Quality control method for evaluating forensic case inspection material extraction and amplification

Abstract

The invention relates to the technical field of biology, in particular to a quality control method for evaluating forensic case sample extraction and amplification. The invention provides a quality control product which can be used for forensic detection material extraction and amplification quality control, the quality control product is plasmids respectively containing EQCS small fragments and EQCL large fragments, the quality control product is applied to forensic detection material extraction and detection quality control, the method is simple and reliable, the compatibility with an existing detection kit is high, and the quality control product has wide application prospects.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a quality control method for evaluating the extraction and amplification of forensic case samples. Background Art

[0002] The research and analysis object of forensic evidence detection DNA is mainly DNA polymorphism. Generally speaking, the location of a gene or non-coding region DNA marker on a chromosome is called a locus, and genes with different sequences at the same locus are called alleles. DNA polymorphism refers to the existence of multiple alleles at a locus that serves as a genetic marker. Analyzing the differences in alleles at a locus is the biological basis for achieving identity identification.

[0003] Common DNA samples in forensic evidence refer to cells shed from the suspect's mouth and skin after the human body comes into contact with items at the crime scene, as well as various secretions and excretions. In a series of criminal and civil cases such as burglary, intentional injury, rape, paternity testing, etc., a series of biological evidence such as blood stains, semen stains, bones, muscles, hair, saliva stains, urine stains, nails, sweat, fingerprints, etc. left at the crime scene can be used as materials (samples) for DNA identification. It can be seen that the identification conclusion based on DNA polymorphism can be used as strong evidence in many cases. However, in order to sample and identify DNA, it is required to obtain sufficient and sufficiently pure DNA samples.

[0004] DNA extraction and purification technology is the first and most important step in forensic DNA testing. However, the common nucleic acid extraction and purification kits for forensic case samples on the market do not contain internal quality control, and when the downstream test results are abnormal, it is impossible to determine the possible problems in the nucleic acid extraction process. Summary of the invention

[0005] In view of this, the technical problem to be solved by the present invention is to provide a quality control method for evaluating the extraction and amplification of forensic case samples.

[0006] The present invention provides a quality control fragment for extraction and amplification of forensic samples, which comprises an upstream fragment having a nucleotide sequence as shown in SEQ ID NO: 1, a downstream fragment having a nucleotide sequence as shown in SEQ ID NO: 2, and a random fragment located between the upstream fragment and the downstream fragment;

[0007] The random fragment has a homology with the human gene of less than 20%;

[0008] The random fragments include short fragments with a length of 6 to 35 nt and / or long fragments with a length of 300 to 650 nt.

[0009] Furthermore, in a specific embodiment of the present invention,

[0010] The nucleotide sequence of the short fragment is shown in SEQ ID NO: 3 (EQCS);

[0011] The nucleotide sequence of the long fragment is shown in SEQ ID NO: 4 (EQCL).

[0012] The present invention provides a quality control product, which includes the quality control product fragment of the present invention and a vector skeleton.

[0013] Furthermore, the vector backbone is derived from pUC57.

[0014] The present invention provides a quality control reagent, which comprises the quality control product and auxiliary materials described in the present invention.

[0015] Furthermore, the auxiliary materials are used to maintain the stability of the quality control product and / or prevent its degradation during storage, and the auxiliary materials include stabilizers, preservatives, buffers and / or antioxidants.

[0016] The present invention provides a kit, which includes the quality control product described in the present invention and / or at least one of the quality control reagents described in the present invention, an extraction reagent, an amplification reagent and / or an amplification primer.

[0017] Furthermore, the amplification primers include an upstream primer having a nucleotide sequence as shown in SEQ ID NO:7 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO:8.

[0018] The present invention provides the use of at least one of the following I) to IV) in the quality control and / or detection of forensic samples:

[0019] I), the quality control fragment of the present invention;

[0020] II), the quality control product of the present invention;

[0021] III), the quality control reagent of the present invention;

[0022] IV), the kit of the present invention.

[0023] The present invention provides a method for quality control and / or detection of forensic samples, which comprises using at least one of the following i) to iv) to perform quality control and / or detection on the forensic samples:

[0024] i), the quality control fragment of the present invention;

[0025] ii), the quality control product described in the present invention;

[0026] iii), the quality control reagent of the present invention;

[0027] iv), the kit of the present invention.

