Recombinant vector for regulating expression of target gene by promoter as well as construction method and application of recombinant vector

Abstract

The invention provides a recombinant vector for regulating expression of a target gene by a promoter, and a construction method and application of the recombinant vector. The recombinant vector comprises a promoter and tag protein, the promoter is one of an hsyn promoter, a CMV promoter, a 1.2 kb NSE promoter and a CaMKII alpha promoter, and the tag protein is a Myc tag. According to the present invention, the recombinant vector containing the hsyn promoter, the CMV promoter, the 1.2 kb NSE promoter and the CaMKII alpha promoter can successfully drive the stable expression of the target gene (Prickle1 gene or Prickle2 gene) in the hippocampal neuron so as to provide the positive significance for the exploration of the effect of the Prickle protein in the neuron function.

Description

Technical Field

[0001] The present invention relates to the field of gene engineering technology, and in particular to a recombinant vector for regulating the expression of a target gene by a promoter, and a construction method and application thereof. Background Art

[0002] The planar cell polarity (PCP) signaling pathway is an important mechanism for regulating cell polarity within the tissue plane and is widely involved in cell orientation, tissue structure and morphogenesis during development. PCP proteins are highly expressed in the brain and are involved in regulating neuronal polarity, axon guidance, dendritic morphogenesis and synaptic plasticity. As one of the core PCP proteins, the human recombinant protein (Prickle protein) is distributed in the postsynaptic density (PSD) region and the axon initial segment (AIS) region of neurons, showing a dotted distribution characteristic, which has an important influence on the morphogenesis and synaptic activity of neuronal cells. Prickle protein can bind to the postsynaptic density 95 (PSD-95) of neurons in the PSD region to form a complex, and interact with ankyrin-G (AnkG) in the AIS region to regulate neuronal polarity. In addition, Prickle gene mutations and changes in protein content are associated with diseases such as neurodevelopmental disorders and epilepsy. Therefore, how to regulate the expression level of Prickle protein is of great significance for its localization and function in neurons.

[0003] At present, the existing technology regulates the expression level of Prickle protein by using a recombinant vector containing a CMV promoter and a GFP tag as a regulatory element. However, this regulatory element will cause the Prickle protein to have an excessively high expression level. Due to the excessively high expression level, the distribution of Prickle protein in neurons will lose its original point-like distribution characteristics in the PSD region, which may lead to protein localization errors.

[0004] Therefore, obtaining a recombinant vector that stably regulates the expression level of Prickle protein has positive significance for exploring the role of Prickle protein in neuronal function. Summary of the invention

[0005] In order to solve the above technical problems, the present invention provides a recombinant vector in which the expression of a target gene is regulated by a promoter, and a construction method and application thereof.

[0006] The first aspect of the present invention provides a recombinant vector in which the expression of a target gene is regulated by a promoter, and the recombinant vector comprises a promoter and a tag protein;

[0007] The promoter is one of the hsyn promoter, CMV promoter, 1.2kb NSE promoter, and CaMKIIα promoter, and the tag protein is a Myc tag;

[0008] The nucleotide sequence of the hsyn promoter is shown in SEQ ID NO.6, the nucleotide sequence of the CMV promoter is shown in SEQ ID NO.8, the nucleotide sequence of the 1.2kb NSE promoter is shown in SEQ ID NO.3, and the nucleotide sequence of the CaMKIIα promoter is shown in SEQ ID NO.7;

[0009] The sequence of the Myc tag is shown as SEQ ID NO.31.

[0010] The promoter is a component of the gene and an important element that regulates the start time and strength of gene expression (transcription). The strength of the promoter is an important criterion for controlling gene expression.

[0011] The present invention provides four promoters with different expression strengths, and the recombinant vectors containing the promoters with different expression strengths can stably regulate the expression of the target gene (Prickle1 gene or Prickle2 gene), which has positive significance for exploring the role of Prickle protein in neuronal function and provides a research basis for achieving stable and efficient expression of the target gene (Prickle1 gene or Prickle2 gene) editing.

[0012] In the present invention, the nucleotide sequence of each promoter can be obtained by using a promoter sequence synthesis method well known in the art, for example, by using a polymerase chain reaction (PCR) amplification method, a recombination method or an artificial synthesis method.

[0013] The promoter may preferably be an hsyn promoter or a CMV promoter.

[0014] The tag protein in the present invention is a Myc tag, which is a polypeptide protein tag derived from the product of the c-myc gene and can be fused to the C-terminus or N-terminus of the target gene through recombinant DNA technology. By adding a Myc tag to the C-terminus or N-terminus of the target gene, it can be conveniently detected, separated and purified by a Myc tag-specific antibody.

[0015] Furthermore, the recombinant vector also includes a target gene, and the target gene is a Prickle gene;

[0016] The nucleotide sequence of the Prickle gene is shown in the sequence listing SEQ ID NO.34 or SEQ ID NO.37; depending on the promoter, the recombinant vector can regulate the expression intensity of the protein encoded by the Prickle gene.

[0017] In the present invention, the Prickle gene with a nucleotide sequence as shown in SEQ ID NO.34 or SEQ ID NO.37 in the sequence listing can express the Prickle protein.

[0018] The recombinant vector of the present invention can be used to express the Prickle gene with a nucleotide sequence such as SEQ ID NO.34 or SEQ ID NO.37 in the sequence listing to realize the activation characteristics of the promoter and enhance the transcriptional expression of the target gene.

[0019] The second aspect of the present invention provides a method for constructing a recombinant vector in which the expression of a target gene is regulated by a promoter, comprising the following steps:

[0020] Obtaining a promoter;

[0021] Using SEQ ID NO.9 as the upstream primer and SEQ ID NO.10 as the downstream primer, and the Flag vector as the template, the first-loop PCR was performed to obtain the Flag vector fragment;

[0022] The promoter is connected to the Flag vector fragment by homologous recombination to obtain a recombinant product with a Flag tag;

[0023] Transforming and extracting the recombinant product with the Flag tag to obtain a vector plasmid with the Flag tag;

[0024] Using SEQ ID NO.27 as the upstream primer and SEQ ID NO.28 as the downstream primer, the vector plasmid with the Flag tag is used as a template for second-loop PCR, and then dimerization of Myc primers is used to obtain a vector with a Myc tag;

[0025] The Myc-tagged vector is digested to obtain a Myc-tagged vector linearized fragment;

[0026] The Prickle gene is obtained, and then the Prickle gene is connected with the linearized fragment of the vector with the Myc tag to obtain the recombinant vector.

[0027] In the present invention, the method for obtaining the promoter and the Prickle gene can be obtained by methods well known in the art, for example, by polymerase chain reaction (PCR) amplification, recombination or artificial synthesis.

[0028] It should be noted that, in the present invention, there are descriptions involving "first", "second", etc., and the descriptions of "first", "second", etc. are only used for description purposes, for example, the first-loop PCR and the second-loop PCR in the present invention.

[0029] Further, the Myc primers include primer 1 and primer 2;

[0030] The nucleotide sequence of the primer 1 is shown in SEQ ID NO.29;

[0031] The nucleotide sequence of the primer 2 is shown as SEQ ID NO.30.

[0032] Furthermore, the reaction procedure of the Myc primer dimerization is: pre-denaturation at 95°C for 4 minutes, denaturation at 95°C for 40 seconds, temperature reduction by 0.7°C before entering the cycle, and annealing at 25°C for 5 minutes, for a total of 65 minutes.

[0033] Furthermore, the enzymes used for the enzyme digestion are restriction endonucleases BamHI and XbaI.

[0034] Furthermore, the reaction system of the first-loop PCR is: 0.6 μL of Flag vector, 1.2 μL of SEQ ID NO.9, 1.2 μL of SEQ ID NO.10, 15 μL of 2×Phanta Master Mix, and sterile water supplemented to 30 μL;

[0035] And / or, the reaction procedure of the first-loop PCR is: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 1 min, 30 cycles; final extension at 72°C for 5 min; cooling at 25°C for 1 min.

[0036] Furthermore, the reaction system of the second-loop PCR is: 0.6 μL of the vector plasmid with a Flag tag, 1.2 μL of SEQ ID NO.27, 1.2 μL of SEQ ID NO.28, 15 μL of 2×Phanta Master Mix, and sterile water supplemented to 30 μL;

[0037] And / or, the reaction procedure of the second-loop PCR is: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 6 min, 30 cycles; final extension at 72°C for 5 min; cooling at 25°C for 1 min.

