Method for mining cell surface antigens against novel antibodies

Abstract

The present invention relates to a method for mining a cell surface antigen for a novel antibody, and more particularly, to a method for mining a cell surface antigen for a novel antibody, having the effect of being capable of accurately screening a cell surface antigen that binds to a novel antibody and of effectively screening a cell surface antigen for the antibody through a cell that binds well to a novel antibody, on the basis of a screening method according to one aspect.

Description

Technical Field

[0001] A method for mining cell surface antigens targeting novel antibodies is disclosed. Background Art

[0002] Cell therapy using chimeric antigen receptors (CAR) has become a promising anticancer treatment method, and research on patient-customized anticancer vaccines is being actively conducted. This patient-customized anticancer vaccine can improve the effect of immune anticancer therapy by inducing the immune response in the patient's body to focus on cancer cell-specific neoantigens (neoantigens). In such anticancer treatment, the technology of screening effective antigens plays a core role.

[0003] In general, a method using cDNA library screening is used to identify new antigens. This method is achieved by overexpressing cDNA libraries and MHC molecules in cell lines and by a T cell co-culture step for identifying antigens that induce T cell activation. However, this has the disadvantages of being labor-intensive, costly, and difficult to identify all tumor antigens.

[0004] In addition, the efficiency of immunoprecipitation-LC-MS / MS, a method commonly used to mine antigens, is also low. In fact, there is currently no technology that can effectively mine cell surface antigens targeting new antibodies.

[0005] Therefore, in antigen-based anticancer therapy, etc., the current inefficient antigen mining technology has become a technical obstacle, and a technology that can efficiently mine antigens is needed.

[0006] In this regard, the present inventors conducted research based on this and found that by constructing a guide RNA library targeting cell surface proteins and introducing it into cancer cells together with Cas9, cell surface antigens can be effectively mined, thereby completing the present invention. Summary of the invention

[0007] Technical issues On the one hand, a method for screening cell surface antigens is provided, comprising the following steps: treating isolated cells with a vector introduced with a guide RNA (gRNA: guide RNA) library targeting cell surface proteins of the cells; treating cells treated with the vector with a protein capable of binding to the isolated cells; and obtaining cells that have lost the ability to bind to the treated protein from the cells treated with the protein.

[0008] Technical Solution On the one hand, a method for screening cell surface antigens is provided, comprising the following steps: treating isolated cells with a vector introduced with a guide RNA (gRNA: guide RNA) library targeting cell surface proteins of the cells; treating the cells treated with the vector with a protein having binding ability with the isolated cells; and obtaining cells that have lost the binding ability with the treated protein from the cells treated with the protein.

[0009] The isolated cell may be a cancer cell.

[0010] In this specification, the term "cancer" refers to a physiological state characterized by typical abnormal or uncontrolled cell growth in animals. Cancer may be associated with, for example, metastasis, interference with peripheral cells with normal functions, release of cytokines or other secretory products at abnormal levels, inhibition or increase of inflammatory or immunological responses, neoplasia, premalignant lesions, malignancy, surrounding or distant tissues or organs (e.g., lymph node invasion), etc. The cancerous tissue may be a tissue separated from a malignant tumor. The step of obtaining cancerous tissue from the malignant tumor may be performed by conventional anatomical methods (e.g., by cutting the tissue present in the malignant tumor into multiple parts with sterile scissors). The obtained cancerous tissue may be washed with serum-free culture medium or phosphate buffered saline (PBS: phosphate buffered saline) containing antibiotics (e.g., penicillin, streptomycin or gentamicin) to remove contaminants such as blood present in the tissue. The cancerous tissue separated as described above may be directly treated with an enzyme, or may be further finely cut with sterilized scissors and the like and then treated with an enzyme.

[0011] In a specific example, the cancer may be blood cancer or solid cancer, and the solid cancer may be any one or more selected from the group consisting of lung cancer, skin cancer, stomach cancer, intestinal cancer, colon cancer, pancreatic cancer, liver cancer, thyroid cancer, uterine cancer, cervical cancer, ovarian cancer, testicular cancer, prostate cancer, breast cancer and oral cancer, but is not limited thereto.

[0012] In one specific example, the cell may include a Cas9 polypeptide. The Cas polypeptide is one of the protein components of the CRISPR / Cas system and may be an activated endonuclease or nicking enzyme. The Cas polypeptide may form a complex with crRNA (CRISPR RNA) and trans-activating crRNA (tracrRNA: trans-activatingcrRNA) to exhibit its activity. The cell may also include a Cas polynucleotide, which is a nucleic acid sequence encoding the Cas polypeptide.

