Application of Orexin-A in inhibition of lipid peroxidation

Abstract

The invention belongs to the technical field of medicines, and particularly relates to application of Orexin-A in inhibiting lipid peroxidation. The invention provides the application of Orexin-A in inhibiting lipid peroxidation for the first time. The application of the OXA in the in-vitro cerebral hemorrhage model shows the potential of the OXA in relieving cell damage, inhibiting ferroptosis and regulating neuroinflammation. The application shows how the OXA realizes the protection effect by influencing a specific signal channel (such as SRC / FAK / ERK1). Multiple roles of the OXA in neuroprotection are disclosed, and a deeper theoretical basis is provided for clinical application of the OXA.

Description

Technical Field

[0001] The invention belongs to the field of medical technology, and particularly relates to application of Orexin-A in inhibiting lipid peroxidation. Background Art

[0002] With the increasing incidence of cerebral hemorrhage year by year, its high disability and mortality rates have become a global health problem. Secondary neural damage after cerebral hemorrhage is a key factor leading to poor prognosis of patients, and ferroptosis, as a newly discovered cell death mode, plays an important role in the secondary neural damage process after cerebral hemorrhage. However, the specific regulatory mechanism of ferroptosis after cerebral hemorrhage is still unclear, which seriously restricts the development of effective treatment strategies.

[0003] Although a variety of treatment strategies have been used for clinical management after ICH, such as decompression surgery and blood pressure control, the treatment results are still unsatisfactory. On the one hand, existing treatments mainly focus on symptom control and alleviation of primary injuries, and there is insufficient research on methods to promote the recovery of neurological function and inhibit secondary brain damage. On the other hand, ferroptosis, as a cell death mechanism, has not been fully utilized in interventional treatment after ICH. At present, the development of inhibitors of ferroptosis pathways is still in its early stages, and the effectiveness and safety of clinical applications need to be further verified.

[0004] Therefore, it is particularly important to explore new therapeutic targets and strategies, especially those that can regulate ferroptosis and alleviate oxidative stress at the molecular level.

[0005] In this context, our previous studies found that Orexin-A has a certain correlation with the prognosis of patients with cerebral hemorrhage, which provides important clues for us to further explore its mechanism of action. Summary of the invention

[0006] In order to solve the above problems, the present invention provides the application of Orexin-A in inhibiting lipid peroxidation.

[0007] This is achieved specifically through the following technical solutions:

[0008] Application of Orexin-A in inhibiting lipid peroxidation.

[0009] Furthermore, the use of Orexin-A in inhibiting lipid peroxidation is characterized in that the Orexin-A is orexin A.

[0010] Furthermore, the inhibition of lipid peroxidation refers to the inhibition of lipid peroxidation caused by cerebral hemorrhage.

[0011] Furthermore, the aspect of inhibiting lipid peroxidation is the aspect of preparing drugs and reagents for inhibiting lipid peroxidation.

[0012] Application of Orexin-A in the preparation of drugs for cerebral hemorrhage.

[0013] Application of Orexin-A in the preparation of drugs for inhibiting ferroptosis.

[0014] Application of Orexin-A in the preparation of drugs for inhibiting SRC gene expression.

[0015] Application of Orexin-A in the preparation of drugs for downregulating the expression of FAK and ERK1 proteins.

[0016] Application of Orexin-A in the preparation of drugs for inhibiting the expression level of MDA (malondialdehyde).

[0017] Application of Orexin-A in the preparation of drugs for reducing ROS generation.

[0018] In summary, the beneficial effects of the present invention are:

[0019] (1) The present invention provides for the first time the use of Orexin-A in inhibiting lipid peroxidation. The application of OXA in the in vitro cerebral hemorrhage model of the present application shows its potential in reducing cell damage, inhibiting ferroptosis and regulating neuroinflammation. The present application shows how OXA achieves its protective effect by affecting specific signaling pathways (such as SRC / FAK / ERK1). It not only reveals the multiple roles of OXA in neuroprotection, but also provides a deeper theoretical basis for its clinical application.

