KASP marker related to thousand seed weight of wheat and application of KASP marker

Abstract

The invention relates to the technical field of gene engineering, and discloses a KASP marker related to thousand seed weight of wheat and application of the KASP marker. The SNP locus is located at the 33397938bp position of the wheat 1A chromosome, and the polymorphism is C / T. Through phenotypic difference and exon capture analysis, the SNP site closely related to the thousand seed weight is determined, and a specific KASP primer combination is designed, so that rapid and accurate identification of the wheat thousand seed weight is realized. The application of the technology has significant significance in accelerating high-yield breeding of wheat. According to the method, the selection efficiency is improved, the breeding period is shortened, and wheat varieties with ideal thousand seed weight can be quickly identified and cultivated. By using the KASP primer combination, an effective tool is provided for molecular marker-assisted selection of wheat yield-related traits, and the overall yield and quality of crops can be improved.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, in particular to a KASP marker related to wheat thousand-grain weight and an application thereof. Background Art

[0002] wheat( Triticum aestivum L.) is a widely planted food crop in the world. Its abundant planting area and high yield have a significant impact on food security. Thousand-grain weight, the weight of one thousand grains of wheat, is a key indicator for measuring the fullness and potential yield of wheat. It not only affects the plant shape and lodging resistance of wheat, but is also directly related to the final yield and quality. Therefore, improving the thousand-grain weight of wheat is one of the important goals in breeding and agricultural production.

[0003] Exome sequencing is a technical means to discover genetic mutations related to protein functional variation by capturing and enriching DNA in the exon region of the whole genome using sequence capture technology, and then sequencing it through high-throughput sequencing. Compared with whole genome sequencing, exome sequencing is more economical and efficient, and has great advantages in studying known SNPs, InDels, etc. KASP (Kompetitive Allele Specific PCR) technology is a molecular marker method based on SNP sites, which is highly favored in genotyping for its high stability, accuracy and economy. It is particularly suitable for high-throughput analysis, especially when a large number of samples need to be processed but there are fewer available SNP sites. The application of KASP technology not only improves the speed and efficiency of genotyping, but also reduces costs, making it have broad application prospects in agricultural breeding, genetic research and molecular diagnosis. Summary of the invention

[0004] The purpose of the present invention is to provide a KASP marker related to wheat thousand-grain weight and application thereof.

[0005] To achieve the purpose of the present invention, in a first aspect, the present invention provides a KASP marker associated with wheat thousand-grain weight, which is a SNP molecular marker associated with plant thousand-grain weight, and the marker contains a nucleotide sequence with a polymorphism of C / T at 33397938 bp of wheat chromosome 1A.

[0006] Furthermore, the plant with the genotype of the polymorphic site contained in the marker being TT has a higher thousand-grain weight than the plant with the genotype being CC.

[0007] In a second aspect, the present invention provides a KASP primer combination for amplifying the marker, comprising forward primer 1 (GCAGCAGCTGGCCGCGGCG) as shown in SEQ ID NO: 1, forward primer 2 (GCAGCAGCTGGCCGCGGCA) as shown in SEQ ID NO: 2, and reverse primer (AGCTATAGGTTGGAGGTAGTATA) as shown in SEQ ID NO: 3.

[0008] Furthermore, the 5′ ends of the forward primer 1 and the forward primer 2 in the KASP primer combination may also be connected to a fluorescent marker sequence, such as FAM (GAAGGTGACCAAGTTCATGCT) or HEX (GAAGGTCGGAGTCAACGGATT).

[0009] In a specific embodiment of the present invention, the KASP primer combination is as follows: 33397938-F1: 5'-GAAGGTGACCAAGTTCATGCTTGCAGCAGCTGGGCCGCGGCG-3'; (SEQ ID NO: 4) 33397938-F2: 5'-GAAGGTCGGAGTCAACGGATTTGCAGCAGCTGGCCGCGGCA-3'; (SEQ ID NO: 5) 33397938-R: 5'-AGCTATAGGTTGGAGGTAGTATA-3' (SEQ ID NO: 3).

[0010] In a third aspect, the present invention also provides a detection reagent or a kit containing the primer combination.

[0011] In a fourth aspect, the present invention provides a method for identifying the thousand-grain weight (height, size) of a plant, comprising: using the DNA of a plant sample to be tested as a template, using the KASP primer combination or the detection reagent or kit to perform PCR amplification, and judging the thousand-grain weight of the plant sample to be tested according to the amplification result.