[0013] The Cas polynucleotide can be, for example, a polynucleotide derived from a bacterium of the genus Streptococcus (e.g., Streptococcus pyogenes), Neisseria (e.g., Neisseria meningitidis), Pasteurella (e.g., Pasteurella multocida), Francisella (e.g., Francisella novicida), or Campylobacter (e.g., Campylobacter jejuni).

[0014] The Cas polypeptide may be a wild-type Cas polypeptide or a mutant Cas polypeptide. The mutant Cas polypeptide may be, for example, a polypeptide in which the catalytic aspartate residue is changed to another amino acid (eg, alanine). The Cas polypeptide may be a recombinant protein.

[0015] In this specification, the term "guide RNA (gRNA: guide RNA)" refers to a polynucleotide that cuts, inserts or connects a target DNA in a cell by RNA editing. The guide RNA may be a single-stranded guide RNA (sgRNA: single-chain guide RNA). The guide RNA may be a crRNA (CRISPR RNA) that is specific to a target nucleic acid sequence. The guide RNA may also include a trans-activating crRNA (tracrRNA: trans-activating crRNA) that interacts with the Cas9 nuclease. The tracrRNA may include a polynucleotide that forms a loop structure. The guide RNA may be 10 to 30 nucleotides in length. The guide RNA may be, for example, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length.

[0016] The guide RNA may include RNA, DNA, PNA or a combination thereof. The guide RNA may be chemically modified.

[0017] The guide RNA can be a component of gene scissors (programmable nuclease). Gene scissors refer to all forms of nucleases that can recognize and cut specific sites on the genome. The gene scissors are, for example, transcription activator-like effector nucleases (TALEN: transcription activator-like effector nuclease), zinc-finger nuclease, meganuclease, RNA-guided engineered nuclease (RGEN: RNA-guided engineered nuclease), Cpf1 and Ago homolog (Ago homolog, DNA-guided endonuclease). The RGEN refers to a nuclease that contains a guide RNA specific to the target DNA and a Cas protein as components. The polynucleotide can be, for example, a component of RGEN.

[0018] The guide RNA can remove the nucleic acid sequence encoding the KRAS polypeptide from the genome of the cell by non-homologous end-joining (NHEJ).

[0019] In this specification, the term "library" refers to a poolor population containing two or more substances of the same species with different characteristics. Therefore, an oligonucleotide library can be a population containing two or more oligonucleotides with different base sequences (e.g., guide RNA) and / or two oligonucleotides with different target sequences.

[0020] The guide RNA library can be a population of guide RNAs targeting cell-surface-protein genes. The guide RNA library can be a population of guide RNAs targeting 2,000 to 6,000 cell-surface-protein genes. In the guide RNA, each cell-surface-protein gene can include 1-10 guide RNAs.

[0021] In this specification, the term "vector" refers to a medium capable of delivering the guide RNA into a cell, for example, a genetic construct, and the vector may contain a base sequence encoding each guide RNA. The vector may be a viral vector or a plasmid vector.

[0022] In a specific example, the vector may be a viral vector. The viral vector may be a retroviral vector, an adenoviral vector, a lentiviral vector, a herpes virus vector, a varicella virus vector, a rhabdoviral vector, an alphavirus vector, a flavivirus vector or an adeno-associated virus vector. The vector may be a vector for expression. The vector may be a constitutive or inducible expression vector. The vector may include a packaging signal, a rev response element (RRV), a WPRE (a posttranscriptional regulatory element of woodchuck hepatitis virus), a central polypurine tract (cPPT), a promoter, an antibiotic resistance gene, an operator, a repressor, a T2A peptide, a reporter gene or a combination thereof. The promoter may include a U6 polymerase III promoter, an elongation factor 1α promoter, an H1 promoter, a cytomegalovirus promoter or a combination thereof. The antibiotic resistance gene may include a puromycin resistance gene, a blasticidin resistance gene or a combination thereof. The repressor may be a tetracycline operator. The reporter gene may include a nucleic acid sequence encoding enhanced green fluorescent protein. The vector may include necessary regulatory elements operably linked to the insert so that the insert (ie, oligonucleotide) is expressed when the vector is present in cells of an individual.