[0020] (2) The present application experimentally demonstrates that OrexinA (OXA) can significantly reduce the level of lipid peroxidation caused by simulated cerebral hemorrhage, especially a significant downregulation was observed in the expression of malondialdehyde (MDA). MDA, as a product of reactive oxygen species (ROS), is an important biomarker for measuring the degree of lipid peroxidation. In cerebral hemorrhage and other neurodegenerative diseases, lipid peroxidation is a key factor leading to the destruction of cell structure and function. Therefore, this effect of OXA has potential clinical significance. Studies have shown that the increase in intracellular iron levels after cerebral hemorrhage promotes the massive generation of ROS, thereby accelerating the process of lipid peroxidation. ROS not only damages the cell membrane, but also aggravates the damage and death of neurons by activating multiple cell death pathways. The antioxidant function of OXA may be achieved by reducing the production of ROS or increasing the expression of antioxidants.

[0021] (3) The present application further reveals the mechanism of action of OXA at ​​the molecular level, especially its regulatory effect on the SRC / FAK / ERK1 signaling pathway. In this study, OXA treatment significantly inhibited SRC gene expression, which subsequently led to downregulation of downstream FAK and ERK1 protein expression. This result suggests that OXA may provide neuroprotection by inhibiting ferroptosis by affecting this signaling pathway. SRC family kinases (SFKs) are important components of multiple signaling pathways in cells, regulating cell survival, proliferation, differentiation and migration. FAK (focal adhesion kinase) is a direct downstream target protein of SFKs, and its activation can further activate multiple signaling pathways, including ERK1 / 2. The ERK pathway plays a central role in regulating multiple biological processes such as cell life and death, proliferation and differentiation. In a brain injury model, activation of the ERK pathway is associated with cytoprotection, which can promote cell survival and tissue repair. However, excessive activation of ERK1 in ferroptosis may be related to the cell death mechanism. Therefore, intervention with OXA may reduce cell death by inhibiting excessive ERK1 activation. It is worth noting that this series of molecular events may jointly enhance the antioxidant defense capacity of cells. Specifically, Orexin-A inhibits SRC and downregulates FAK, thereby affecting the activity of ERK, thereby effectively inhibiting the excessive accumulation of ROS in cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Horizontal gel electrophoresis after restriction endonuclease of plasmid. (1kbDNA Ladder band: 12000bp, 8000bp, 6000bp, 5000bp, 4000bp, 3000bp, 2500bp, 2000bp, 1500bp, 1000bp).

[0023] Figure 2 SRCSHRNAshRNA1 sequencing results and alignment results.

[0024] Figure 3 SRCSHRNAshRNA2 sequencing results and alignment results.

[0025] Figure 4 SRCSHRNAshRNA3 sequencing results and alignment results.

[0026] Figure 5 QPCR results of SRC interference sequence.

[0027] Figure 6 BV2 cells transfected with plasmids. a is NC white light, b is NC fluorescence, c is SRCshRNA1 white light, d is SRCshRNA1 fluorescence.

[0028] Figure 7 Cell survival rate after treatment with different concentrations of Hemin.

[0029] Figure 8 Effect of OXA treatment on BV2 GPX4 mRNA expression.

[0030] Fig. 9 Effect of OXA treatment on FAK mRNA expression.

[0031] Fig.10 Effect of OXA treatment on PI3K mRNA expression.

[0032] Fig.11 Effect of OXA treatment on PI3K protein expression.

[0033] Fig.12 Effect of OXA treatment on ERK1 mRNA expression.

[0034] Fig.13 Effect of OXA treatment on ERK 1 protein expression.

[0035] Fig.14 Effect of OXA treatment on map2k2 mRNA expression.

[0036] Fig.15 Effect of OXA treatment on MEK mRNA expression.

[0037] Fig.16 Effect of OXA treatment on ERK2 mRNA expression. DETAILED DESCRIPTION

[0038] The specific embodiments of the present invention are further described in detail below, but the present invention is not limited to these embodiments, and any improvement or substitution based on the basic spirit of the present embodiment still falls within the scope of protection required by the claims of the present invention.