[0028] Specifically, the quality control and / or detection method comprises the following steps: after mixing the quality control product with the sample, extracting, amplifying and electrophoresing, and realizing the quality control and / or detection of the forensic sample according to the electrophoresis result. Furthermore, the electrophoresis is capillary electrophoresis.

[0029] The quality control product or quality control reagent or kit provided by the present invention can be used for the quality control of DNA extraction and PCR amplification involved in the forensic specimen detection process. EQCS and EQCL are extracted and amplified in the form of plasmids. The plasmids are stable DNA forms. When they are incorporated into a specific sample and extracted with the sample, the plasmids containing EQCS and EQCL can be extracted and amplified under normal circumstances. The success or failure of the DNA extraction and PCR reaction can be confirmed by checking whether there are EQCS and EQCL product peaks on the typing map. It can also be determined whether the DNA is degraded by evaluating the relative peak heights of EQCS and EQCL and the peak heights of different fragment sizes of the sample; in a specific extraction and amplification, the amplification characteristic peaks of the plasmids containing EQCS and EQCL and the peak heights of the characteristic peaks are used as controls to evaluate the quality of the sample DNA; specifically, the quality control product of the present invention is mixed into the extraction reagent, and then the quality control product is amplified and capillary electrophoresed together with the sample DNA, and the quality control and / or detection of the sample DNA is determined or realized according to the capillary electrophoresis results;

[0030] Specifically, the criteria for determining or implementing sample quality control (DNA extraction and quality) are:

[0031] If product peaks of EQCS and EQCL appear in the electrophoresis pattern and the EQC peak height is relatively consistent with the allele peak heights of each locus, DNA extraction is successful;

[0032] If no product peaks of EQCS and EQCL are detected in the electrophoresis spectrum, and no effective target peaks are detected at each locus, DNA extraction fails;

[0033] If product peaks of EQCS and EQCL appear in the electrophoresis spectrum, and the EQC peak height is relatively consistent, while the peak heights of each locus are high at the beginning and low at the end, or if there is a target peak at the small fragment locus but no target peak is detected at the large fragment, it can be inferred that the sample DNA is degraded.

[0034] In addition, the length and sequence of the EQCS and EQCL fragments described in the present invention are also obtained through screening, and the existing design length is skipped. For example, a plasmid sequence designed to be too small or too large may be unable to be detected by the capillary electrophoresis method; a sequence that is too similar to the sample sequence or has too high a GC content or hairpin structure will affect the amplification result. It has been found through experiments that the EQCS and EQCL described in the present invention have the best effect for quality control.

[0035] The quality control products used for forensic samples in the prior art can only indicate that the amplification process is normal, but cannot determine whether the sample does not contain DNA or whether the DNA is lost due to problems in the nucleic acid extraction process. The present invention provides quality control products that can be used for forensic sample extraction and PCR detection processes, and these two processes can be quality controlled at the same time; at the same time, the quality control products described in the present invention have high universality and a high degree of matching with common autosomal STR kits on the market; and the quality control process does not need to add additional detection methods or components, and can achieve extraction quality control and PCR detection quality control in the forensic DNA testing process.

[0036] The present invention provides quality control products that can be used for forensic sample extraction and amplification quality control. The quality control products contain plasmids of EQCS small fragment and EQC large fragment respectively. The quality control products are applied to the quality control of forensic sample extraction and detection. The method is simple and reliable, has high compatibility with existing detection kits, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 The Amelogenin primer sequences were published in the STRBase database;

[0038] Figure 2 Shows the results of X / Y chromosome gene homologous sequence comparison;

[0039] Figure 3 Schematic diagram of EQC plasmid sequence design is shown;

[0040] Figure 4 The figure shows the detection spectrum of EQC for Amelogenin primer verification. The red circles are the product peaks of EQCS (product peak position 60-90 bp) and EQCL (product peak position 350-700 bp).

