipid peroxidation damage in SAH mice.

[0081] Finally, it should be noted that the terms "comprises," "includes," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that includes a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements that are inherent to such process, method, article, or apparatus.

[0082] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0083] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. Use of FOXO3a as a target in screening drugs for preventing, alleviating and / or treating acute brain injury after subarachnoid hemorrhage, characterized in that: The screening method includes screening substances that can inhibit the expression of FOXO3a gene.

2. Application of FOXO3a expression inhibitor in the preparation of drugs for treating acute brain injury after subarachnoid hemorrhage.

3. The use according to claim 2, characterized in that: The FOXO3a expression inhibitor comprises at least one of the following components: FOXO3a inhibitors; Knockdown reagent for FOXO3a.

4. The use according to claim 3, characterized in that: The FOXO3a knockout reagent includes: shRNA and / or gRNA targeting the target gene, and the shRNA nucleotide sequence is shown in SED ID NO.1-SED ID NO.

2.

5. The use according to claim 2, characterized in that: The medicine for treating acute brain injury after subarachnoid hemorrhage is a medicine for improving neurological damage and brain edema in SAH mice and reducing lipid peroxidation damage.

6. A drug for treating acute brain injury after subarachnoid hemorrhage, characterized in that: The drug includes at least one of a FOXO3a inhibitor and a FOXO3a knockout agent.

7. Application of FOXO3a as a molecular marker in the preparation of diagnostic and / or prognostic products for acute brain injury after subarachnoid hemorrhage.

8. Use of FOXO3a detection reagents in the preparation of diagnostic and / or prognostic products for acute brain injury after subarachnoid hemorrhage.

9. The use according to claim 8, characterized in that: The FOXO3a detection reagent includes a FOXO3a detection primer or an immunohistochemical detection reagent.

Images