[0038] The third aspect of the present invention provides a cell comprising the recombinant vector.

[0039] The cells can be obtained by transforming, transducing or transfecting the recombinant vector into the starting cells by conventional methods in the art. The starting cells are hippocampal neurons. Taking hippocampal neurons as an example, the recombinant vector is transferred into hippocampal neurons using a transfection strategy to obtain transfected hippocampal neurons.

[0040] The fourth aspect of the present invention provides an application of the recombinant vector in regulating the expression intensity of a target gene in hippocampal neurons.

[0041] The target gene of the present invention is the Prickle gene, and the nucleotide sequence of the Prickle gene is shown in SEQ ID NO. 34 or SEQ ID NO. 37. The recombinant vector is used to regulate the expression intensity of the target gene in hippocampal neurons.

[0042] In summary, the solution of the present invention has at least the following effects:

[0043] The present invention first successfully constructs a recombinant vector (hSyn-Myc-Prickle1 recombinant vector, CMV-Myc-Prickle1 recombinant vector, 1.2kb NSE-Myc-Prickle1 recombinant vector, CaMKIIα-Myc-Prickle1 recombinant vector, hSyn-Myc-Prickle2 recombinant vector, CMV-Myc-Prickle2 ...Prickle1 recombinant vector, CaMKIIα-Myc-Prickle1 recombinant vector, hSyn-Myc-Prickle2 recombinant vector, CMV-Myc-Prickle2 recombinant vector, 1.2kb NSE-Prickle1 recombinant vector, CaMKIIα-Myc-Prickle1 recombinant vector, hSyn-Myc-Prickle2 recombinant vector, hSyn-Myc-Prickle2 recombinant vector, hSyn-Myc-Prickle2 recombinant vector, hSyn-Myc-Prickle1 recombinant vector, CMV-Myc-Prickle2 recombinant vector, 1.2kb NSE-Prickle1 recombinant vector, CaMKIIα-Myc-Prickle1 recombinant vector, hSyn-Myc-Prickle2 recombinant vector, hSyn-Myc-Prickle1 recombinant vector, CMV-Myc-Prickle2 recombinant vector, 1.2kb The results showed that each recombinant vector was able to express Prickle protein after transfection, and the Prickle protein was distributed in the cell body and processes, with a dotted distribution along the dendrites, showing localization in the PSD region. The Prickle protein was correctly positioned, indicating that the recombinant vectors containing hsyn promoter, CMV promoter, 1.2kb NSE promoter and CaMKIIα promoter provided by the present invention can successfully drive the stable expression of the target gene (Prickle1 gene or Prickle2 gene) in hippocampal neurons, which is of positive significance for exploring the role of Prickle protein in neuronal function. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0045] Figure 1 is the map of the Flag vector;

[0046] Figure 2 is the map of hSyn-Myc-Prickle2 recombinant vector;

[0047] Figure 3 This is the result of immunofluorescence staining of CMV-GFP-Prickle2-transfected hippocampal neurons to detect the fluorescence expression intensity of Prickle protein;

[0048] Figure 4 This is a result diagram of immunofluorescence staining of transfected Prickle1 background promoter-Myc-Prickle1 hippocampal neurons to detect the fluorescence expression intensity of Prickle protein;

[0049] Figure 5 This is a result diagram of immunofluorescence staining of transfected Prickle2 background promoter-Myc-Prickle2 hippocampal neurons to detect the fluorescence expression intensity of Prickle protein;

[0050] Figure 6 The results of immunofluorescence staining of transfected 1.2kb NSE-Myc-Prickle1 hippocampal neurons and 1.2kb NSE-Myc-Prickle2 hippocampal neurons to detect the fluorescence expression intensity of Prickle protein are shown in Figure 1. Figure 6 A is the result diagram of fluorescence expression intensity. Figure 6 B is a statistical graph of fluorescence expression intensity;

[0051] Figure 7 The results of immunofluorescence staining of transfected 1.0kb NSE-Myc-Prickle1 hippocampal neurons and 1.0kb NSE-Myc-Prickle2 hippocampal neurons to detect the fluorescence expression intensity of Prickle protein;

[0052] Figure 8 The results of immunofluorescence staining of transfected 0.3kb NSE-Myc-Prickle1 hippocampal neurons and 0.3kb NSE-Myc-Prickle2 hippocampal neurons to detect the fluorescence expression intensity of Prickle protein;

[0053] Fig. 9 The results of immunofluorescence staining of transfected hSyn-Myc-Prickle1 hippocampal neurons and hSyn-Myc-Prickle2 hippocampal neurons to detect the fluorescence expression intensity of Prickle protein are shown in Figure 1. Fig. 9 A is the result diagram of fluorescence expression intensity. Fig. 9 B is a statistical graph of fluorescence expression intensity;

[0054] Fig.10 The results of immunofluorescence staining of transfected CaMKIIα-Myc-Prickle1 hippocampal neurons and CaMKIIα-Myc-Prickle2 hippocampal neurons to detect the fluorescence expression intensity of Prickle protein are shown in Figure 1. Fig.10 A is the result diagram of fluorescence expression intensity. Fig.10 B is a statistical graph of fluorescence expression intensity;

[0055] Fig.11 The results of immunofluorescence staining of transfected CMV-Myc-Prickle1 hippocampal neurons and CMV-Myc-Prickle2 hippocampal neurons to detect the fluorescence expression intensity of Prickle protein are shown in Figure 1. Fig.11 A is the result diagram of fluorescence expression intensity. Fig.11 B is a statistical graph of fluorescence expression intensity;

[0056] Fig.12 is the fluorescence expression intensity of Prickle1 protein in different recombinant vectors, wherein a is the fluorescence expression intensity in 1.2kb NSE-Myc-Prickle1 recombinant vector, b is the fluorescence expression intensity in CMV-GFP-Prickle1 recombinant vector, c is the fluorescence expression intensity in hSyn-Myc-Prickle1 recombinant vector, and d is the fluorescence expression intensity in CaMKIIα-Myc-Prickle1 recombinant vector;

[0057] Fig.13 is the fluorescence expression intensity of Prickle2 protein in different recombinant vectors, wherein a is the fluorescence expression intensity in 1.2kb NSE-Myc-Prickle2 recombinant vector, b is the fluorescence expression intensity in CMV-GFP-Prickle2 recombinant vector, c is the fluorescence expression intensity in hSyn-Myc-Prickle2 recombinant vector, and d is the fluorescence expression intensity in CaMKIIα-Myc-Prickle2 recombinant vector. DETAILED DESCRIPTION

[0058] To make the purpose, technical scheme and advantages of the present invention clearer, the technical scheme in the embodiment of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in the art without making creative work are within the scope of protection of the present invention. If the specific technology or conditions are not indicated in the embodiments, the technology or conditions described in the literature in this area or the product instructions are carried out. The reagents or instruments used that do not indicate the manufacturer are all conventional products that can be obtained commercially.

[0059] In the following examples, the term "Prickle1 background promoter" refers to the promoter of the Prickle1 gene.

[0060] The term "Prickle2 basal promoter" is the promoter of the Prickle2 gene.

[0061] The term "NSE promoter" refers to the neuron-specific enolase (NSE) promoter, which has neuron specificity and can be used to drive the expression of exogenous genes in neurons.

[0062] The term "hSyn promoter" refers to the promoter of the human SYN1 gene. The SYN1 gene produces Synapsin I protein (protruding premembrane protein), which is a protein specifically expressed in neurons. Therefore, the hSyn promoter is a neuron-specific promoter.

[0063] The term "CaMKIIα promoter" refers to a promoter that controls the expression of the calmodulin-dependent protein kinase IIα (CaMKIIα) gene. CaMKIIα is a protein kinase that is closely related to key neural functions such as synaptic plasticity, learning, and memory in excitatory neurons. The CaMKIIα promoter is neuron-specific and mainly functions in excitatory neurons.

[0064] The term "CMV promoter" refers to the promoter of human cytomegalovirus (CMV), which is a strong promoter for initiating eukaryotic gene expression.