[0041] Figure 5 NHID ®25A Case Kit (Liquid) Amplification map of the fluorescent dye group where the Amelogenin locus is located. The red circles are marked with the product peaks of EQCS (product peak position 60~90bp) and EQCL (product peak position 350~700bp); Among them, a is the standard DNA9948 map extracted by the Forensic DNA Magnetic Bead Extraction Kit (NH9547); b is the standard DNA9948 map extracted by the Forensic DNA Magnetic Bead Extraction Kit (NH9547) with EQC added; c is the negative control map extracted by the Forensic DNA Magnetic Bead Extraction Kit (NH9547); d is the negative control map extracted by the Forensic DNA Magnetic Bead Extraction Kit (NH9547) with EQC added;

[0042] Figure 6 Figure 2 shows the amplification map of the fluorescent dye group where the Amelogenin locus of the AmpFLSTR™ Identifiler™ Plus PCR Amplification Kit is located. The red circles are the product peaks of EQCS (product peak position 60~90bp) and EQCL (product peak position 350~700bp); a is the map of standard DNA9948 extracted by the Forensic DNA Magnetic Bead Extraction Kit (NH9547); b is the map of standard DNA9948 extracted by the Forensic DNA Magnetic Bead Extraction Kit (NH9547) with EQC added; c is the map of negative control extracted by the Forensic DNA Magnetic Bead Extraction Kit (NH9547); d is the map of negative control extracted by the Forensic DNA Magnetic Bead Extraction Kit (NH9547) with EQC added;

[0043] Figure 7 Figure 2 shows the amplification map of the fluorescent dye group where the VeriFiler™ Plus PCR Amplification Kit Amelogenin locus is located. The red circles are the product peaks of EQCS (product peak position 60~90bp) and EQCL (product peak position 350~700bp); a is the map of standard DNA9948 extracted by the Forensic DNA Magnetic Bead Extraction Kit (NH9547); b is the map of standard DNA9948 extracted by the Forensic DNA Magnetic Bead Extraction Kit (NH9547) with EQC added; c is the map of negative control extracted by the Forensic DNA Magnetic Bead Extraction Kit (NH9547); d is the map of negative control extracted by the Forensic DNA Magnetic Bead Extraction Kit (NH9547) with EQC added;

[0044] Figure 8Figure 2 shows the amplification map of the fluorescent dye group where the Amelogenin locus is located by Microreader™ 21 ID System. The red circles are the product peaks of EQCS (product peak position 60~90bp) and EQCL (product peak position 350~700bp); a is the map of standard DNA9948 extracted by the Forensic DNA Magnetic Bead Extraction Kit (NH9547); b is the map of standard DNA9948 extracted by the Forensic DNA Magnetic Bead Extraction Kit (NH9547) with EQC added; c is the map of negative control extracted by the Forensic DNA Magnetic Bead Extraction Kit (NH9547); d is the map of negative control extracted by the Forensic DNA Magnetic Bead Extraction Kit (NH9547) with EQC added;

[0045] Fig. 9 Figure 2 shows the amplification map of the fluorescent dye group where the Amelogenin locus of the AGCU EX28CS fluorescent detection kit is located. The red circles are the product peaks of EQCS (product peak position 60~90bp) and EQCL (product peak position 350~700bp); among them, a is the map of standard DNA9948 extracted by the Forensic DNA Magnetic Bead Extraction Kit (NH9547); b is the map of standard DNA9948 extracted by the Forensic DNA Magnetic Bead Extraction Kit (NH9547) with EQC added; c is the map of negative control extracted by the Forensic DNA Magnetic Bead Extraction Kit (NH9547); d is the map of negative control extracted by the Forensic DNA Magnetic Bead Extraction Kit (NH9547) with EQC added;

[0046] Fig.10 The STR test spectrum of the sample DNA was successfully extracted. The red circles are the product peaks of EQCS (product peak position 60~90bp) and EQCL (product peak position 350~700bp);

[0047] Fig.11 The STR test spectrum of the sample DNA extraction failure is shown. The red circles are the product peaks of EQCS (product peak position 60~90bp) and EQCL (product peak position 350~700bp);

[0048] Fig.12 The figure shows the STR detection spectrum of the degradation sample. The red circles are the product peaks of EQCS (product peak position 60~90bp) and EQCL (product peak position 350~700bp). DETAILED DESCRIPTION

[0049] The present invention provides a quality control method for evaluating the extraction and amplification of forensic case samples. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve it. It is particularly important to point out that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications of this article without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0050] Internal quality control product: An artificially designed nucleic acid sequence that participates in the nucleic acid extraction or amplification process and is used to evaluate the extraction or amplification process (hereinafter referred to as internal quality control).