[0023] The method of delivering the vector to the cells for preparing the library can be achieved by various methods known in the art. For example, it can be performed by various methods known in the art such as calcium phosphate-DNA coprecipitation, DEAE-dextran-mediated transfection, polybrene-mediated transfection, electroporation, microinjection, liposome fusion, liposome transfection, and protoplast fusion. In addition, when a viral vector is used, the target (i.e., the vector) can be delivered to the cell using viral particles by infection. In addition, the vector can be introduced into the cell by a gene gun or the like.

[0024] In one embodiment, for cells treated with the vector, one vector can be introduced into each cell. By adjusting the multiplicity of infection (MOI) to 0.2 to 0.4 (eg, 0.3), one vector can be introduced into each cell.

[0025] In one embodiment, the method may include the step of removing cells into which the vector has not been introduced.

[0026] In this specification, the term "protein capable of binding to a cell" may refer to a protein that specifically recognizes a surface protein of a cell or specifically binds to a surface protein of a cell. Therefore, the protein capable of binding to the cell may be a protein that specifically binds to the cell-surface-protein.

[0027] In one embodiment, the protein that specifically binds to the cell-surface protein may be any one selected from the group consisting of an antibody, an affibody, and a bispecific antibody (diabody) without an Fc region.

[0028] In this specification, the terms "antibody" and "antibody" refer to any antigen-binding molecule or molecular complex that includes at least one complementary determining region (CDR) that specifically binds to a specific antigen or interacts with a specific antibody. The antibody includes not only immunoglobulin molecules, but also multimers thereof (e.g., IgM), wherein the immunoglobulin molecule includes four polypeptide chains of two heavy (H) chains and two light (L) chains interconnected by disulfide bonds. In addition, the antibody includes an immunoglobulin molecule composed of four polypeptide chains of two heavy (H) chains and two light (L) chains interconnected by disulfide bonds. Each heavy chain includes a heavy chain variable region (abbreviated as HCVR or VH in this application) and a heavy chain constant region. The heavy chain constant region includes three domains CH1, CH2 and CH3. Each light chain includes a light chain variable region (abbreviated as LCVR or VL in this application) and a light chain constant region. The light chain constant region includes a domain (CL1). The VH and VL regions can be further subdivided into hypervariable regions called complementarity determining regions (CDRs) interspersed with more conserved regions called framework regions (FRs). Each VH and VL is composed of three CDRs and four FRs, which are arranged in the following order from amino terminus to carboxyl terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.

[0029] The antibody also includes an antigen-binding fragment of a complete antibody molecule. The term "antigen-binding portion" of an antibody, "antigen-binding fragment" of an antibody, etc. includes any naturally occurring, enzymatically obtainable, synthetic or genetically engineered polypeptide or glycoprotein that specifically binds to an antigen to form a complex. The antigen-binding fragment of an antibody can be derived from a complete antibody molecule using any suitable standard technique such as proteolytic digestion or recombinant genetic engineering techniques involving manipulation and expression of DNA encoding antibody variable domains and optional constant domains. Such DNA can be known or disclosed, for example, it can be easily utilized from a DNA library (for example, including a phage-antibody library) as a commercial source, or it can be synthesized. The DNA can be sequenced and manipulated using chemical methods or molecular biological techniques for the following reasons: in order to arrange more than one variable domain and / or constant domain into a suitable configuration, or in order to introduce codons, in order to produce cysteine ​​residues, in order to modify, add amino acids or make amino acids missing, etc.

[0030] In the present specification, the term "affibody" may refer to an antibody mimetic that can bind to a specific target protein (receptor). Generally, an affibody molecule is composed of 20 to 150 amino acid residues and may be composed of 2 to 10 α helices.

[0031] In one embodiment, the cell-surface-protein that provides a site for binding of a protein capable of binding to the isolated cells can be bound to an antibody or antibody-like Fc site.

[0032] In one embodiment, the protein capable of binding to the isolated cells and the cell-surface protein can be linked via a non-covalent bond.

[0033] In this specification, the term "cell-surface-protein" may refer to a protein present on the cell surface. In a specific example, the cell-surface-protein may be an antigen that binds to the treated protein. Therefore, by the screening method, cell surface antigens that bind well to the novel antibody can be mined.

[0034] In a specific example, the step of obtaining cells that lose the ability to bind to the treated protein may include the following steps: treating beads having a surface that binds to the treated protein with cells treated with the protein; and obtaining cells that do not bind to the beads. The beads may be beads whose surfaces are modified to bind to the treated protein.