[0039] Example 1

[0040] Experimental study on lipid peroxidation regulated by orexin-A in SRC / FAK / ERK signaling pathway in traumatic cerebral hemorrhage

[0041] 1 Materials and methods

[0042] 1.1 Main reagents (Table 1 Main reagents statistics)

[0043]

[0044]

[0045] 1.2 Main instruments (Table 2 Main instruments statistics)

[0046]

[0047] 1.3.1 Preparation of Orexin (OXA) solution

[0048] Preparation of mother solution: 1.0000 mg of Orexin A is accurately weighed and dissolved in ultrapure water (ddH2O) to make a mother solution with a concentration of 1 mg / ml. It is then dispensed into individual tubes, each containing 100 microliters, and properly stored at -20°C in a low temperature environment away from light. When conducting experimental operations, the mother solution is diluted with culture medium as needed to obtain Hemin solutions of different concentrations for experimental use.

[0049] 1.3.2 Preparation of Hemin Solution

[0050] Hemin is a reagent used to construct an in vitro cerebral hemorrhage model and is ready for use.

[0051] Preparation of mother solution: Accurately weigh 0.6509 μg of Hemin, use dimethyl sulfoxide (DMSO) as solvent, and prepare a mother solution with a concentration of 0.6509 μg / ml. Then, evenly divide the mother solution into small tubes, each containing 100 μl, and store it properly at -20°C in a dark environment. When performing experimental operations, use culture medium to appropriately dilute the mother solution according to specific needs to obtain the required Hemin solution of different concentrations.

[0052] 1.2 Experimental methods

[0053] 1.2.1.Cultivation of BV2 cells

[0054] Recovery: Carefully remove the cell sample from the ultra-low temperature freezer (-80℃) or liquid nitrogen tank, quickly place it in a constant temperature water bath preheated to 37℃, and gently shake it to accelerate the thawing process of the cells. Subsequently, slowly transfer the thawed cell suspension to a DMEM high-glucose medium (containing 1% penicillin-streptomycin) containing 5 times its volume and 10% fetal bovine serum to ensure the nutrition and growth environment of the cells. Next, accurately take 10 microliters from the mixture for cell counting to determine the cell survival rate and density. The remaining cell suspension is centrifuged at 1000 rpm for 5 minutes to separate the cells from the culture medium. After centrifugation, carefully discard the supernatant, add an appropriate amount of complete culture medium, adjust the cell density to approximately 2×10^5 cells / cm2, and then evenly inoculate it into a T25 cell culture flask. Gently shake the inoculated cell culture flask to ensure that the cells are evenly distributed, and then place it in a cell culture incubator for culture. It is particularly important to note that on the first day after recovery, new culture medium must be replaced to avoid adverse effects of waste and metabolites in the old culture medium on the cells. When replacing the culture medium, make sure that the reagents used have been taken out of the 4°C refrigerator and restored to room temperature to reduce temperature stimulation to the cells. Normally, after 2 to 3 days of culture, the cells will reach a sufficient density to provide sufficient cell material for subsequent experimental operations.

[0055] Passaging and plating: When the cells grow to a density that occupies 80%-90% of the bottom area of ​​the culture flask, we perform cell passaging with a passaging ratio of 1:3. First, remove the original culture medium and gently rinse the cells once with preheated sterile phosphate buffered saline (PBS) containing 1% penicillin / streptomycin (Li Ji). Next, add 1 ml of 0.25% trypsin (Li Ji) for digestion. Place the culture flask in an incubator set at 37°C and incubate for 2 minutes, gently tapping the bottom of the flask to assist cell detachment. Under an inverted phase contrast microscope, when it is found that the cell morphology has changed to a round shape and large pieces have detached from the bottom of the flask, quickly add 2 ml of DMEM high-glucose medium containing 10% fetal bovine serum to terminate the digestion of trypsin. At this time, the cells can be gently blown to promote their complete detachment. Subsequently, the liquid containing the cells is transferred to a centrifuge tube and centrifuged at 1000rpm / min for 5min. Then, carefully pour off the supernatant, add 1 ml of DMEM high-glucose complete medium, and gently pipette to resuspend the cells. Then, slowly add 1 ml of cell suspension to the T25 cell culture flask along the bottom of the culture flask, and add complete medium to a total volume of 3 ml. Finally, return the culture flask to the cell culture incubator set at 37°C and 5% carbon dioxide concentration for continued culture. In the next 2 to 3 days, unless there are special circumstances, it is usually not necessary to change the medium. Carefully check the morphology and growth of the cells under a microscope. When the density of cells growing on the wall is observed to be close to 80%, cell plating can be performed.