[0065] In the following examples, the formula of LB liquid culture medium is: tryptone 10 g / L, yeast extract 5 g / L, sodium chloride 10 g / L;

[0066] The formula of LB solid medium is: tryptone 10 g / L, yeast extract 5 g / L, sodium chloride 10 g / L, agarose 15 g / L;

[0067] The formula of Mix-B27 medium is: 30mL DMEM, 3.75mL Ham's F12, 4.125mL Cell culture water, 1.875mL FBS, 1.875mL NBCS calf serum, 0.5mL B27;

[0068] The formula of NB27 medium is: 48mL Neurobasal medium, 0.5mL 100×Glutamax, 0.5mL 100×NaCl, 1mL B27;

[0069] The formula of calcium transfer solution is: 30 mL DMEM, 3.75 mL Ham's F12, 4.125 mL ultrapure water, 0.5 mL B27, 0.937 mL HEPES (1 M).

[0070] The following is a detailed description of the recombinant vector for regulating the expression of a target gene by a promoter, and its construction method and application provided by the present invention in conjunction with the embodiments.

[0071] Example 1 Construction of recombinant vector

[0072] 1. Promoter

[0073] The following promoters were cloned from human genomic DNA: Prickle1 background promoter, Prickle2 background promoter, 1.2 kb neuron-specific enolase promoter (1.2 kb NSE promoter), 1.0 kb NSE promoter, 0.3 kb NSE promoter, hSyn promoter, CaMKIIα promoter, CMV promoter;

[0074] The nucleotide sequence of the Prickle1 background promoter is shown in the sequence listing as SEQ ID NO.1;

[0075] The nucleotide sequence of the Prickle2 background promoter is shown in the sequence listing as SEQ ID NO.2;

[0076] The nucleotide sequence of the 1.2 kb NSE promoter is shown in SEQ ID NO. 3;

[0077] The nucleotide sequence of the 1.0 kb NSE promoter is shown in SEQ ID NO.4;

[0078] The nucleotide sequence of the 0.3 kb NSE promoter is shown in SEQ ID NO.5;

[0079] The nucleotide sequence of the hSyn promoter is shown in SEQ ID NO.6;

[0080] The nucleotide sequence of the CaMKIIα promoter is shown in SEQ ID NO.7;

[0081] The nucleotide sequence of the CMV promoter is shown in SEQ ID NO.8.

[0082] 2. Construction of recombinant vector with Myc tag

[0083] 1. Construct a vector with a Flag tag

[0084] (1) Obtaining Flag vector fragment

[0085] Perform circular PCR on Flag vector (vector with Flag tag):

[0086] Design upstream primers (nucleotide sequence as shown in SEQ ID NO.9) and downstream primers (nucleotide sequence as shown in SEQ ID NO.10), and use Flag vector (map as shown in Figure 1 As shown) is used as a template, circular PCR is performed to obtain a circular PCR product;

[0087] Reaction system: Flag vector 0.6 μL, upstream primer 1.2 μL, downstream primer 1.2 μL, 2×Phanta MasterMix 15 μL, sterile water to 30 μL;

[0088] Upstream primer: CTCTGGCTAACTAGAGAACCC (SEQ ID NO. 9);

[0089] Downstream primer: CGGAACTCCATATATGGGCTA (SEQ ID NO. 10);

[0090] Reaction procedure: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 6 min, 30 cycles; final extension at 72°C for 5 min; cooling at 25°C for 1 min.

[0091] Template digestion:

[0092] Since the presence of the template (Flag vector) after circular PCR will interfere with subsequent homologous recombination, the template in the circular PCR product needs to be digested;

[0093] Digestion system: 30 μL of circular PCR product, 2.4 μL of DpnI enzyme, and 3.6 μL of CutSmart;

[0094] The above digestion system was mixed and placed in a 37°C water bath for enzymatic digestion for 2 h to obtain the product.

[0095] The product was detected by agarose gel electrophoresis, and the target band was found and cut out according to the molecular marker. The target band of the product detected by agarose gel electrophoresis was recovered using a gel recovery kit to obtain the Flag vector fragment, which was stored for later use.

[0096] (2) Obtaining promoter gene fragments

[0097] ① Obtaining the Prickle1 background promoter gene fragment: designing an upstream primer (nucleotide sequence as shown in SEQ ID NO.11) and a downstream primer (nucleotide sequence as shown in SEQ ID NO.12), using human genomic DNA as a template, and performing PCR amplification to obtain a PCR amplification product;

[0098] Reaction system: human genomic DNA 0.6 μL, upstream primer 1.2 μL, downstream primer 1.2 μL, 2×PhantaMaster Mix 15 μL, sterile water to 30 μL;

[0099] Upstream primer: AGCCCATATATGGAGTTCCGCTTAGTCAAGACATGAATGA (SEQ ID NO. 11);

[0100] Downstream primer: GGTTCTCTAGTTAGCCAGAGAAAGTTTAAAGCCTGGTTTC (SEQ ID NO. 12);

[0101] Reaction procedure: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 130 s, 30 cycles; 72℃ final extension for 5 min; 25℃ cooling for 1 min;

[0102] The PCR amplification product was detected by agarose gel electrophoresis, and the target band was found and cut out according to the molecular marker. The target band of the PCR amplification product detected by agarose gel electrophoresis was recovered using a gel recovery kit to obtain the Prickle1 background promoter gene fragment (the nucleotide sequence is shown in the sequence table SEQ ID NO.1), which was stored for later use.

[0103] ② Obtaining the Prickle2 background promoter gene fragment: designing upstream primers (nucleotide sequence as shown in SEQ ID NO.13) and downstream primers (nucleotide sequence as shown in SEQ ID NO.14), using human genomic DNA as a template, and performing PCR amplification to obtain PCR amplification products;

[0104] Upstream primer: AGCCCATATATGGAGGTCCGAAAAAATTAAAAACATATAT (SEQ ID NO. 13);

[0105] Downstream primer: GGTTCTCTAGTTAGCCAGAGGTGCTCCTCCTGGGGACACT (SEQ ID NO. 14);

[0106] The reaction system and reaction procedure are the same as ①;

[0107] The PCR amplification product was detected by agarose gel electrophoresis, and the target band was found and cut out according to the molecular marker. The target band of the PCR amplification product detected by agarose gel electrophoresis was recovered using a gel recovery kit to obtain the Prickle2 background promoter gene fragment (the nucleotide sequence is shown in the sequence table SEQ ID NO.2), which was stored for later use.

[0108] ③ Obtaining the 1.2 kb NSE promoter gene fragment: designing upstream primers (nucleotide sequence as shown in SEQ ID NO.15) and downstream primers (nucleotide sequence as shown in SEQ ID NO.16), using human genomic DNA as a template, and performing PCR amplification to obtain a PCR amplification product;

[0109] Upstream primer: TATGGAGTTCCGATTAATGGGACAGTA (SEQ ID NO. 15);

[0110] Downstream primer: AGTTAGCCAGAGGCTAGCCTCGAGGAC (SEQ ID NO. 16);

[0111] The reaction system and reaction procedure are the same as ①;

[0112] The PCR amplification product was detected by agarose gel electrophoresis, and the target band was found and cut out according to the molecular marker. The target band of the PCR amplification product detected by agarose gel electrophoresis was recovered using a gel recovery kit to obtain a 1.2 kb NSE promoter gene fragment (nucleotide sequence as shown in SEQ ID NO.3) and stored for later use.

[0113] ④ Obtaining 1.0 kb NSE promoter gene fragment: designing upstream primers (nucleotide sequence as shown in SEQ ID NO.17) and downstream primers (nucleotide sequence as shown in SEQ ID NO.18), using human genomic DNA as a template, and performing PCR amplification to obtain PCR amplification products;

[0114] Upstream primer: TATGGAGTTCCGAGAGAAGGGAGAAGA (SEQ ID NO. 17);

[0115] Downstream primer: AGTTAGCCAGAGTCGAGGACTGCAGAC (SEQ ID NO. 18);

[0116] The reaction system and reaction procedure are the same as ①;

[0117] The PCR amplification product was detected by agarose gel electrophoresis, and the target band was found and cut out according to the molecular marker. The target band of the PCR amplification product detected by agarose gel electrophoresis was recovered using a gel recovery kit to obtain a 1.0 kb NSE promoter gene fragment (nucleotide sequence as shown in SEQ ID NO.4), which was stored for later use.