[0035] In one embodiment, the method may include the following steps: analyzing the gRNA included in the cell that has lost the ability to bind to the treated protein; and confirming the gene targeted by the analyzed guide RNA.

[0036] In one embodiment, the method may include the following steps: preparing control cells in which the gene targeted by the guide RNA to be analyzed is knocked down or knocked out; and treating the control cells with an antibody to measure whether an antigen-antibody reaction occurs. The control cells in which the gene targeted by the guide RNA to be analyzed is knocked down can be prepared by introducing siRNA of the target gene.

[0037] In one specific example, the antigen-antibody reaction can be measured using any one selected from the group consisting of enzyme immunoassay, radioimmunoassay, sandwich assay, Western blotting, immunoprecipitation, immunohistochemical staining, fluorescent immunoassay, enzyme substrate colorimetry, and antigen-antibody agglutination method.

[0038] In one embodiment, the cell-surface-protein may be a tumor-associated antigen (TAA).

[0039] In this specification, the term "tumor-associated antigen (TAA)" refers to any antigen including, but not limited to, proteins associated with cancer. Such antigens may be expressed on malignant cells or in tumor microenvironments such as tumor-associated blood vessels, extracellular matrix, mesenchymal matrix, or immune infiltrates.

[0040] The tumor-associated antigens may include, for example, AFP, ALK, BAGE protein, BIRC5 (survivin), BIRC7, β-catenin, brc-abl, BRCA1, BORIS, CA9, carbonic anhydrase IX, caspase-8, CALR, CCR5, CD19, CD20 (MS4A1), CD22, CD40, CD70, CDK4, CEA, cyclin-B1, CYP1B1, EGFR, EGFRvIII, ErbB2 / Her2, ErbB3, ErbB4, ETV6-AML, EpCAM, EphA2, Fra-1, FOLR1, GAGE ​​protein (e.g., GAGE-1, -2), GD2, GD3, GloboH, Glypican-3, GM3, gp100, Her2, HLA / B-raf, HLA / k-ras, HLA / MAGE-A3, hTE RT, IL-10, LMP2; MAGE proteins (e.g., MAGE-1, -2, -3, -4, -6, and -12), MART-1, mesothelin, ML-IAP, Muc1, Muc2, Muc3, Muc4, Muc5, Muc16 (CA-125), MUM1, NA17, NY-BR1, NY-BR62, NY-BR85, NY-ESO1, p15, p53, PAP, PAX3, P AX5, PCTA-1, PLAC1, PRLR, PRAME, PSMA (FOLH1), RAGE protein, Ras, RGS5, Rho, SART-1, SART-3, STEAP1, STEAP2, TAG-72, TGF-β, TMPRSS2, Thompson-nouvelle antigen (Tn), TRP-1, TRP-2, tyrosinase, and urokinin-3.

[0041] Effects of the Invention Based on the screening method according to one aspect, cell surface antigens that bind to novel antibodies can be accurately screened, and cell surface antigens against antibodies can be effectively screened through cells that bind well to novel antibodies. This can be used to mine novel major antigens by mining novel antibodies present in patient serum, and the mining of novel antigens can be a new therapeutic strategy for overcoming resistance in anticancer therapy, so it is of great significance in the field of anticancer therapy and immunotherapy, and plays an effect of helping to develop patient-customized therapeutic strategies. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 These images confirm whether Cas9 is expressed in breast cancer cells: MDA-MB-468 is a breast cancer cell that has not been transduced with Cas9, and MDA-MB-468-cas9 is a breast cancer cell that has been transduced with Cas9.

[0043] Figure 2 This graph shows that Cas9 / guide RNA library cells were subjected to magnetic activated cell sorting (MACS) using cetuximab as an antibody, and guide RNAs were confirmed to be expressed in larger amounts in cells not labeled with cetuximab than in cells labeled with cetuximab.

[0044] Figure 3 This is a graph showing that MACS was performed using a CD44 antibody, and guide RNAs that were abundantly expressed in cells that were not labeled with the CD44 antibody were confirmed in different cell lines: in, Figure 3 a is a graph showing that guide RNA was expressed in large amounts in HeLa cell lines in cells that were not labeled with CD44 antibodies. Figure 3 b is a graph confirming that the guide RNA is abundantly expressed in the A549 cell line from cells not labeled with CD44 antibody.