[0051] Standard DNA 9948: is a commonly used human DNA sample with known concentration and DNA typing. It is a commonly used standard DNA in the field of forensic DNA testing.

[0052] The test materials used in the present invention are all common commercial products and can be purchased on the market. The present invention is further described below in conjunction with the embodiments:

[0053] Example 1 Solution of the present invention

[0054] 1. Summary of the Invention

[0055] 1. Design EQC plasmid sequence

[0056] Tooth enamel contains amelogenin, and the gene encoding this protein is located on the sex chromosomes, the X chromosome and the Y chromosome. Females with XX sex chromosomes have only X-type amelogenin in their teeth; males with XY sex chromosomes have both X-type and Y-type amelogenin, so the Amelogenin locus is often used to assist in determining the gender of samples in forensic DNA testing. According to the primer sequence of the Amelogenin locus published in the STRBase database ( Figure 1 ), find the corresponding sequences on chromosome X and chromosome Y in the human genome of NCBI, and perform homologous sequence comparison analysis. The comparison results are as follows Figure 2 shown.

[0057] Therefore, the EQC sequence (EQCS and EQCL) designed in the present invention is to insert a random sequence (Nm, Nn) into the Amelogenin enamel gene sequence (including upstream and downstream sequences), and the sequence contains the Amelogenin locus primer binding region ( Figure 3 ), that is:

[0058] EQCS sequence: Upstream sequence-N m- downstream sequence;

[0059] EQCL sequence: Upstream sequence-N n - downstream sequence;

[0060] N m and N n is an inserted random sequence, the nucleotides of the upstream sequence are: cttcagctatgaggtaatttttctctttactaattttgaccattgtttgcgttaacaatgccctgggctctgtaaagaatagtgtgt (SEQ ID NO: 1), and the nucleotides of the downstream sequence are: caccagcttcccagtttaagctctgatggttggcctcaagcctgtgt (SEQ ID NO: 2); wherein, the number of bases represented by m ranges from 6 to 35 nt, and the number of bases represented by n ranges from 300 to 650 nt.

[0061] Then, the EQCS sequence and EQCL sequence were integrated into the pUC57 vector to obtain the EQCS plasmid and EQCL plasmid, respectively;

[0062] 2. Extraction: Use the Forensic DNA Magnetic Bead Extraction Kit (NH9547) of Suzhou Xinhai Biotechnology Co., Ltd. for extraction. The steps are as follows:

[0063] Place the sample in a cannula, add 400 μL lysis solution, 10 μL proteinase K, and 10 μL EQC working solution, mix well; heat and shake at 800 rpm, 56°C for 30 min. Centrifuge at 12000 rpm for 3 min; remove the carrier and cannula, and transfer all the liquid to a new 1.5 mL centrifuge tube. Subsequent binding, rinsing, and elution were performed according to the instructions of the kit (EQC working solution includes 0.16 ng / mL EQCS plasmid and 2.4 ng / mL EQCL plasmid).

[0064] 3. Amplification: Use common autosomal STR amplification kits on the market and perform amplification according to the instructions.

[0065] 4. Electrophoresis detection: Use ABI3500xL genetic analyzer for analysis, mix formamide and molecular weight internal standard in a ratio of 10:0.2, take 9 μL of formamide internal standard mixture and 1 μL of PCR product for electrophoresis detection.

[0066] 5. Data analysis: GeneMapper ID-X software was used for data analysis.

[0067] 6. Internal quality control evaluation

[0068] The corresponding EQC product peaks were detected at the 60-90 bp position and the 350-700 bp position in the fluorescent marker group where the Amelogenin gene locus is located, proving that the extraction and amplification process was normal.