[0012] Preferably, based on a total system of 10 μL, the system used for PCR amplification includes: 4-6 μL of 2×KASP Mix, 0.12-0.16 μL of primer mixture, 25-35 ng of DNA template, and the remainder is water.

[0013] The primer mixture, calculated as 100 μL, includes: 100 μM forward primer 1 10-14 μL, 100 μM forward primer 2 10-14 μL, 100 μM reverse primer 28-32 μL, and the remainder is water.

[0014] Preferably, the reaction program used for PCR amplification is: 95°C 8-12 min; 95°C 15-25 s, 61°C 60 s, 8-12 cycles, with the annealing temperature decreasing by 0.5°C-0.7°C in each cycle; 95°C 15-25 s, 55°C 35-45 s, 32-36 cycles; 25°C 10-20 min.

[0015] Furthermore, judging the thousand-grain weight of the plant sample to be tested according to the amplification result includes: analyzing the genotype of the polymorphic site contained in the marker in the amplification product, and the plant with the genotype of TT has a higher thousand-grain weight than the plant with the genotype of CC.

[0016] Furthermore, the plant is wheat.

[0017] In a fifth aspect, the present invention provides any of the following applications of the marker, the marker combination, or the detection reagent or kit: (1) Used for identification, breeding and improvement of wheat thousand-grain weight; (2) Used for early prediction of wheat thousand-grain weight; (3) Used in wheat molecular marker-assisted breeding; (4) Used for screening or cultivating high-yield plants.

[0018] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects: (I) The present invention successfully identified a SNP site closely related to plant thousand-grain weight through phenotypic difference analysis and exon capture sequencing technology. The polymorphism detection of this site can accurately and quickly evaluate the thousand-grain weight characteristics of plants.

[0019] (II) Using KASP technology, the SNP sites and corresponding primer combinations provided by the present invention not only improve the efficiency of plant variety selection, but also help shorten the breeding cycle and accelerate the cultivation of high-quality plant varieties. These markers have good genetic stability and high resolution, are suitable for high-throughput detection, and have significant application value in the field of plant breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 The exon capture sequencing technology provided in Example 1 of the present invention is obtained by analysis TraesCS1A02G052000 Gene exon SNP site map.

[0021] Figure 2 It is a statistical chart of thousand-grain weight of different genotypes at locus 33397938 of chromosome 1A provided in Example 2 of the present invention.

[0022] Figure 3It is the typing result of the wheat genotype at the 33397938 site of chromosome 1A provided in Example 2 of the present invention; wherein CC represents 33397938-C, TT represents 33397938-T, and CK represents a no-template control, that is, ultrapure water is used instead of sample DNA.

[0023] Figure 4 This is the sequencing peak diagram of different genotypes of the 1A chromosome 33397938 site provided in Example 2 of the present invention. The gene is negative in the genome, and the sequencing result is positive sequencing, that is: CG, AT. DETAILED DESCRIPTION

[0024] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0025] The wheat varieties (lines) involved in the following examples were all provided by Researcher Zhang Xueyong of the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences. The wheat was sown in Xinxiang, Henan Province, harvested after physiological maturity, naturally dried and used for subsequent analysis.

[0026] It should be noted that, as a professional agricultural research institution, the applicant has long preserved relevant germplasm materials, and the relevant wheat varieties are publicly available on the market or in existing germplasm banks.

[0027] Example 1 Acquisition of SNP markers associated with plant thousand-grain weight and design of KASP primers 1. 111 exon capture sequencing The whole exome sequencing process mainly includes the following four main steps: 1) Sample testing: Before DNA sequencing, the quality and quantity of the sample DNA must be ensured by agarose gel electrophoresis and nanodrop detection. The DNA concentration must be no less than 20ng / ul and the total amount must be no less than 800ng to ensure the accuracy and repeatability of sequencing.

[0028] 2) Library construction: Use Covaris fragmentor to randomly break genomic DNA into 180-280bp fragments. Then, use Agilent SureSelect kit to complete DNA end repair, phosphorylation, and poly A tailing. Liquid phase hybridization is used to enrich the exon region, and biotin-labeled probes are used for specific hybridization with libraries with specific indexes, followed by PCR amplification. Finally, the amplified library is quality tested to ensure that the quality of the library meets the standards before sequencing.

[0029] 3) Library inspection: After the library is constructed, Qubit 2.0 is used for preliminary quantification. Then, the Agilent 2100 bioanalyzer detects the inserted fragments to ensure that the size is appropriate. After passing the test, the effective concentration of the library is accurately quantified to 3nmol / L by Q-PCR to ensure the quality and accuracy of the sequencing library.