[0118] ⑤ Obtaining a 0.3 kb NSE promoter gene fragment: designing an upstream primer (nucleotide sequence as shown in SEQ ID NO.19) and a downstream primer (nucleotide sequence as shown in SEQ ID NO.20), using human genomic DNA as a template, and performing PCR amplification to obtain a PCR amplification product;

[0119] Upstream primer: TATGGAGTTCCGTCGAGTTGGCTGGACA (SEQ ID NO. 19);

[0120] Downstream primer: AGTTAGCCAGAGGCTAGCCTCGAGGACT (SEQ ID NO. 20);

[0121] The reaction system and reaction procedure are the same as ①;

[0122] The PCR amplification product was detected by agarose gel electrophoresis, and the target band was found and cut out according to the molecular marker. The target band of the PCR amplification product detected by agarose gel electrophoresis was recovered using a gel recovery kit to obtain a 0.3 kb NSE promoter gene fragment (nucleotide sequence as shown in SEQ ID NO.5) and stored for later use.

[0123] ⑥ Obtaining the hSyn promoter gene fragment: designing an upstream primer (nucleotide sequence as shown in SEQ ID NO.21) and a downstream primer (nucleotide sequence as shown in SEQ ID NO.22), using human genomic DNA as a template, and performing PCR amplification to obtain a PCR amplification product;

[0124] Upstream primer: TATGGAGTTCCGAGTGCAAGTGGGTTTT (SEQ ID NO. 21);

[0125] Downstream primer: AGTTAGCCAGAGCTGCGCTCTCAGGCAC (SEQ ID NO. 22);

[0126] The reaction system and reaction procedure are the same as ①;

[0127] The PCR amplification product was detected by agarose gel electrophoresis, and the target band was found and cut out according to the molecular marker. The target band of the PCR amplification product detected by agarose gel electrophoresis was recovered using a gel recovery kit to obtain the hSyn promoter gene fragment (nucleotide sequence as shown in SEQ ID NO.6), which was stored for later use.

[0128] ⑦ Obtaining the CaMKIIα promoter gene fragment: designing an upstream primer (nucleotide sequence as shown in SEQ ID NO.23) and a downstream primer (nucleotide sequence as shown in SEQ ID NO.24), using human genomic DNA as a template, and performing PCR amplification to obtain a PCR amplification product;

[0129] Upstream primer: TATGGAGTTCCGCATTATGGCCTTAGGTCA (SEQ ID NO. 23);

[0130] Downstream primer: AGTTAGCCAGAGGCTGCCCCCAGAACTAG (SEQ ID NO. 24);

[0131] The reaction system and reaction procedure are the same as ①;

[0132] The PCR amplification product was detected by agarose gel electrophoresis, and the target band was found and cut out according to the molecular marker. The target band of the PCR amplification product detected by agarose gel electrophoresis was recovered using a gel recovery kit to obtain the CaMKIIα promoter gene fragment (nucleotide sequence as shown in SEQ ID NO.7), which was stored for later use.

[0133] ⑧ Obtaining the CMV promoter gene fragment: designing an upstream primer (nucleotide sequence as shown in SEQ ID NO.25) and a downstream primer (nucleotide sequence as shown in SEQ ID NO.26), using human genomic DNA as a template, and performing PCR amplification to obtain a PCR amplification product;

[0134] Upstream primer: TATGGAGTTCCGGACATTGATTATTGACTA (SEQ ID NO. 25);

[0135] Downstream primer: AGTTAGCCAGAGAGCTCTGCTTATATAGAC (SEQ ID NO. 26);

[0136] The reaction system and reaction procedure are the same as ①;

[0137] The PCR amplification product was detected by agarose gel electrophoresis, and the target band was found and cut out according to the molecular marker. The target band of the PCR amplification product detected by agarose gel electrophoresis was recovered using a gel recovery kit to obtain the CMV promoter gene fragment (nucleotide sequence as shown in SEQ ID NO.8), which was stored for later use.

[0138] The nucleotide sequences of the above promoters can be obtained from the NCBI database ( https: / / www.ncbi.nlm.nih.gov / ) is obtained.

[0139] (3) Homologous recombination

[0140] ① Recombinant product Prickle1 background promoter-Flag: The Flag vector fragment and the Prickle1 background promoter gene fragment were connected by homologous recombination to obtain a recombinant product with a Flag tag (recombinant product Prickle1 background promoter-Flag);

[0141] Homologous recombination system: Flag vector fragment 2μL, Prickle1 background promoter gene fragment 1μL, ExnaseⅡ1μL, 5×CEⅡBuffer 2μL, sterile water to 10μL.

[0142] ② Recombinant product Prickle2 background promoter-Flag: The Flag vector fragment and the Prickle2 background promoter gene fragment were connected by homologous recombination to obtain a recombinant product with a Flag tag (recombinant product Prickle2 background promoter-Flag);

[0143] Homologous recombination system: Flag vector fragment 2μL, Prickle2 background promoter gene fragment 1μL, ExnaseⅡ1μL, 5×CEⅡBuffer 2μL, sterile water to 10μL.

[0144] ③ Recombinant product 1.2kb NSE-Flag: The Flag vector fragment and the 1.2kb NSE promoter gene fragment were connected by homologous recombination to obtain a recombinant product with a Flag tag (recombinant product 1.2kb NSE-Flag);

[0145] Homologous recombination system: Flag vector fragment 2μL, 1.2kb NSE promoter gene fragment 1μL, ExnaseⅡ1μL, 5×CEⅡBuffer 2μL, and sterile water to 10μL.

[0146] ④ Recombinant product 1.0 kb NSE-Flag: The Flag vector fragment and the 1.0 kb NSE promoter gene fragment were connected by homologous recombination to obtain a recombinant product with a Flag tag (recombinant product 1.0 kb NSE-Flag);

[0147] Homologous recombination system: Flag vector fragment 2μL, 1.0kb NSE promoter gene fragment 1μL, ExnaseⅡ1μL, 5×CEⅡBuffer 2μL, and sterile water to 10μL.

[0148] ⑤ Recombinant product 0.3 kb NSE-Flag: The Flag vector fragment and the 0.3 kb NSE promoter gene fragment were connected by homologous recombination to obtain a recombinant product with a Flag tag (recombinant product 0.3 kb NSE-Flag);

[0149] Homologous recombination system: Flag vector fragment 2μL, 0.3kb NSE promoter gene fragment 1μL, ExnaseⅡ1μL, 5×CEⅡBuffer 2μL, sterile water to 10μL.

[0150] ⑥ Recombinant product hSyn-Flag: The Flag vector fragment and the hSyn promoter gene fragment were connected by homologous recombination to obtain a recombinant product with a Flag tag (recombinant product hSyn-Flag);

[0151] Homologous recombination system: Flag vector fragment 2 μL, hSyn promoter gene fragment 1 μL, ExnaseⅡ1 μL, 5×CEⅡBuffer 2 μL, and sterile water to 10 μL.

[0152] ⑦ Recombinant product CaMKIIα-Flag: The Flag vector fragment and the CaMKIIα promoter gene fragment were connected by homologous recombination to obtain a recombinant product with a Flag tag (recombinant product CaMKIIα-Flag);

[0153] Homologous recombination system: Flag vector fragment 2μL, CaMKIIα promoter gene fragment 1μL, ExnaseⅡ1μL, 5×CEⅡBuffer 2μL, sterile water to 10μL.

[0154] ⑧ Recombinant product CMV-Flag: The Flag vector fragment and the CMV promoter gene fragment were connected by homologous recombination to obtain a recombinant product with a Flag tag (recombinant product CMV-Flag);

[0155] Homologous recombination system: Flag vector fragment 2μL, CMV promoter gene fragment 1μL, ExnaseⅡ1μL, 5×CEⅡBuffer 2μL, sterile water to 10μL.

[0156] (4) Conversion

[0157] Transformation method: Add E. coli DH5α competent cells to the recombinant product and place in an ice bath for 30 minutes; place in a 42°C constant temperature water bath after the ice bath, heat shock for 75 seconds, then transfer to ice and let stand for 3 minutes, add 100μL LB liquid culture medium, shake at 37°C for 30 minutes to obtain a mixed solution; apply the mixed solution on LB plate culture medium, and culture in a 37°C constant temperature incubator for 12 hours to obtain colonies containing the recombinant product;

[0158] According to the above transformation method, the recombinant product Prickle1 background promoter-Flag, the recombinant product Prickle2 background promoter-Flag, the recombinant product 1.2kb NSE-Flag, the recombinant product 1.0kb NSE-Flag, the recombinant product 0.3kbNSE-Flag, the recombinant product hSyn-Flag, the recombinant product CaMKIIα-Flag and the recombinant product CMV-Flag were respectively transformed into Escherichia coli DH5α competent cells to obtain corresponding colonies (colonies containing the recombinant product Prickle1 background promoter-Flag, colonies containing the recombinant product Prickle2 background promoter-Flag, colonies containing the recombinant product 1.2kb NSE-Flag, colonies containing the recombinant product 1.0kb NSE-Flag, colonies containing the recombinant product 0.3kb NSE-Flag, colonies containing the recombinant product hSyn-Flag, colonies containing the recombinant product CaMKIIα-Flag, colonies containing the recombinant product CMV-Flag).