[0056] Cell inoculation and counting: For cell inoculation, we chose the central area of ​​the 96-well plate for experimental operations, and filled the periphery of the experimental wells with phosphate buffered saline (PBS). Accurately inoculate 4,000 cells in each well, and to ensure the reliability of the results, set up 5 replicate wells in each group. Before cell inoculation, the cells need to be counted. We resuspend the digested cells with an appropriate amount of culture medium. Next, carefully pipette 10 microliters of the cell suspension liquid and slowly soak it into the gap between the coverslip and the counting plate of the cell counting plate. Let the suspension stand in the counting plate for 3 minutes to ensure that the cells are evenly distributed. Subsequently, we use a microscope to read the total number of cells in the large grids at the four corners of the counting plate, and calculate the cell density based on this. The formula for calculating cell density is: Cell density (cells / ml) = total number of cells / 4×10 ^4 Depending on the specific needs of the experiment, we can further dilute the cell suspension to adjust the number of cells.

[0057] Cell freezing: When the cells grow to a density of about 80%, we select some cells for freezing. The cell digestion and centrifugation steps are the same as before, followed by an accurate cell count using a cell counting plate. After the count is completed, we add 1 ml of serum-free cell freezing solution (brand: Li Ji) to resuspend the cells. Next, place the cell suspension in a 4°C refrigerator for 5 minutes and in a -20°C refrigerator for 30 minutes. Finally, make sure the container of the cell suspension is tightly sealed and transfer it to a -80°C refrigerator or liquid nitrogen for long-term storage.

[0058] 1.2.2 Establishment of in vitro BV2 cell model of cerebral hemorrhage and screening of optimal concentrations of Hemin and Orexin (OXA)

[0059] BV2 cells were plated conventionally and treated with different concentrations of Hemin, 10, 20, 30, 40, 50, 60, and 100 μM, and cultured in a 5% carbon dioxide incubator at 37°C for 3, 6, and 12 hours before CCK8 detection.

[0060] The absorbance was measured at 450nm on a microplate reader. The absorbance value is proportional to the cell proliferation ability.

[0061] The survival rate formula is as follows = [(As-Ab) / (Ac-Ab)], As represents the absorbance of the experimental well; Ac represents the absorbance of the control well; Ab represents the absorbance of the blank well.

[0062] 1.2.3 Cell CCK8 experiment

[0063] Plate 5×10 BV2 cells 3 After inoculation into 96-well plates, BV2 cells were plated on 9 plates each, and each plate was divided into a blank control group and a drug-added experimental group, with different concentrations of Orexin at 0.001, 0.01, 1, 5, and 10 μM. The culture conditions were: 37°C, 5% carbon dioxide incubator, and CCK8 detection was performed after 12, 24, and 48 hours of culture.

[0064] 1.2.4 Construction of SRC interference sequence gene

[0065] In view of the relatively short sequence of the SRCSHRNA interference gene, Hejin Biotechnology Co., Ltd. was responsible for the design and synthesis of specific primers, and successfully amplified the target gene fragment through the annealing process. Subsequently, we used BamHI and ECORI enzymes to digest the HJPLV-U6-ZSGreen-puro vector to linearize it for subsequent ligation reactions. After gel recovery and purification, we connected the linearized vector with the target gene fragment and transfected the ligation product into DH5α competent cells. The single clone selection technology was used for sequencing verification, and finally a viral plasmid containing the target interference gene sequence was constructed.

[0066] 1.2.4.1 Genetic information acquisition

[0067] We searched for the target gene sequence of SRCSHRNA on the official website of the National Center for Biotechnology Information (NCBI): http: / / www.ncbi.nlm.nih.gov / gene / .

[0068] 1.2.4.2 Preparation of vector plasmid DNA

[0069] In order to obtain the vector plasmid DNA, we routinely used restriction endonucleases Bam HI and xhoI to digest the target fragment HJSWPAAV-U6-ZSGreen and successfully recovered the vector HJPLV-U6-ZSGreen-puro.