[0045] Figure 4 This is a graph showing that MACS was performed using anti-cancer antibodies S4-2 and S3-5 mined from a patient-derived antibody library as antibodies against Cas9 / guide RNA library cells, and that guide RNAs that were expressed in large amounts in cells not labeled with the anti-cancer antibodies S4-2 or S3-5 were confirmed compared to cells labeled with the anti-cancer antibodies S4-2 or S3-5: in, Figure 4 a is a graph confirming that guide RNA is abundantly expressed in cells in which anti-cancer antibody S4-2 mined from a patient-derived antibody library is not labeled. Figure 4 b is a graph confirming that the guide RNA is abundantly expressed in cells in which the anti-cancer antibody S3-5 mined from the patient-derived antibody library is not labeled.

[0046] Figure 5 The figure shows that ICAM1-specific siRNA was treated in MDA-MB-468 cells, and flow cytometry (FACS: Fluorescence-activated cell sorting) was performed.

[0047] Figure 6 This is an image of immunoprecipitation-western blot performed on the HS578T breast cancer cell line expressing ICAM1.

[0048] Figure 7 The images show the results of immunoprecipitation-Western blotting performed to confirm whether the anti-cancer antibodies S4-2 and S3-5 directly bind to ICAM1.

[0049] Figure 8 is a schematic diagram of a method for screening cell surface antigens. DETAILED DESCRIPTION

[0050] The following is a more detailed description by way of examples, but these examples are for illustrative purposes only and the scope of the present invention is not limited to these examples.

[0051] Example 1. Construction of cells stably expressing Cas9 To construct cells stably expressing Cas9, HEK293T cells were seeded 1 day before transfection to obtain 70% confluency. The HEK293T cells were co-transfected with packaging plasmid pMD2.G (1.5 μg), psPAX2 (1.5 μg) and lentiCas9-Blast (4.5 μg) using packaging Lipofectamine 3000. After 6 hours after transfection, the culture medium was replaced with DMEM medium containing 10% FBS and 1% penicillin / streptomycin (P / S: Penicillin / Streptomycin). Then, the culture supernatant containing viral particles was collected every 24 hours and centrifuged at 1200 rpm for 5 minutes to remove the remaining HEK293T cells. The collected viral supernatant was filtered using a 0.45 μm filter.

[0052] To generate breast cancer cells (MDA-MB-468) stably expressing Cas9, the virus-containing medium was supplemented twice with polybrene (10 μg / ml). After 24 hours of incubation, breast cancer cells (MDA-MB-468-cas9) stably expressing Cas9 were constructed by 6 μg / ml-8 μg / ml of Blasticidine S hydrochloride (Sigma). To confirm whether Cas9 is well expressed in the constructed breast cancer cells, Western blotting was performed and is shown in Figure 1 middle.

[0053] Figure 1 These images confirm whether Cas9 is expressed in breast cancer cells: MDA-MB-468 is a breast cancer cell that has not been transduced with Cas9, and MDA-MB-468-cas9 is a breast cancer cell that has been transduced with Cas9.

[0054] like Figure 1 As shown, it was confirmed that Cas9-transduced MDA-MB-468-cas9 stably expressed Cas9.

[0055] Example 2. Construction of a guide RNA library for cell-surface proteins Five guide RNAs targeting each gene of approximately 5,000 cell-surface proteins were designed and synthesized, and then cloned into a lentiviral vector to construct a guide RNA library for cell-surface proteins.

[0056] More specifically, a total of 2,692 cell-surface proteins were selected by analyzing genes whose gene information was well verified among proteins known to exist on the cell surface, and are shown in Table 1: Reference Proc Natl Acad Sci U S A. 2018 Nov 13;115(46): E10988-E10997 and HGNC database. Five guide RNAs targeting each gene were designed for approximately 5,000 cell-surface proteins, synthesized, and then cloned into a lentiviral vector to construct a guide RNA library for cell-surface proteins.

[0057] More specifically, a total of 2,692 cell-surface-proteins were selected by analyzing genes whose gene information was well verified among proteins known to exist on the cell surface and are shown in Table 1: with reference to Proc Natl Acad Sci US A. 2018 Nov 13;115(46): E10988-E10997 and HGNC database.