[0159] (5) Plasmid extraction

[0160] Plasmid extraction method: pick the colony into LB liquid culture medium, shake at 37℃ for 8h, extract the plasmid with a small amount of plasmid extraction kit (BSC01M1, Hangzhou Biore) according to the instructions, measure the plasmid concentration with an ultra-microbiological monitor, and send it to a sequencing company for sequencing; extract the plasmid with the correct sequencing result, and extract the plasmid with a plasmid extraction kit (CW2105S, Kangwei Century) according to the instructions to obtain the vector plasmid with a Flag tag;

[0161] According to the above-mentioned plasmid extraction method, plasmids were extracted from colonies containing the recombinant product Prickle1 background promoter-Flag, colonies containing the recombinant product Prickle2 background promoter-Flag, colonies containing the recombinant product 1.2kb NSE-Flag, colonies containing the recombinant product 1.0kb NSE-Flag, colonies containing the recombinant product 0.3kb NSE-Flag, colonies containing the recombinant product hSyn-Flag, colonies containing the recombinant product CaMKIIα-Flag and colonies containing the recombinant product CMV-Flag, and the corresponding vector plasmids (Prickle1 background promoter-Flag vector plasmid, Prickle2 background promoter-Flag vector plasmid, 1.2kb NSE-Flag vector plasmid, 1.0kb NSE-Flag vector plasmid, 0.3kb NSE-Flag vector plasmid, hSyn-Flag vector plasmid, CaMKIIα-Flag vector plasmid, CMV-Flag vector plasmid) were obtained respectively.

[0162] 2. Construction of a vector with a Myc tag

[0163] (1) Obtaining the Prickle1 background promoter-Myc vector

[0164] Design an upstream primer (nucleotide sequence as shown in SEQ ID NO.27) and a downstream primer (nucleotide sequence as shown in SEQ ID NO.28), perform circular PCR using the Prickle1 background promoter-Flag vector plasmid as a template, and then dimerize with Myc primers to obtain a vector with a Myc tag (Prickle1 background promoter-Myc vector);

[0165] The reaction system of circular PCR: Prickle1 background promoter-Flag vector plasmid 0.6 μL, upstream primer 1.2 μL, downstream primer 1.2 μL, 2×Phanta Master Mix 15 μL, sterile water supplemented to 30 μL;

[0166] The reaction procedure of circular PCR was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 6 min, 30 cycles; final extension at 72°C for 5 min; cooling at 25°C for 1 min;

[0167] Upstream primer: AAGCTTGGTACCGAGCTCGGA (SEQ ID NO. 27);

[0168] Downstream primer: CATGGTGGCGGCTAGCAGCTT (SEQ ID NO. 28);

[0169] The reaction system for Myc primer dimerization: 5 μL of primer 1, 5 μL of primer 2, 2 μL of 10x annealing buffer, and sterile water to 20 μL;

[0170] The reaction procedure for Myc primer dimerization was as follows: pre-denaturation at 95°C for 4 min, denaturation at 95°C for 40 s, temperature reduction of 0.7°C before entering the cycle, and annealing at 25°C for 5 min, for a total of 65 min;

[0171] Myc primers include primer 1 (SEQ ID NO.29) and primer 2 (SEQ ID NO.30),

[0172] Primer 1: GCCACCATGGAACAAAAACTCATCTCAGAAGAGGATCTC (SEQ ID NO. 29);

[0173] Primer 2: ACCAAGCTTGAGATCCTCTTCTGAGATGAGTTTTTGTTC (SEQ ID NO. 30);

[0174] The sequence of the Myc tag is: EQKLISEEDL (SEQ ID NO. 31).

[0175] (2) Obtaining the Prickle2 background promoter-Myc vector

[0176] The preparation process of Prickle2 background promoter-Myc vector is basically the same as that of (1) Prickle1 background promoter-Myc vector, except that: circular PCR is performed using Prickle2 background promoter-Flag vector plasmid as a template, and then Myc primer dimerization is used to obtain a vector with a Myc tag (Prickle2 background promoter-Myc vector).

[0177] (3) Obtaining 1.2kb NSE-Myc vector

[0178] The preparation process of 1.2kb NSE-Myc vector is basically the same as that of (1) Prickle1 background promoter-Myc vector, except that circular PCR is performed using 1.2kb NSE-Flag vector plasmid as a template, and then Myc primer dimerization is used to obtain a vector with a Myc tag (1.2kb NSE-Myc vector).

[0179] (4) Obtaining 1.0 kb NSE-Myc vector

[0180] The preparation process of 1.0 kb NSE-Myc vector is basically the same as that of (1) Prickle1 background promoter-Myc vector, except that circular PCR is performed using 1.0 kb NSE-Flag vector plasmid as a template, and then Myc primer dimerization is used to obtain a vector with a Myc tag (1.0 kb NSE-Myc vector).

[0181] (5) Obtaining 0.3kb NSE-Myc vector

[0182] The preparation process of 0.3 kb NSE-Myc vector is basically the same as that of (1) Prickle1 background promoter-Myc vector, except that circular PCR is performed using 0.3 kb NSE-Flag vector plasmid as a template, and then Myc primer dimerization is used to obtain a vector with a Myc tag (0.3 kb NSE-Myc vector).

[0183] (6) Obtaining hSyn-Myc vector

[0184] The preparation process of hSyn-Myc vector is basically the same as that of (1) Prickle1 background promoter-Myc vector, except that circular PCR is performed using hSyn-Flag vector plasmid as a template, and then Myc primer dimerization is used to obtain a vector with a Myc tag (hSyn-Myc vector).

[0185] (7) Obtaining CaMKIIα-Myc vector

[0186] The preparation process of the CaMKIIα-Myc vector is basically the same as that of (1) obtaining the Prickle1 background promoter-Myc vector, except that circular PCR is performed using the CaMKIIα-Flag vector plasmid as a template, and then Myc primer dimerization is used to obtain a vector with a Myc tag (CaMKIIα-Myc vector).

[0187] (8) Obtaining CMV-Myc vector

[0188] The preparation process of CMV-Myc vector is basically the same as that of (1) Prickle1 background promoter-Myc vector, except that circular PCR is performed using CMV-Flag vector plasmid as a template, and then Myc primer dimerization is used to obtain a vector with a Myc tag (CMV-Myc vector).

[0189] 3. Construction of a recombinant vector with a Myc tag

[0190] (1) Obtaining Prickle1 and Prickle2 genes

[0191] ① Obtaining the Prickle1 gene fragment

[0192] Design an upstream primer (nucleotide sequence as shown in SEQ ID NO.32) and a downstream primer (nucleotide sequence as shown in SEQ ID NO.33), use human genomic DNA as a template, and perform PCR amplification to obtain a Prickle1 gene fragment (nucleotide sequence as shown in SEQ ID NO.34 in the sequence listing);

[0193] Reaction system: human genomic DNA 0.6 μL, upstream primer 1.2 μL, downstream primer 1.2 μL, 2×PhantaMaster Mix 15 μL, sterile water to 30 μL;

[0194] Upstream primer: GAGCTCGGATCCATGCCTTTGGAGATGGAG (SEQ ID NO. 32);

[0195] Downstream primer: GGGCCCTCTAGATTTAAGAAATGATACAGTTTTT (SEQ ID NO. 33);

[0196] Reaction procedure: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 2 min 35 s, 30 cycles; final extension at 72°C for 5 min; cooling at 25°C for 1 min.

[0197] ① Obtaining the Prickle2 gene fragment

[0198] Design an upstream primer (nucleotide sequence as shown in SEQ ID NO.35) and a downstream primer (nucleotide sequence as shown in SEQ ID NO.36), use human genomic DNA as a template, and perform PCR amplification to obtain a Prickle2 gene fragment (nucleotide sequence as shown in SEQ ID NO.37 in the sequence listing);

[0199] Upstream primer: GAGCTCGGATCCATGGTGACAGTGATGCCG (SEQ ID NO. 35);

[0200] Downstream primer: GGGCCCTCTAGATTTAAGAAATGATACAGTT (SEQ ID NO. 36);

[0201] The reaction system and reaction procedure are the same as those in ① obtaining the Prickle1 gene fragment.