[0030] 4) Sequencing: After the library is qualified, PE150 sequencing is performed using the Illumina HiSeq platform according to the effective concentration of the library and data requirements. PE150 is double-end sequencing, with 150bp reads at each end. High-throughput sequencing is performed using the insert fragments of the small fragment library to facilitate subsequent sequence comparison and analysis, and improve the accuracy and reliability of the data.

[0031] 2. Obtaining thousand-grain weight of different wheat and developing SNP molecular markers To screen for key genes affecting thousand-grain weight in wheat, we first measured thousand-grain weight in 111 wheat varieties to assess their phenotypic variation. This basic data collection is the first step in understanding the genetic background of thousand-grain weight. The results are shown in Table 1, laying the foundation for further genetic analysis and breeding research.

[0032] Based on the 111 thousand-grain weight phenotype data obtained in step 2, combined with the exon capture sequencing analysis results, the contribution of SNP sites of important genes to thousand-grain weight was explored, and a single nucleotide polymorphism (SNP) was screened on chromosome 1A of the wheat genome. TraesCS1A02G052000 There is a SNP site in the gene exon, and the SNP variation of this site significantly increases the thousand-grain weight. The significant site affecting the thousand-grain weight of wheat was identified (1A: 33397938 bp) (part of the results are shown in Figure 1 ), and the site was named: 33397938. It should be noted that the gene is in the negative direction in the genome, and the designed sequencing and KASP primers are all positive sequences.

[0033] Based on the above sequence differences and the KASP principle, a primer set for PCR amplification to obtain the wheat molecular marker was further developed and designed. The specific design is as follows: 33397938-F1: 5'-GAAGGTGACCAAGTTCATGCTTGCAGCAGCTGGCCGCGGCG -3', (the 5' end "GAAGGTGACCAAGTTCATGCT" part of the sequence is the FAM tag sequence) 33397938-F2: 5'-GAAGGTGACCAAGTTCATGCTTGCAGCAGCTGGCCGCGGCA-3', (the 5' end "GAAGGTCGGAGTCAACGGATT" part of the sequence is the HEX tag sequence) 33397938-R: 5'- AGCTATAGGTTGGAGGTAGTATA -3'; When 33397938-F1 and 33397938-R are used as a primer pair combination, it is used to amplify the sequence with the base C at the 33397938 position of chromosome 1A in the wheat molecular marker; When 33397938-F2 and 33397938-R are used as a primer pair combination, they are used to amplify the sequence with the base T at the 33397938 position of chromosome 2A in the wheat molecular marker.

[0034] Example 2 Application of SNP markers in identifying wheat thousand-grain weight 1. Based on the primer pair design of Example 1, the present invention detected the genotypes of 111 wheat materials (30 CC / 20 TT), and identified the correlation between the genotype and the 1000-grain weight phenotype. The specific process is as follows: First, genomic DNA of each wheat variety was extracted; Then, according to the primers designed in Example 1, the above extracted DNA was used as a template to perform PCR (using Quant Studio 1 fluorescent quantitative PCR instrument) detection and analysis on different wheat samples.

[0035] During specific PCR amplification, the 10 μL amplification system was designed as follows: KASP Mix (2×), 5 μL (i.e., HiGeno 2× Probe Mix (provided at 2× concentration), containing Taq DNA polymerase, universal fluorescent reporter probe, dNTP, buffer, MgCl2, and reference dye ROX); Primer Mix, 0.14 μL; DNA, 30 ng; Add ddH2O to 10 μL.

[0036] Wherein, the Primer Mix, per 100 μL: 33397938-F1, 100 μM, 12 μL; 33397938-F2, 100 μM, 12 μL; 33397938-R, 100 μM, 30 μL; ddHO, 46 μL.

[0037] The PCR reaction program (which can be adjusted appropriately according to the amplification results) is: 95℃ for 10 min; 95℃ for 20 s, 61℃ for 60 s (10 cycles, decreasing by 0.6℃ each cycle); 95℃ for 20 s, 55℃ for 40 s, 34 cycles; 25℃ for 15 min.

[0038] 2. Use the genomic DNA of each wheat variety extracted in step 1 to perform conventional PCR and sequencing to verify the accuracy of KASP genotyping.

[0039] First, specific primers were designed for amplification at 33397938 bp of wheat chromosome 1A (the reference sequence was Chinese spring wheat). The primer sequences were: WAF: 5'-GCCTATAATAACCCCTGCCCA-3' WAR: 5'- TGCTGCAGCAGCGGAGGAGGC-3' Eight wheat varieties with GG / AA genotypes according to KASP genotyping results were randomly selected, amplified using a common PCR instrument, and sequenced after electrophoresis detection to verify the reliability of the genotyping results.