[0070] 1.2.4.3 Preparation process of competent bacteria

[0071] 1) Solution preparation steps:

[0072] First, we prepared a 0.1 M CaCl2 solution and sterilized it through a 0.22 μm filter. Next, we prepared a 250 mM KCl solution. Then, we prepared a 2 M MgCl2 solution and sterilized it by autoclaving at 121 °C for 30 min. Finally, we prepared the SOB solution by adding 1 ml of the 250 mM KCl solution to a 100 ml measuring cup, adjusting the pH to 7.0 with 1 M NaOH, and autoclaving it. Then, we added 0.5 ml of the 2 M MgCl2 solution before use.

[0073] 2) Detailed preparation process of competent bacteria:

[0074] From the fresh plate cultured at 37℃ for 16 hours, we carefully picked a single colony and transferred it to a 500ml flask containing 100ml LB or SOB medium and cultured it at 37℃ and 250rpm for 3 hours. We performed the routine operation and finally resuspended the cell pellet according to the initial culture ratio and stored it in aliquots at -80℃ for later use.

[0075] 1.2.4.4 Preparation of clones

[0076] 1) Target fragment amplification

[0077] (1) Primer information is as follows:

[0078] Table 3 Plasmid sequence design table

[0079]

[0080] (2) Steps:

[0081] ① Take a sterile 0.2ml EP tube and prepare the reaction solution (add in the order of most first and then least):

[0082] Table 4 Preparation of common PCR reaction system

[0083]

[0084] ②Set up the PCR reaction program according to the following conditions:

[0085] 95℃ 10min

[0086] 4℃ ∞

[0087] Note: After annealing at 95℃ for 10 minutes, turn off the PCR instrument immediately and allow the sample to cool down slowly in the PCR instrument before ligation.

[0088] 2) Enzyme digestion

[0089] (1) First, we carefully selected the appropriate reaction solution based on the characteristics of the selected restriction endonuclease and accurately prepared the enzyme digestion system according to the standard operating procedures. Then, we placed the vector in this precisely prepared enzyme digestion system and used the restriction endonuclease to perform precise enzyme digestion on it to ensure the smooth progress of subsequent experimental steps.

[0090] Table 5 Horizontal electrophoresis reaction system preparation

[0091]

[0092] (2) Incubate in a 37° water bath for 2 hours

[0093] (3) Recovering the digested vector:

[0094] Prepare 1% DNA agarose gel: First, accurately weigh 1 gram of agarose powder and carefully pour it into a conical flask. Next, add 100 ml of 1×TAE buffer. Heat the mixture in a microwave until the agarose is completely dissolved. Then, let the solution cool naturally for 5 minutes (note that the temperature cannot be too high), and then slowly pour it into the gel preparation mold.

[0095] Load all 50 microliters of the digested sample plasmid into the gel wells, and use a DNA marker as a control. Perform electrophoresis at 110 volts for 30 minutes. After the electrophoresis, stain the gel with EB for 10 to 15 minutes. After that, place the gel in a gel imaging system for photography. Take a sterile 1.5 ml centrifuge tube and cut and recover the target gene band. This step needs to be operated in accordance with the user manual of the Tiangen brand agarose gel DNA recovery kit. Routine washing and identification are performed to ensure successful recovery.

[0096] 3) Connect

[0097] Prepare the recombination reaction system according to the following ratio:

[0098] Table 6 Recombination reaction preparation system

[0099]

[0100] After 1 hour of ligation at 22°C, the transformation process was ready to begin.

[0101] 4) Conversion

[0102] (1) Solution preparation:

[0103] Prepare 250mM potassium chloride (KCl) solution; prepare 2M magnesium chloride (MgCl2) solution and sterilize it by high pressure; prepare LB medium, LB agar medium and SOC medium routinely. Use a sterile pipette tip to aspirate 50μL from the competent cell suspension and place it in a sterile microcentrifuge tube. Add 5μL of ligation solution to each tube, gently rotate the centrifuge tube to mix evenly, and then place the centrifuge tube in ice for 30 minutes; preheat the water bath to 42°C in advance, and then place the centrifuge tube in a water bath for heat shock treatment for 90 seconds;