[0058] [Table 1]

[0059]

[0060]

[0061]

[0062]

[0063]

[0064]

[0065]

[0066]

[0067]

[0068]

[0069]

[0070]

[0071]

[0072]

[0073]

[0074]

[0075]

[0076]

[0077]

[0078]

[0079]

[0080]

[0081]

[0082]

[0083]

[0084]

[0085]

[0086]

[0087]

[0088]

[0089]

[0090]

[0091]

[0092] Among the genes disclosed in Table 1 above, 2,653 genes that are easy to design guide RNAs were selected, and up to 6 guide RNAs and control guide RNAs were designed for each of the genes, thereby designing a guide RNA library including a total of 15,678 guide RNAs. Then, the synthesized guide RNA library was cloned into a lentiviral vector to construct a lentiviral vector expressing the guide RNA. Next-generation sequencing (NGS) was performed on the lentiviral vector to confirm that the guide RNA was well expressed.

[0093] Example 3. Construction of Cas9 / guide RNA library cells (Cas9 / gRNA library cells) The lentiviral vector containing the guide RNA library of Example 2 was introduced into the breast cancer cells (MDA-MB-468-cas9) of Example 1. The multiplicity of infection (MOI: Multiplicity of Infection) was adjusted to a level of 0.3, and one lentiviral vector was introduced into each breast cancer cell. Then, breast cancer cells without guide RNA were removed by puromycin selection, thereby constructing Cas9 / guide RNA library cells. The whole DMA (genomic DNA) of the constructed Cas9 / guide RNA library cells was isolated, and NGS was performed to confirm the insertion of the guide RNA library.

[0094] Experimental Example 1: Sorting cells that have lost their ability to bind to antibodies using magnetic activated cell sorting (MACS) The Cas9 / guide RNA library cells of Example 3 were treated with trypsin and resuspended in 150 μl MACS buffer to a final concentration of 2×10 6 cells. Then, 5 μg of antibody and the Cas9 / guide RNA library cells were incubated at room temperature for 2 hours, and the Cas9 / guide RNA library cells were combined with MACS protein G microbeads (130-071-101) at 4°C for 30 minutes, and then MACS buffer (100 μl) was added to the Cas9 / guide RNA library cells, and the cells were sorted using LD sorting columns (130-042-901). Cells not labeled with antibodies and cells labeled with antibodies were collected, and cell counting was performed.

[0095] Experimental Example 2: Confirmation of loss of antibody binding ability due to gene deletion In order to confirm the gRNA inserted in each isolated cell group, the guide RNA region in the total DNA of the cell was subjected to polymerase chain reaction (PCR) and its base sequence was sequenced by NGS, thereby confirming the distribution of 15,678 guide RNAs. For each of the total 15,678 guide RNAs, the ratio in the control group and the experimental group was calculated, and the guide RNA that increased in the experimental group compared to the control group was selected. The gene targeted by the guide RNA selected above was confirmed, and the antibody binding was lost when which gene was deleted was tracked.

[0096] 2.1 MACS was performed using Cetuximab, an antibody that binds to the EGFR surface protein, and the results confirmed that cells lacking EGFR were screened Screening was performed using cetuximab, which is a known antibody that binds to epidermal growth factor receptor (EGFR), a cell surface protein. As a result, it was confirmed that guide RNAs targeting guide sequences targeting EGFR (SEQ ID NO. 1: TGTCACCACATAATTACCTG, SEQ ID NO. 2: GTGGAGCCTCTTACACCCAG, SEQ ID NO. 3: GTCTGCGTACTTCCAGACCA, SEQ ID NO. 4: TCTTGCCGGAATGTCAGCCG, SEQ ID NO. 5: CCTCATTGCCCTCAACACAG, SEQ ID NO. 6: CTCTTCTTAGACCATCCAGG) were amplified more than 22,000 times in cells not labeled with cetuximab. The results are shown in FIG. Figure 2 middle.

[0097] Figure 2This is a graph showing that guide RNAs expressed in larger amounts in cells not labeled with cetuximab compared to cells labeled with cetuximab were confirmed by magnetic activated cell sorting (MACS) using cetuximab as an antibody for Cas9 / guide RNA library cells.

[0098] like Figure 2 As shown, it was confirmed that the guide RNA targeting EGFR (ie, antigen against cetuximab) was abundantly expressed in cells not labeled with cetuximab.

[0099] This means that the antigen to which the antibody binds can be identified by confirming the guide RNA amplified in cells without antibody labeling and confirming the gene targeted by the amplified guide RNA.