[0040] During specific PCR amplification, the 25 μL amplification system was designed as follows: Bio-Gold 2×EasyTaq® PCR SuperMix for PAGE (+dye), 10 μL; 10 μM primers WAF / WAR, 1 μL each; DNA, 60 ng; Add ddH2O to 25 μL.

[0041] The PCR reaction program (which can be adjusted appropriately according to the amplification results) is: 94℃ for 5 min; 94℃ for 30 s, 58℃ for 30 s, 72℃ for 40 s (35 cycles); 72℃ for 10 min; end at 16℃.

[0042] The specific genotypes and wheat thousand-grain weight statistics are shown in Tables 1-3 and Figure 1-Figure 4 shown.

[0043] Table 1 Correspondence between different wheat genotypes and their thousand-grain weight

[0044] Table 2 Correspondence between different wheat genotypes and their thousand-grain weight

[0045] Table 3 Correspondence between different wheat genotypes and their thousand-grain weight

[0046] From the above experimental results, it can be seen that the average thousand-grain weight of CC genotype wheat is 33.163 g; the average thousand-grain weight of TT genotype wheat is 45.132 g. The thousand-grain weight of TT genotype wheat is significantly higher than that of CC genotype wheat, increasing by 36.09%, with a significant difference at the p<0.01 level. In other words, the thousand-grain weight of CC genotype wheat is significantly lower than that of TT genotype wheat.

[0047] The present invention can accurately determine the 1000-grain weight trait of wheat by detecting specific SNP sites through carefully designed primers. This technology not only provides accurate genotype information for molecular breeding, but also helps to quickly screen wheat varieties with ideal 1000-grain weight. In addition, the technology and theoretical support of the present invention have made significant technical contributions to the development of high-yield wheat varieties, promoting agricultural scientific and technological progress and increasing crop yields.

[0048] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. A KASP marker associated with wheat thousand-grain weight, characterized in that: The marker is a SNP molecular marker associated with plant thousand-grain weight, and contains a nucleotide sequence with a polymorphism of C / T at 33397938 bp of wheat chromosome 1A.

2. The marking according to claim 1, characterized in that Plants with a genotype of TT at the polymorphic site contained in the marker have a higher thousand-grain weight than plants with a genotype of CC.

3. A KASP primer combination for amplifying the marker according to claim 1 or 2, characterized in that: It includes a forward primer 1 as shown in SEQ ID NO: 1, a forward primer 2 as shown in SEQ ID NO: 2, and a reverse primer as shown in SEQ ID NO:

3.

4. A detection reagent or kit containing the primer combination according to claim 3.

5. A method for identifying plant thousand-grain weight, characterized in that: include: Using the DNA of the plant sample to be tested as a template, PCR amplification is performed using the KASP primer combination described in claim 3 or the detection reagent or kit described in claim 4, and the thousand-grain weight of the plant sample to be tested is determined according to the amplification result.

6. The method according to claim 5, characterized in that Based on a total system of 10 μL, the system used for PCR amplification includes: 2×KASP Mix 4-6 μL, primer mixture 0.12-0.16 μL, DNA template 25-35 ng, and the remainder is water; The primer mixture, calculated as 100 μL, includes: 100 μM forward primer 1 10-14 μL, 100 μM forward primer 2 10-14 μL, 100 μM reverse primer 28-32 μL, and the remainder is water.

7. The method according to claim 6, characterized in that The reaction program used for PCR amplification was as follows: 95°C for 8-12 min; 95°C for 15-25 s, 61°C for 60 s, for 8-12 cycles, with the annealing temperature decreasing by 0.5°C-0.7°C in each cycle; 95°C for 15-25 s, 55°C for 35-45 s, for 32-36 cycles; 25°C for 10-20 min.

8. The method according to claim 6 or 7, characterized in that: Determining the thousand-grain weight of the plant sample to be tested according to the amplification result includes: analyzing the genotype of the polymorphic site contained in the marker in the amplification product, and the plant with the genotype of TT has a higher thousand-grain weight than the plant with the genotype of CC.

9. The method according to any one of claims 5 to 8, characterized in that: The plant is wheat.

10. Any of the following uses of the marker according to claim 1 or 2, the KASP primer combination according to claim 3, or the detection reagent or kit according to claim 4: (1) Used for identification, breeding and improvement of wheat thousand-grain weight; (2) Used for early prediction of wheat thousand-grain weight; (3) Used in molecular marker-assisted breeding of wheat.

Images