[0069] Second, the specific design of the present invention is as follows:

[0070] Design and verify the internal quality control product EQC sequence and application. The specific steps include:

[0071] 1. Design and synthesize the EQC plasmid sequence, insert a random sequence N between the upstream sequence of the nucleotide sequence of the Amelogenin enamel gene sequence as shown in SEQ ID NO: 1 and the downstream sequence as shown in SEQ ID NO: 2 m or N n Obtain EQCS or EQCL, the sequence includes the Amelogenin locus primer binding region of the common kit on the market, wherein,

[0072] N m The nucleotide sequence is: tacgtccgccacggac (SEQ ID NO: 3);

[0073] N n The nucleotide sequence is: atctctacagttgtgagggtatgtcatacccatgctcgaagtttggttcaccaacactccgacgagtgcatctcacacaagcctgtgatgcactaattcagtaacaggccggtgttctga cgctgtcatctatgttggcgtcgcacgctgggctcactccggcgtaaagattgcccacgagtacagccaagcgagtgttgtgactcagatacatcgcacagacaggatccactcgctactggagagat cagcacatatctaagtgatcatgtgtgctctcatgtgcctatataaggcaagtaatacggcaatcaatccacgagaccttgcggaactcctgttatctttgcgagcgtaatagtctctccatacagtt cgggccctaaatcgagctgtagcgtccactagtccacaaatccgtatcgtccgccacttcaatagaaacactctcgaggctaaatatcgccgttgctaatattcaccgaaactatcgcagcacg (seq IDNO:4);

[0074] The specific sequence after insertion is as follows:

[0075] EQCS(N m =16nt):cttcagctatgaggtaatttttctctttactaattttgaccattgtttgcgttaacaatgccctgggctctgtaaagaatagtgtgt tacgtccgccacggac caccagcttcccagtttaagctctgatggttggcctcaagcctgtgt (SEQ ID NO: 5), wherein the underlined portion is N m Random sequence;

[0076] EQCL(N n =500nt): cttcagctatgaggtaatttttctctttactaattttgaccattgtttgcgttaacaatgccctgggctctgtaaagaatagtgtgt atctctacagttgtgagggtatgtcatacccatgctcgaagt ttggttcaccaacactccgacgagtgcatctcacacaagcctgtgatgcactaattcagtaacaggccggtgttct gacgctgtcatctatgttggcgtcgcacgctgggctcactccggcgtaaagattgcccacgagtacagccaagcga gtgttgtgactcagatacatcgcacagacaggatccactcgctactggagagatcagcacatatctaagtgatcat gtgtgctctcatgtgcctatataaggcaagtaatacggcaatcaatccacgagaccttgcggaactcctgttatct ttgcgagcgtaatagtctctccatacagttcgggccctaaatcgagctgtagcgtccactagtccacaaatccgta tcgtccgccacttcaatagaaacactctcgaggctaaatatcgccgttgctaatattcaccgaaactatcgcagca cg caccagcttcccagtttaagctctgatggttggcctcaagcctgtgt (SEQ ID NO: 6), wherein the underlined portion is N n Random sequence;

[0077] Then, the EQCS sequence and EQCL sequence were integrated into the pUC57 vector to obtain the EQCS plasmid and EQCL plasmid, respectively;

[0078] Amelogenin primer sequences:

[0079] F: 5'-ccctgggctctgtaaagaatag-3' (SEQ ID NO:7);

[0080] R: 5'-atcagagcttaaactgggaagct-3' (SEQ ID NO: 8);

[0081] 2. Preparation of amplification system

[0082] (1) Preparation of EQC working solution: 2 μg EQCS plasmid powder was added to 1×Low TE and diluted to 0.04 ng / μL (EQCS plasmid solution); 2 μg EQCL plasmid powder was added to 1×Low TE and diluted to 0.04 ng / μL (EQCL plasmid solution); 2 μL of 0.04 ng / μL EQCS plasmid solution and 3 μL of 0.04 ng / μL EQCL plasmid solution were added to 495 μL 1×Low TE for later use (the concentration of EQCS plasmid is 0.16 ng / mL and the concentration of EQCL plasmid is 2.4 ng / mL).

[0083] (2) Mix all reaction components by oscillation to prepare PCR reaction solution. The total volume of the amplification system is 10 μL, including 1 μL of primer mixture (10× Primer Mix), 2 μL of reaction buffer (5× PCR Mix), 1 μL of 0.5 ng / μL 9948 standard DNA (standard DNA 9948), 1 μL of EQC working solution, and 5 μL of 1× Low TE to obtain the amplification system.