[0104] Raise the water temperature to the set temperature, quickly transfer the centrifuge tube to the ice box, and cool for 2 minutes; inject 500 microliters of resistance-free LB medium into each test tube, then place the centrifuge tube in a shaker set at 37°C for a 45-minute incubation recovery process; centrifuge the centrifuge tube at 6000g for 2 minutes, and then discard the supernatant. Use 100 μL of LB medium to resuspend the transformed competent cells and evenly spread them on the LB agar medium containing the corresponding resistance; leave the culture dish at room temperature for a period of time until the liquid is completely absorbed; invert the culture dish and place it in a 37°C incubator for 16 hours;

[0105] After the culture was completed, single clones were selected for sequencing analysis.

[0106] 1.2.5 Target screening

[0107] 1.2.5.1 Plasmid transient transfection

[0108] First, RTEC cells were passaged and precisely seeded into 6-well plates, with a cell density of approximately 4×10^5 cells per well. When the cell confluence reached 80%-90%, we proceeded to cell transfection. Next, 200 μL of serum-free DMEM high-glucose medium was used to dilute 1 μg of plasmid and 3 μL of transfection reagent respectively. After standing at room temperature for 5 minutes, we gently mixed the liquids and stood at room temperature for 20 minutes again to ensure sufficient reaction. After 20 minutes, the mixture was added dropwise to the cells, and then the cells were placed in an incubator at 37°C, 5% carbon dioxide concentration, and saturated humidity for culture. After 6 hours, we replaced the new DMEM high-glucose medium containing 10% fetal bovine serum to continue to support cell growth and transfection process. 48 hours after transfection, the transfection efficiency of the cells was observed using a fluorescence microscope, and target screening was performed. The transfection effect was evaluated based on the expression of GFP (green fluorescent protein), and the overall state of the cells was observed at this time, and relevant photos were recorded and taken.

[0109] 1.2.5.2 RNA extraction and testing: RNA was extracted using conventional methods and the RNA concentration was tested.

[0110] 1.2.5.4 Reverse transcription of samples

[0111] The protocol for first-strand cDNA synthesis and Ig DNA removal is as follows:

[0112] 1. Reaction system

[0113] Table 7 cDNA synthesis reaction system

[0114]

[0115] 2. Mix gently and incubate for 30 seconds

[0116] 3. Heat at 85 degrees Celsius for 5 seconds to inactivate Easyscript TR / RI and GDNA Remover, a conventional reaction system.

[0117] 1.2.6.1 Lentivirus packaging steps and system

[0118] 1) 293T cells were inoculated at an appropriate density (between 70% and 90%) in a culture dish with a diameter of 10 cm and allowed to grow for about 16 hours. A three-plasmid system was used, with pxp2X and pmd2G as two auxiliary plasmids of lentivirus and SRC shRNA as the core plasmid of lentivirus interference expression. The following plasmids (SRC shRNA: pxp2X: pmd2G is 5:2.5:2) were added to transfect 293T cells, and DMEM high-glucose complete medium was replaced 6 hours after transfection. After 48 hours, the first culture supernatant was collected and temporarily stored at 4°C. After 72 hours, the second culture supernatant was collected, the two supernatants were mixed, filtered at 1000rpm for 5 minutes, and concentrated with a 0.45um filter using a centrifuge tube. After concentration, the supernatants were divided into virus tubes and stored in a -80°C refrigerator.

[0119] 1.2.6 Construction of BV2 virus model

[0120] The steps and system of lentiviral SRCshRNA infection of BV2 cells were inoculated into T25 culture dishes at an appropriate ratio (70%-90%) and cultured for about 16 hours. The target virus and co-infection reagent system (virus: co-infection reagent = 2:1, volume ratio) were used to infect the cells, and DMEM complete medium was replaced 9 hours after transfection. The cells were observed and photographed under a fluorescence microscope 48 hours after infection.

[0121] 1.2.7 Real-time fluorescence quantitative PCR

[0122] Lyse cells routinely and perform reverse transcription using the following system:

[0123] Table 8 Reverse transcription reaction system

[0124]

[0125] The PCR reaction was carried out using the following system

[0126] Table 9 qPCR system and conditions

[0127]

[0128] 1.2.8 Protein blotting

[0129] 1.2.8.1 Prepare protein samples: Digest adherent cultured PC-12 cells. Add 100 μl RIPA to each cell, incubate on ice for 60 min, shake every 10 min, then drop 25 μl 5× Loading Buffer, boil in a 100°C metal bath for 10 min to denature the protein, and freeze at -20°C.