[0202] Both the Prickle1 gene fragment and the Prickle2 gene fragment were cloned from human genomic DNA. Studies have shown that both the Prickle1 gene and the Prickle2 gene can express Prickle protein.

[0203] (2) Construction of recombinant vector with Myc tag

[0204] ①Construction of Prickle1 background promoter-Myc-Prickle1 recombinant vector

[0205] The Prickle1 background promoter-Myc vector was digested with restriction endonucleases BamHI and XbaI to obtain a Prickle1 background promoter-Myc vector linearized fragment; the Prickle1 background promoter-Myc vector linearized fragment was connected with the above Prickle1 gene fragment by homologous recombination to obtain a Prickle1 recombinant vector with a Myc tag (Prickle1 background promoter-Myc-Prickle1 recombinant vector), which was stored for later use;

[0206] Enzyme digestion reaction system: Prickle1 background promoter-Myc vector 15μL, CutSmart 3μL, BamHI 1μL, XbaI 1μL, sterile water to 30μL; enzyme digestion reaction procedure: 37℃ enzyme digestion for 4h.

[0207] ②Construction of Prickle2 background promoter-Myc-Prickle2 recombinant vector

[0208] The Prickle2 background promoter-Myc vector was digested with restriction endonucleases BamHI and XbaI to obtain a Prickle2 background promoter-Myc vector linearized fragment; the Prickle2 background promoter-Myc vector linearized fragment was connected with the above Prickle2 gene fragment by homologous recombination to obtain a Prickle2 recombinant vector with a Myc tag (Prickle2 background promoter-Myc-Prickle2 recombinant vector), which was stored for later use;

[0209] The double enzyme digestion reaction system and double enzyme digestion reaction procedure are basically the same as ①, except that: 15 μL of Prickle2 background promoter-Myc vector.

[0210] ③Construction of 1.2kb NSE-Myc-Prickle1 recombinant vector and 1.2kb NSE-Myc-Prickle2 recombinant vector

[0211] The 1.2 kb NSE-Myc vector was digested with restriction endonucleases BamHI and XbaI to obtain a 1.2 kb NSE-Myc vector linearized fragment; the 1.2 kb NSE-Myc vector linearized fragment was connected to the Prickle1 gene fragment and the Prickle2 gene fragment by homologous recombination to obtain a Prickle1 recombinant vector (1.2 kb NSE-Myc-Prickle1 recombinant vector) with a Myc tag and a Prickle2 recombinant vector (1.2 kb NSE-Myc-Prickle2 recombinant vector) with a Myc tag, respectively, and stored for later use;

[0212] The enzyme digestion reaction system and enzyme digestion reaction procedure are the same as ①.

[0213] ④Construction of 1.0kb NSE-Myc-Prickle1 recombinant vector and 1.0kb NSE-Myc-Prickle2 recombinant vector

[0214] The 1.0 kb NSE-Myc vector was digested with restriction endonucleases BamHI and XbaI to obtain a 1.0 kb NSE-Myc vector linearized fragment; the 1.0 kb NSE-Myc vector linearized fragment was connected to the Prickle1 gene fragment and the Prickle2 gene fragment by homologous recombination to obtain a Prickle1 recombinant vector (1.0 kb NSE-Myc-Prickle1 recombinant vector) with a Myc tag and a Prickle2 recombinant vector (1.0 kb NSE-Myc-Prickle2 recombinant vector) with a Myc tag, respectively, and stored for later use;

[0215] The enzyme digestion reaction system and enzyme digestion reaction procedure are the same as ①.

[0216] ⑤Construction of 0.3kb NSE-Myc-Prickle1 recombinant vector and 0.3kb NSE-Myc-Prickle2 recombinant vector

[0217] The 0.3 kb NSE-Myc vector was digested with restriction endonucleases BamHI and XbaI to obtain a 0.3 kb NSE-Myc vector linearized fragment; the 0.3 kb NSE-Myc vector linearized fragment was connected to the Prickle1 gene fragment and the Prickle2 gene fragment by homologous recombination to obtain a Prickle1 recombinant vector (0.3 kb NSE-Myc-Prickle1 recombinant vector) with a Myc tag and a Prickle2 recombinant vector (0.3 kb NSE-Myc-Prickle2 recombinant vector) with a Myc tag, respectively, and stored for later use;

[0218] The double enzyme digestion reaction system and double enzyme digestion reaction procedure are the same as ①.

[0219] ⑥Construction of hSyn-Myc-Prickle1 recombinant vector and hSyn-Myc-Prickle2 recombinant vector

[0220] The hSyn-Myc vector was digested with restriction endonucleases BamHI and XbaI to obtain a linearized fragment of the hSyn-Myc vector; the linearized fragment of the hSyn-Myc vector was connected to the Prickle1 gene fragment and the Prickle2 gene fragment by homologous recombination to obtain a Prickle1 recombinant vector with a Myc tag (hSyn-Myc-Prickle1 recombinant vector) and a Prickle2 recombinant vector with a Myc tag (hSyn-Myc-Prickle2 recombinant vector (map as shown in FIG. Figure 2 As shown), save for later use;

[0221] The enzyme digestion reaction system and enzyme digestion reaction procedure are the same as ①.

[0222] ⑦Construction of CaMKIIα-Myc-Prickle1 recombinant vector and CaMKIIα-Myc-Prickle2 recombinant vector

[0223] The CaMKIIα-Myc vector was digested with restriction endonucleases BamHI and XbaI to obtain a linearized fragment of the CaMKIIα-Myc vector; the linearized fragment of the CaMKIIα-Myc vector was connected to the Prickle1 gene fragment and the Prickle2 gene fragment by homologous recombination to obtain a Prickle1 recombinant vector with a Myc tag (CaMKIIα-Myc-Prickle1 recombinant vector) and a Prickle2 recombinant vector with a Myc tag (CaMKIIα-Myc-Prickle2 recombinant vector), respectively, and the recombinant vectors were stored for later use;

[0224] The enzyme digestion reaction system and enzyme digestion reaction procedure are the same as ①.

[0225] ⑧Construction of CMV-Myc-Prickle1 recombinant vector and CMV-Myc-Prickle2 recombinant vector

[0226] The Myc-CMV vector was digested with restriction endonucleases BamHI and XbaI to obtain a CMV-Myc vector linearized fragment; the CMV-Myc vector linearized fragment was connected to the Prickle1 gene fragment and the Prickle2 gene fragment by homologous recombination to obtain a Prickle1 recombinant vector (CMV-Myc-Prickle1 recombinant vector) with a Myc tag and a Prickle2 recombinant vector (CMV-Myc-Prickle2 recombinant vector) with a Myc tag, respectively, and stored for standby use;

[0227] The enzyme digestion reaction system and enzyme digestion reaction procedure are the same as ①.

[0228] 3. Construction of recombinant vector with GFP tag

[0229] The sequence of the GFP-CMV vector is consistent with the sequence of pCMV-GFP in the reference (Electroporation and RNA interference in the rodent retina in vivo and in vitro, Proc Natl Acad Sci US A. 2004 Jan 6.101(1):16-22.).

[0230] The CMV-GFP vector was digested with enzymes to obtain a linearized fragment of the CMV-GFP vector; the linearized fragment of the CMV-GFP vector was connected with the Prickle2 gene fragment to obtain a CMV-GFP-Prickle2 recombinant vector.