[0100] 2.2 MACS was performed using CD44 antibody as a binding antibody against CD44, and the results confirmed that cells lacking CD44 were screened Screening was performed using CD44 antibodies, which are binding antibodies to CD44 surface proteins. As a result, it was confirmed that guide RNAs for guide sequences targeting CD44 (SEQ ID NO: 7: CATCACGGTTAACAATAGCT, SEQ ID NO: 8: AAGACTCCCATTCGACAACA, SEQ ID NO: 9: TGCTACTTCAGACAACCACA, SEQ ID NO: 10: TCGCTACAGCATCTCTCGGA, SEQ ID NO: 11: CGTGGAATACACCTGCAAAG, SEQ ID NO: 12: CTACAGCATCTCTCGGACGG) were amplified in cells not labeled with CD44 antibodies in both of two different cell lines (HeLa and A549). This is shown in FIG. Figure 3 middle.

[0101] Figure 3 This is a graph showing guide RNAs that were abundantly expressed in different cell lines after MACS using CD44 antibodies compared to cells that were not labeled with CD44 antibodies: Figure 3 a is a graph showing that guide RNA was expressed in large amounts in HeLa cell lines in cells that were not labeled with CD44 antibodies. Figure 3 b is a graph confirming that the guide RNA is abundantly expressed in the A549 cell line from cells not labeled with CD44 antibody.

[0102] like Figure 3 As shown, it was confirmed that the guide RNA targeting CD44 was abundantly expressed in cells not labeled with CD44 antibody.

[0103] This means that the antigen to which the antibody binds can be identified by confirming the guide RNA amplified in cells without antibody labeling and confirming the gene targeted by the amplified guide RNA.

[0104] Experimental Example 3. Antigen Identification for Anticancer Antibodies 3.1 Discovering novel antibodies derived from patients The novel antibodies S4-2 and S3-5 were discovered through the screening process of the patient-derived antibody library. Specifically, PBMCs were obtained from the blood obtained with the consent of the patients selected based on clinical information, RNA was purified from them, and then the cDNA library of antibodies prepared by the PCR method was obtained in a single-chain form and cloned into phagemid. The antibody library thus obtained was bound to cancer cells through phage display technology, thereby discovering novel antibodies that specifically bind.

[0105] 3.2 Antigen Identification for Anticancer Antibodies The same experiment as in Experimental Example 2 was performed on the anti-cancer antibodies S4-2 and S3-5 mined from the patient-derived antibody library. As a result, intercellular adhesion molecule 1 (ICAM-1) was identified as an antigen of the novel anti-cancer antibody. Figure 4 middle.

[0106] Figure 4 This is a graph showing that MACS was performed using anti-cancer antibodies S4-2 and S3-5 mined from a patient-derived antibody library as antibodies against Cas9 / guide RNA library cells, and that guide RNAs that were expressed in large amounts in cells not labeled with the anti-cancer antibodies S4-2 or S3-5 were confirmed compared to cells labeled with the anti-cancer antibodies S4-2 or S3-5: in, Figure 4 a is a graph confirming that guide RNA is abundantly expressed in cells in which anti-cancer antibody S4-2 mined from a patient-derived antibody library is not labeled. Figure 4 b is a graph confirming that the guide RNA is abundantly expressed in cells in which the anti-cancer antibody S3-5 mined from a patient-derived antibody library is not labeled.

[0107] like Figure 4As shown, in cells in which the anti-cancer antibodies S4-2 and S3-5 mined from a patient-derived antibody library were not tagged, it was confirmed that guide RNAs for guide sequences targeting ICAM-1 (SEQ ID NO: 13: TGACGTGTGCAGTAATACTG, SEQ ID NO: 14: GCCCGCTGAGGTCACGACCA, SEQ ID NO: 15: CGGGCTGTTCCCAGTCTCGG, SEQ ID NO: 16: TGCAGGGACTCCAGAACGGG, SEQ ID NO: 17: ACCAGCACGGAGCCTCCCCG, SEQ ID NO: 18: GCTCAGTTACTCACAGTACA) were abundantly expressed.

[0108] This means that ICAM-1 is an antigen for the anti-cancer antibodies S4-2 and S3-5.