[0130] 1.2.8.2 SDS-PAGE gel electrophoresis: Prepare 10% separation gel and 5% concentration gel. Then add marker and protein sample to the corresponding gel wells. Use 80V voltage for electrophoresis at the beginning. When the protein sample indicates that the marker reaches the separation gel, adjust the voltage to 120V. Stop electrophoresis when the protein sample indicates that the marker runs to the bottom of the separation gel.

[0131] 1.2.8.3 Transfer: After the electrophoresis is completed, take out the gel and soak it in the electrotransfer solution. Prepare an NC membrane and filter paper of the same shape and size as the gel and soak them in the electrotransfer solution. In the direction of black gel and white membrane, put the filter paper, gel, NC membrane, and filter paper into the transfer machine in turn. Spread the membrane on the filter paper and use tools to drive out the bubbles. Transfer the membrane for 120 minutes at a voltage of 100V

[0132] 1.2.8.4 Blocking: After the transfer, place the PVDF membrane in the blocking solution and block it on a shaker for 2 hours at room temperature. 1.2.8.5 Incubate with antibodies: After marking and trimming the PVDF membrane according to the molecular weight of the protein marker, incubate it with the diluted primary antibody in a 4°C refrigerator overnight. The next day, soak the NC membrane in TBST solution, wash it on a shaker for 45 minutes, and change the solution every 15 minutes. Prepare the corresponding horseradish peroxidase (1:2000) secondary antibody according to the species of the primary antibody, and then incubate the PVDF membrane with the secondary antibody at room temperature for 120 minutes.

[0133] 1.2.8.6 Photographing: After the secondary antibody incubation is completed, wash the membrane with PBST for 3 times, 15 minutes each time, on a shaker. Prepare the developer in advance, add the developer to the PVDF membrane, place it in a gel imager, expose and photograph, and save the image.

[0134] 1.2.9 Biochemical testing

[0135] MDA

[0136] Kit composition and preparation (50 tubes / 48 samples A003-1-1):

[0137] Kit composition and preparation (100 tubes / 96 samples A003-1-2):

[0138] Reagent 1: Liquid 20mL × 1 bottle, stored at room temperature.

[0139] Reagent 2: 12 mL of liquid × 1 bottle. Add 340 mL of distilled water to each bottle and mix well. Refrigerate at 4°C.

[0140] Reagent 3: Powder × 1 tube, add 60mL of distilled water to the powder and heat to 90℃~100℃ to fully dissolve

[0141] Then add distilled water to 60 mL, add 60 mL of glacial acetic acid, mix well, and refrigerate the prepared reagent away from light. Standard: 10 nmol / mL tetraethoxypropane 5 mL × 1 bottle, refrigerate at 4℃.

[0142] Operation configuration:

[0143] Blank tube: 0.1ml anhydrous ethanol + 0.1ml reagent 1 + 3ml reagent 2 + 1ml reagent 3 Standard tube: 0.1ml 10nmol / mL standard + 0.1ml reagent 1 + 3ml reagent 2 + 1ml reagent 3 Determination tube: 0.1ml 10ug / ul protein sample + 0.1ml reagent 1 + 3ml reagent 2 + 1ml reagent 3

[0144] Put the lid on the centrifuge tube, poke a small hole in the lid with a needle, mix well with a vortex mixer, place in a 95℃ water bath (or boil in a pot with the lid open) for 40 minutes, take out and cool with running water, then centrifuge at 3500-4000 rpm for 10 minutes (the centrifugation time below 3000 rpm needs to be extended to allow complete precipitation). Take the supernatant***, measure the absorbance of each tube at 532nm, 1cm light path, adjust to zero with distilled water. [Note]: a*: represents the amount of sample, standard, anhydrous ethanol, and reagent 1 taken, and the four are equal. (a* is generally 0.1-0.2mL)

[0145] MDA = (measured OD value - blank OD value) / (standard OD value - blank OD value) * standard concentration * dilution concentration

[0146] Preparation of 1mg / L (17.91mol / L) iron standard solution: dilute 10mg / L iron standard solution 10 times, i.e. 1mL 10mg / L (179.1mol / L) iron standard solution with double distilled water to 10mL. Reagent 2: 50mg iron adsorbent × 50 tubes, stored at 4℃ for 6 months.