[0231] SEQ ID NO.3:

[0232]

[0233] SEQ ID NO.4:

[0234]

[0235] SEQ ID NO.5:

[0236] tcgagttggctggacaaggttatgagcatccgtgtacttatggggttgccagcttggtcctggatcgcccgggcccttcccccacccgttcggttccccaccaccacccgcgctcgtacgtgcgtctccgcctgcagctcttgactcatcggggcccccgggtcacatgcgctcgctcggctctataggcgccgccccctgcccaccccccgcccgcgctgggagccgcagccgccgccactcctgctctctctgcgccgccgccgtcaccaccgccaccgccaccggctgagtctgcagtcctcgaggctagc

[0237] SEQ ID NO.6:

[0238] agtgcaagtgggttttaggaccaggatgaggcggggtgggggtgcctacctgacgaccgaccccgacccactggacaagcacccaacccccattccccaaattgcgcatcccctatcagagagggggaggggaaacaggatgcggcgaggcgcgtgcgcactgccagcttcagcaccgcggacagtgccttcgcccccgcctggcggcgcgcgccaccgccgcctcagcactgaaggcgcgctgacgtcactcgccggtcccccgcaaactccccttcccggccaccttggtcgcgtccgcgccgccgccggcccagccggaccgcaccacgcgaggcgcgagataggggggcacgggcgcgaccatctgcgctgcggcgccggcgactcagcgctgcctcagtctgcggtgggcagcggaggagtcgtgtcgtgcctgagagcgca

[0239] SEQ ID NO.7:

[0240]

[0241] SEQ ID NO.8:

[0242] gacattgattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaata atgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatg gcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggat ttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagct

[0243] Example 2 Effects of different recombinant vectors on Prickle protein expression in neurons

[0244] 1. Transfection

[0245] (1) Obtain primary hippocampal neurons from rats (rats were purchased from the Animal Experiment Center of Anhui Medical University).

[0246] (2) Transfection: The obtained primary hippocampal neurons were cultured in Mix-B27 culture medium (original culture medium). After 24 hours of culture, the medium was changed. 300 μl of the original culture medium (Mix-B27 culture medium) was aspirated and 500 μl of NB27 culture medium was added. The culture medium was changed every three days until the fifth day, which was solution A. 3 μg of recombinant vector and 6 μl of calcium transfer solution were added, and the volume was adjusted to 50 μl with sterile water and mixed evenly, which was solution B. Solution B was added to 50 μl of 2xHBSS solution to obtain transfection complex solution C. Solution C was blown evenly and allowed to stand for 15 minutes. Solution C was then added to solution A. The culture was continued until the seventh day, and the transfected hippocampal neurons were collected. The transfected hippocampal neurons were subjected to immunofluorescence staining to detect the expression of Prickle protein and fluorescence localization analysis. The hippocampal neurons were photographed using a Zeiss LSM980 confocal microscope and Map2 was used to characterize the hippocampal neurons.

[0247] The CMV-GFP-Prickle2 recombinant vector, Prickle1 background promoter-Myc-Prickle1 recombinant vector, Prickle2 background promoter-Myc-Prickle2 recombinant vector, 1.2kb NSE-Myc-Prickle1 recombinant vector, 1.2kb NSE-Myc-Prickle2 recombinant vector, 1.0kb NSE-Myc-Prickle1 recombinant vector, 1.0kb NSE-Myc-Prickle2 recombinant vector, 0.3kb NSE-Myc-Prickle1 recombinant vector, 0.3kb The NSE-Myc-Prickle2 recombinant vector, hSyn-Myc-Prickle1 recombinant vector, hSyn-Myc-Prickle2 recombinant vector, CaMKIIα-Myc-Prickle1 recombinant vector, CaMKIIα-Myc-Prickle2 recombinant vector, CMV-Myc-Prickle1 recombinant vector and CMV-Myc-Prickle2 recombinant vector were transfected according to the above method, respectively, to obtain transfected CMV-GFP-Prickle2 hippocampal neurons, transfected Prickle1 background promoter-Myc-Prickle1 hippocampal neurons, transfected Prickle2 background promoter-Myc-Prickle2 hippocampal neurons, transfected 1.2kb NSE-Myc-Prickle1 hippocampal neurons, transfected 1.2kb NSE-Myc-Prickle2 hippocampal neurons, transfected 1.0kb NSE-Myc-Prickle1 hippocampal neurons and transfected 1.0kb NSE-Myc-Prickle2 hippocampal neurons, transfected 0.3kbNSE-Myc-Prickle1 hippocampal neurons, transfected 0.3kb NSE-Myc-Prickle2 hippocampal neurons, transfected hSyn-Myc-Prickle1 hippocampal neurons, transfected hSyn-Myc-Prickle2 hippocampal neurons, transfected CaMKIIα-Myc-Prickle1 hippocampal neurons, transfected CaMKIIα-Myc-Prickle2 hippocampal neurons, transfected CMV-Myc-Prickle1 hippocampal neurons and transfected CMV-Myc-Prickle2 hippocampal neurons, each transfected hippocampal neuron was subjected to immunofluorescence staining to detect the expression of Prickle protein and to perform fluorescence localization analysis, and photographed using a Zeiss LSM980 confocal microscope, and Map2 was used to characterize the hippocampal neurons.

[0248] 2. Effects of different recombinant vectors on the expression of Prickle protein in hippocampal neurons

[0249] Figure 3 This is a result diagram of immunofluorescence staining of CMV-GFP-Prickle2-transfected hippocampal neurons to detect the fluorescence expression intensity of Prickle protein; Figure 4 This is a result diagram of immunofluorescence staining of transfected Prickle1 background promoter-Myc-Prickle1 hippocampal neurons to detect the fluorescence expression intensity of Prickle protein; Figure 5 This is a result diagram of immunofluorescence staining of transfected Prickle2 background promoter-Myc-Prickle2 hippocampal neurons to detect the fluorescence expression intensity of Prickle protein; Figure 6 The results of immunofluorescence staining of transfected 1.2kb NSE-Myc-Prickle1 hippocampal neurons and 1.2kbNSE-Myc-Prickle2 hippocampal neurons to detect the fluorescence expression intensity of Prickle protein are shown in Figure 1. Figure 6 A is the result diagram of fluorescence expression intensity. Figure 6 B is a statistical graph of fluorescence expression intensity; Figure 7 The results of immunofluorescence staining of transfected 1.0kb NSE-Myc-Prickle1 hippocampal neurons and 1.0kb NSE-Myc-Prickle2 hippocampal neurons to detect the fluorescence expression intensity of Prickle protein; Figure 8 The results of immunofluorescence staining of transfected 0.3kbNSE-Myc-Prickle1 hippocampal neurons and 0.3kb NSE-Myc-Prickle2 hippocampal neurons to detect the fluorescence expression intensity of Prickle protein; Fig. 9 The results of immunofluorescence staining of transfected hSyn-Myc-Prickle1 hippocampal neurons and hSyn-Myc-Prickle2 hippocampal neurons to detect the fluorescence expression intensity of Prickle protein are shown in Figure 1. Fig. 9 A is the result diagram of fluorescence expression intensity. Fig. 9 B is a statistical graph of fluorescence expression intensity; Fig.10 The results of immunofluorescence staining of transfected CaMKIIα-Myc-Prickle1 hippocampal neurons and CaMKIIα-Myc-Prickle2 hippocampal neurons to detect the fluorescence expression intensity of Prickle protein are shown in Figure 1. Fig.10 A is the result diagram of fluorescence expression intensity. Fig.10 B is a statistical graph of fluorescence expression intensity; Fig.11The results of immunofluorescence staining of transfected CMV-Myc-Prickle1 hippocampal neurons and CMV-Myc-Prickle2 hippocampal neurons to detect the fluorescence expression intensity of Prickle protein are shown in Figure 1. Fig.11 A is the result diagram of fluorescence expression intensity. Fig.11 B is a statistical graph of fluorescence expression intensity.

[0250] Depend on Figure 3 It can be seen that transfection of CMV-GFP-Prickle2 recombinant vector into hippocampal neurons can express Prickle protein. The Prickle protein is overexpressed in hippocampal neurons, distributed in the cell body and processes, loses the point-like distribution characteristics along the dendrites, and does not show localization in the PSD area.

[0251] Depend on Figure 4 It can be seen that transfection of the Prickle1 background promoter-Myc-Prickle1 recombinant vector into hippocampal neurons cannot drive the expression of Prickle protein.

[0252] Depend on Figure 5 It can be seen that transfection of the Prickle2 background promoter-Myc-Prickle2 recombinant vector into hippocampal neurons cannot drive the expression of Prickle protein.

[0253] Depend on Figure 6 As shown in A and B, the 1.2kb NSE-Myc-Prickle1 recombinant vector and the 1.2kb NSE-Myc-Prickle2 recombinant vector were transfected into hippocampal neurons and were able to express Prickle protein. The Prickle protein was distributed in the cell body and processes, and was distributed in a dotted pattern along the dendrites, showing the localization in the PSD region. The Prickle protein was correctly located. This indicates that the 1.2kb NSE promoter can drive the expression of Prickle protein in hippocampal neurons.