[0109] 3.3 Confirmation of the binding of anticancer antibodies S4-2 and S3-5 to cell lines expressing ICAM1 In order to confirm whether the ICAM1 directly binds to the anti-cancer antibodies S4-2 and S3-5, the ICAM1-specific siRNA was treated, and the loss of the antibody binding ability was confirmed by flow cytometry (FACS: Fluorescence-activated cell sorting). In addition, immunoprecipitation-western blotting was used to verify whether ICAM1 directly binds to the anti-cancer antibodies S4-2 and S3-5. And, the results are shown in Figure 5 and Figure 6 middle.

[0110] [Table 2]

[0111] Figure 5 This is a graph showing that ICAM1-specific siRNA was treated in MDA-MB-468 cells and flow cytometry (FACS) was performed.

[0112] Figure 6 This is an image of immunoprecipitation-western blot performed on the HS578T breast cancer cell line expressing ICAM1.

[0113] like Figure 5 and 6 As shown, it was confirmed that the cell lines not expressing ICAM1 lost the ability to bind to the anti-cancer antibodies S4-2 and S3-5, and that the cell lines expressing ICAM1 bound to the anti-cancer antibodies S4-2 and S3-5.

[0114] 3.4 Confirmation of whether anticancer antibodies S4-2 and S3-5 bind directly to ICAM1 In order to confirm whether the anticancer antibodies S4-2 and S3-5 directly bind to ICAM1, purified ICAM1 was mixed with antibodies (IgG, 3-5, and 4-2) in vitro, and immunoprecipitation-Western blotting was performed. The results are shown in Figure 7 middle.

[0115] Figure 7 These are images showing the results of performing immunoprecipitation-Western blotting to confirm whether the anti-cancer antibodies S4-2 and S3-5 directly bind to ICAM1.

[0116] Figure 8 is a schematic diagram of a method for screening cell surface antigens.

[0117] like Figure 7 As shown, it was confirmed that both the anti-cancer antibodies S4-2 and S3-5 directly bind to ICAM1.

Claims

1. A method for screening cell surface antigens, comprising the following steps: The separated cells are treated with a vector into which a guide RNA (gRNA: guide RNA) library targeting a cell-surface protein of the cells is introduced; treating the vector-treated cells with a protein capable of binding to the separated cells; and Cells that have lost the ability to bind to the treated protein are obtained from the cells treated with the protein.

2. The method for screening cell surface antigens according to claim 1, wherein: The protein capable of binding to the cell is a protein that specifically binds to the cell-surface protein.

3. The method for screening cell surface antigens according to claim 2, wherein: The protein that specifically binds to the cell-surface protein is any one selected from the group consisting of an antibody, an affibody, and a bispecific antibody (diabody) without an Fc region.

4. The method for screening cell surface antigens according to claim 3, wherein: The antibodies are mined through a screening process of patient-derived antibody libraries.

5. The method for screening cell surface antigens according to claim 1, wherein: The cells are cancer cells.

6. The method for screening cell surface antigens according to claim 1, wherein: The cell includes a Cas9 nuclease.

7. The method for screening cell surface antigens according to claim 1, wherein: The vector is a viral vector.

8. The method for screening cell surface antigens according to claim 1, wherein: For cells treated with the vector, one vector is introduced into each cell.

9. The method for screening cell surface antigens according to claim 1, wherein: In the guide RNA library, each cell-surface-protein gene includes 1 to 10 guide RNAs.

10. The method for screening cell surface antigens according to claim 1, further comprising: analyzing the guide RNA in cells that have lost the ability to bind to the treated protein; as well as Identify the gene targeted by the guide RNA analyzed.

11. The method for screening cell surface antigens according to claim 1, wherein: The step of obtaining cells that lose the ability to bind to the treated protein comprises the following steps: treating beads having a surface bound to the treated protein with cells treated with the protein; and Cells not bound to the beads are obtained.

12. The method for screening cell surface antigens according to claim 10, further comprising the steps of: a control group of cells in which the gene targeted by the guide RNA to be analyzed is knocked down or knocked out; and The control group cells were treated with antibodies to measure whether antigen-antibody reaction occurred.

13. The method for screening cell surface antigens according to claim 12, wherein: The antigen-antibody reaction is measured using any one selected from the group consisting of enzyme immunoassay, radioimmunoassay, sandwich assay, Western blotting, immunoprecipitation, immunohistochemical staining, fluorescent immunoassay, enzyme substrate colorimetry, and antigen-antibody agglutination.

14. The method for screening cell surface antigens according to claim 1, wherein: The cell-surface-protein is a tumor-associated antigen (TAA).

Images