[0084] 3. Amplification

[0085] The amplification system of step 2 was subjected to the following amplification procedure: first step denaturation: 95°C, 1 minute; thermal cycle: 95°C, 10 seconds; 60°C, 90 seconds, for a total of 29 cycles; final extension at 60°C, 10 minutes; incubation at 4°C to amplify and obtain the amplified product.

[0086] 4. Fragment analysis by capillary electrophoresis

[0087] The amplified product was detected by capillary electrophoresis. Formamide and molecular weight internal standard were mixed at a volume ratio of 100:2, 9 μL of the mixture was added to a 96-well plate, and then 1 μL of the amplified product was added. After mixing and centrifugation, the plate was placed on the ABI3500 genetic analyzer for detection.

[0088] 5. Data Analysis

[0089] GeneMapper™ ID-X software was used to analyze the data and generate maps. Figure 4 It can be seen that the internal quality control product EQC provided in this embodiment can work normally.

[0090] Example 2 The matching degree between the internal quality control product EQC of the present invention and the common autosomal STR kits on the market

[0091] The specific steps include:

[0092] 1. DNA acquisition

[0093] The forensic DNA magnetic bead extraction kit (NH9547) from Suzhou Xinhai Biotechnology Co., Ltd. was used.

[0094] Take 5μL of 10ng / μL 9948 standard DNA and add it to a 1.5mL centrifuge tube. Add 400μL lysis solution, 10μL proteinase K, and 10μL EQC working solution, mix well; heat and shake at 800rpm, 56℃ for 30min. Centrifuge at 12000rpm for 3min; remove the carrier and sleeve, and transfer all the liquid to a new 1.5mL centrifuge tube. Subsequent binding, rinsing, and elution were carried out according to the instructions of the NH9547 kit.

[0095] 2. Amplification

[0096] Use common kits on the market (NHID ® 25A Case Kit (Liquid), AmpFLSTR™ Identifiler™ Plus PCR Amplification Kit, VeriFiler™ Plus PCR Amplification Kit, Microreader™ 21ID System, AGCU EX28CS Fluorescence Detection Kit), and amplification was performed according to the instructions.

[0097] 3. Fragment analysis by capillary electrophoresis

[0098] The amplified product was detected by capillary electrophoresis. Formamide and molecular weight internal standard were mixed at a volume ratio of 100:2, 9 μL of the mixture was added to a 96-well plate, and then 1 μL of the amplified product was added. After mixing and centrifugation, the plate was placed on the ABI3500 genetic analyzer for detection.

[0099] 4. Data Analysis

[0100] GeneMapper™ ID-X software was used to analyze the data and generate maps. Figures 5 to 9 , for NHID ®25A Case Kit (Liquid), AmpFLSTR™ Identifiler™ Plus PCR Amplification Kit, VeriFiler™ Plus PCR Amplification Kit, Microreader™ 21 ID System, AGCU EX28CS Fluorescence Detection Kit Amelogenin locus amplification map of the fluorescent dye group. As can be seen from the figure, through the comparative analysis of the traditional forensic DNA magnetic bead extraction kit (NH9547) and the forensic DNA magnetic bead extraction kit with added EQC (NH9547), it can be seen that the quality control method for evaluating the extraction and amplification of forensic case samples is highly compatible with the common autosomal STR detection kits on the market.

[0101] Example 3 Evaluation of DNA extraction and amplification process of forensic case samples by internal quality control product EQC of the present invention

[0102] The internal quality control product EQC of the present invention evaluates the DNA extraction and amplification process of forensic case samples as follows:

[0103] 1. Sample acquisition

[0104] The forensic DNA magnetic bead extraction kit (NH9547) from Suzhou Xinhai Biotechnology Co., Ltd. was used.

[0105] Place the sample in a cannula, add 400 μL lysis solution, 10 μL proteinase K, and 10 μL EQC working solution, mix well; heat and shake at 800 rpm, 56°C for 30 min. Centrifuge at 12000 rpm for 3 min; remove the carrier and cannula, and transfer all the liquid to a new 1.5 mL centrifuge tube. Subsequent binding, rinsing, and elution were performed according to the instructions of the NH9547 kit.