[0254] Depend on Figure 7 It can be seen that when the 1.0kb NSE-Myc-Prickle1 recombinant vector and the 1.0kb NSE-Myc-Prickle2 recombinant vector were transfected into hippocampal neurons, they could not drive the expression of Prickle protein.

[0255] Depend on Figure 8 It can be seen that when the 0.3kb NSE-Myc-Prickle1 recombinant vector and the 0.3kb NSE-Myc-Prickle2 recombinant vector were transfected into hippocampal neurons, they could not drive the expression of Prickle protein.

[0256] Depend on Fig. 9 As shown in A and B, the hSyn-Myc-Prickle1 recombinant vector and the hSyn-Myc-Prickle2 recombinant vector were transfected into hippocampal neurons and were able to express Prickle protein. The Prickle protein was distributed in the cell body and processes, and was distributed in a dotted pattern along the dendrites, showing the localization in the PSD region. The Prickle protein was correctly localized. This indicates that the hSyn promoter can drive the high expression of Prickle protein in hippocampal neurons.

[0257] Depend on Fig.10 As shown in A and B, the CaMKIIα-Myc-Prickle1 recombinant vector and the CaMKIIα-Myc-Prickle2 recombinant vector were transfected into hippocampal neurons and Prickle proteins were expressed. Prickle proteins were distributed in the cell bodies and processes, and were distributed in a dotted pattern along the dendrites, showing the localization in the PSD region. Prickle proteins were correctly located. This indicates that the CaMKIIα promoter can drive the expression of Prickle proteins in hippocampal neurons.

[0258] Depend on Fig.11 As shown in A and B, the CMV-Myc-Prickle1 recombinant vector and the CMV-Myc-Prickle2 recombinant vector were transfected into hippocampal neurons and were able to express Prickle protein. The Prickle protein was distributed in the cell body and processes, and was distributed in a dotted pattern along the dendrites, showing the localization in the PSD region. The Prickle protein was correctly located. This indicates that the CMV promoter can drive the expression of Prickle protein in hippocampal neurons.

[0259] In summary, the recombinant vectors containing hsyn promoter, CMV promoter, 1.2kb NSE promoter, and CaMKIIα promoter can successfully drive the stable expression of the target gene (Prickle1 gene or Prickle2 gene) in hippocampal neurons.

[0260] 3. Comparison of the fluorescence expression intensity of Prickle protein in different recombinant vectors

[0261] Fig.12 is the fluorescence expression intensity of Prickle1 protein in different recombinant vectors, wherein a is the fluorescence expression intensity in 1.2kb NSE-Myc-Prickle1 recombinant vector, b is the fluorescence expression intensity in CMV-GFP-Prickle1 recombinant vector, c is the fluorescence expression intensity in hSyn-Myc-Prickle1 recombinant vector, and d is the fluorescence expression intensity in CaMKIIα-Myc-Prickle1 recombinant vector; Fig.13 is the fluorescence expression intensity of Prickle2 protein in different recombinant vectors, wherein a is the fluorescence expression intensity in 1.2kb NSE-Myc-Prickle2 recombinant vector, b is the fluorescence expression intensity in CMV-GFP-Prickle2 recombinant vector, c is the fluorescence expression intensity in hSyn-Myc-Prickle2 recombinant vector, and d is the fluorescence expression intensity in CaMKIIα-Myc-Prickle2 recombinant vector.

[0262] Depend on Fig.12 It can be seen that the fluorescence expression intensity is hSyn-Myc-Prickle1 recombinant vector>CMV-Myc-Prickle1 recombinant vector>1.2kb NSE-Myc-Prickle1 recombinant vector>CaMKIIα-Myc-Prickle1 recombinant vector. Fig.13 It can be seen that CMV-Myc-Prickle2 recombinant vector>hSyn-Myc-Prickle2 recombinant vector>CaMKIIα-Myc-Prickle2 recombinant vector>1.2kb NSE-Myc-Prickle2 recombinant vector.

[0263] Therefore, the expression intensity of hSyn-Myc-Prickle recombinant vector and CMV-Myc-Prickle recombinant vector is strong and stable.

[0264] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A recombinant vector in which the expression of a target gene is regulated by a promoter, characterized in that: The recombinant vector includes a promoter and a tag protein; The promoter is one of the hsyn promoter, CMV promoter, 1.2kb NSE promoter, and CaMKIIα promoter, and the tag protein is a Myc tag; The nucleotide sequence of the hsyn promoter is shown in SEQ ID NO.6, the nucleotide sequence of the CMV promoter is shown in SEQ ID NO.8, the nucleotide sequence of the 1.2kb NSE promoter is shown in SEQ ID NO.3, and the nucleotide sequence of the CaMKIIα promoter is shown in SEQ ID NO.7; The sequence of the Myc tag is shown as SEQ ID NO.

31.

2. The recombinant vector for regulating the expression of a target gene by a promoter according to claim 1, characterized in that: The recombinant vector also includes a target gene, which is a Prickle gene; The nucleotide sequence of the Prickle gene is shown in the sequence listing SEQ ID NO.34 or SEQ ID NO.37; depending on the promoter, the recombinant vector can regulate the expression intensity of the protein encoded by the Prickle gene.

3. The method for constructing a recombinant vector in which the expression of a target gene is regulated by a promoter according to claim 1 or 2, characterized in that: The following steps are involved: Obtaining a promoter; Using SEQ ID NO.9 as the upstream primer and SEQ ID NO.10 as the downstream primer, and the Flag vector as the template, the first-loop PCR was performed to obtain the Flag vector fragment; Connecting the promoter to the Flag vector fragment using homologous recombination to obtain a recombinant product with a Flag tag; Transforming and extracting the recombinant product with the Flag tag to obtain a vector plasmid with the Flag tag; Using SEQ ID NO.27 as the upstream primer and SEQ ID NO.28 as the downstream primer, the vector plasmid with the Flag tag is used as a template for second-loop PCR, and then dimerization of Myc primers is used to obtain a vector with a Myc tag; The Myc-tagged vector is digested to obtain a Myc-tagged vector linearized fragment; The Prickle gene is obtained, and then the Prickle gene is connected with the linearized fragment of the vector with the Myc tag to obtain the recombinant vector.

4. The method for constructing a recombinant vector for regulating the expression of a target gene by a promoter according to claim 3, characterized in that: The Myc primers include primer 1 and primer 2; The nucleotide sequence of the primer 1 is shown in SEQ ID NO.29; The nucleotide sequence of the primer 2 is shown as SEQ ID NO.

30.

5. The method for constructing a recombinant vector in which the expression of a target gene is regulated by a promoter according to claim 3, characterized in that: The reaction procedure of the Myc primer dimerization is: pre-denaturation at 95°C for 4 minutes, denaturation at 95°C for 40 seconds, temperature reduction by 0.7°C before entering the cycle, and annealing at 25°C for 5 minutes, for a total of 65 minutes.

6. The method for constructing a recombinant vector in which the expression of a target gene is regulated by a promoter according to claim 3, characterized in that: The enzymes used in the digestion are restriction endonucleases BamHI and XbaI.

7. The method for constructing a recombinant vector for regulating the expression of a target gene by a promoter according to claim 3, characterized in that: The reaction system of the first-loop PCR is: 0.6 μL of Flag vector, 1.2 μL of SEQ ID NO.9, 1.2 μL of SEQ ID NO.10, 15 μL of 2×Phanta Master Mix, and sterile water to 30 μL; And / or, the reaction procedure of the first-loop PCR is: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 1 min, 30 cycles; final extension at 72°C for 5 min; cooling at 25°C for 1 min.

8. The method for constructing a recombinant vector for regulating the expression of a target gene by a promoter according to claim 1, characterized in that: The reaction system of the second-loop PCR is: 0.6 μL of the vector plasmid with a Flag tag, 1.2 μL of SEQ ID NO.27, 1.2 μL of SEQ ID NO.28, 15 μL of 2×Phanta Master Mix, and sterile water to 30 μL; And / or, the reaction procedure of the second-loop PCR is: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 6 min, 30 cycles; final extension at 72°C for 5 min; cooling at 25°C for 1 min.

9. A cell, characterized in that Comprising the recombinant vector according to claim 1 or 2.

10. Use of the recombinant vector according to claim 1 or 2 in regulating the expression intensity of a target gene in hippocampal neurons.

Images