[0106] 2. Amplification

[0107] Using NHID ® 25A case kit (liquid) and amplify according to the instructions.

[0108] 3. Fragment analysis by capillary electrophoresis

[0109] The amplified product was detected by capillary electrophoresis. Formamide and molecular weight internal standard were mixed at a volume ratio of 100:2, 9 μL of the mixture was added to a 96-well plate, and then 1 μL of the amplified product was added. After mixing and centrifugation, the plate was placed on the ABI3500 genetic analyzer for detection.

[0110] 4. Data Analysis

[0111] GeneMapper™ ID-X software was used to analyze the data and generate a profile. Figures 10-12 When DNA extraction is successful, product peaks of EQCS and EQCL appear in the electrophoresis spectrum, and the EQC peak height is relatively consistent with the allele peak height of each locus, such as Fig.10 ; When DNA extraction fails, no product peaks of EQCS and EQCL are detected in the electrophoresis spectrum, and no effective target peaks are detected at each locus, such as Fig.11 If product peaks of EQCS and EQCL appear in the electrophoresis spectrum, and the EQC peak height is relatively consistent, while the peak heights of each locus are high at the beginning and low at the end, or if there is a target peak at the small fragment locus but no target peak is detected at the large fragment, it can be inferred that the sample DNA is degraded.

[0112] Therefore, the results shown in the figure indicate that when the test results of the common STR amplification kits currently used for forensic case samples are abnormal, it is impossible to determine the possible problems in the nucleic acid extraction process. The extraction quality control product EQC in the extraction process can confirm the success or failure of DNA extraction and PCR reaction by detecting EQCS and EQCL product peaks on the electrophoresis spectrum, and the relative peak heights of EQCS and EQCL together with STR typing can infer the degree of DNA sample degradation.

[0113] The above are only preferred embodiments of the present invention. It should be pointed out that, for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A quality control fragment for the extraction and amplification of forensic samples, characterized in that: comprising an upstream segment having a nucleotide sequence as shown in SEQ ID NO: 1, a downstream segment having a nucleotide sequence as shown in SEQ ID NO: 2, and a random segment located between the upstream segment and the downstream segment; The random fragment has a homology with the human gene of less than 20%; The random fragments include short fragments with a length of 6 to 35 nt and / or long fragments with a length of 300 to 650 nt.

2. The quality control fragment according to claim 1, characterized in that: The nucleotide sequence of the short fragment is shown in SEQ ID NO: 3; The nucleotide sequence of the long fragment is shown in SEQ ID NO:

4.

3. Quality control products, characterized in that: It comprises the quality control product fragment and the vector skeleton as described in claim 1 or 2.

4. The quality control product according to claim 3, characterized in that: The vector backbone is derived from pUC57.

5. A quality control reagent, characterized in that: Including the quality control product and auxiliary materials described in claim 3 or 4.

6. The quality control reagent according to claim 5, characterized in that: The auxiliary materials include stabilizers, preservatives, buffers and / or antioxidants.

7. A kit, characterized in that It comprises at least one of the quality control product described in claim 3 or 4 and / or the quality control reagent described in claim 5 or 6, an extraction reagent, an amplification reagent and / or an amplification primer.

8. Application of at least one of the following I) to IV) in quality control and / or testing of forensic samples: I), the quality control fragment according to claim 1 or 2; II), the quality control product according to claim 3 or 4; III), the quality control reagent according to claim 5 or 6; IV), the kit according to claim 7.

9. A method for quality control and / or detection of forensic samples, characterized in that: The method comprises the following steps of: performing quality control and / or testing on forensic samples using at least one of the following i) to iv): i), the quality control fragment according to claim 1 or 2; ii) The quality control product according to claim 3 or 4; iii) The quality control reagent according to claim 5 or 6; iv) The kit according to claim 7.

10. The quality control and / or detection method according to claim 9, characterized in that: The method comprises the following steps: mixing the quality control product with the sample, extracting, amplifying and electrophoresing the sample, and achieving quality control and / or detection of the sample according to the electrophoresis result.

Images