[0147] Iron colorimetric reagent: one bottle of No. 3 A powder, one bottle of No. 3 B powder, 100 mL of No. 3 C liquid × 1 bottle, stored at 4℃ for 6 months. When using, pour the A and B powders into the C liquid, mix and dissolve thoroughly to obtain the iron colorimetric reagent, and store at 4℃~8℃ away from light.

[0148] Operation configuration:

[0149] Blank tube: 1ml double distilled water + 2ml color developer

[0150] Standard tube: 1ml 1mg / L iron standard application solution + 2ml iron colorimetric solution

[0151] Assay tube: 1ml protein sample (10μg / μL) + 2ml iron colorimetric reagent

[0152]

[0153] TIBC = measured OD value - blank OD value) / (standard OD value - blank OD value)*standard concentration*2Cstandard = standard solution concentration, 1 mg / L (17.91 mol / L).

[0154] 1.2.11 Statistical methods

[0155] The independent sample t-test was used for group comparison, with 0.05 as the test level. . The grouping details are as follows: in vitro grouping is divided into cell group (HTT22, BV2 normal cells), cell+hemin, cell+OXA and cell+Hemin+OXA groups. After the introduction of SCR infection plasmid, it is further divided into NC, NC+hemin, NC+OXA, NC+Hemin+OX, SRCshRNA, SRCshRNA+hemin, SRCshRNA+OXA and SRCshRNA+Hemin+OXA. NC is the empty group.

[0156] 2 Results

[0157] 2.1 SRC interference RNA sequencing results

[0158] 2.1.1SRCSHRNA shRNA1 sequencing results

[0159] Sequencing sequence: The underlined part is the inserted target gene fragment

[0160] TTAAGTTTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAGGATCG

[0161] CAA GATCACTAGACGGGAATTTCAAGAGAATTCCCGTCTAGTGATCTT

[0162] GCTTTTTT AATTCTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCAT

[0163] AGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTG

[0164] GCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTC

[0165] CCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTT

[0166] ACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTAC

[0167] GCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAG

[0168] TACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCAT

[0169] CGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAG

[0170] CGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGG

[0171] AGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAAC

[0172] TCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTAT

[0173] ATAAGCAGAGCTGGTTTAGTGAACCGTCAGATCCGCTAGCGCTACCGGTCG

[0174] CCACCATGGCCCAGTCCAAGCACGGCCTGACCAAGGAGATGACCATGAAG

[0175] TACCGCATGGAGGGCTGCGTGGACGGCCACAAGTTCGTGATCACCGGCGA

[0176] GGGCATCGGCTACCCCTTCAAGGGCAAGCAGGCCATCAACCTGTGCGTGG

[0177] TGAAAGGCGGCCCCTTGCCCTTCGCCGAGGACATCTTGTCCGCCGCCTTCA

[0178] TGTACGGCAACCGCGTGTTCACCGAATACCCCCAGGAAATCGTCGACTACT

[0179] TCAAGAACTCCTGCCCCGC

[0180] The sequencing peak graph indicates that the peak graph of the target gene is in the red box, and the comparison results indicate that SRCSHRNA shRNA1 is sequenced correctly and has no point mutation ( Figure 2 ).

[0181] 2.1.2 SRCSHRNA shRNA2 sequencing results

[0182] Sequencing sequence: The underlined part is the inserted target gene fragment

[0183] ATTAAGATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAG GATC

[0184] CCTAAATGTGAAACACTACAATTCAAGAGATTGTAGTGTTTCACATTTA

[0185] GGTTTTTT AATTCTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCAT

[0186] AGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTG

[0187] GCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTC

[0188] CCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTT

[0189] ACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTAC

[0190] GCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAG

[0191] TACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCAT

[0192] CGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGGCGTGGATAG

[0193] CGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCATTGACGTCAATGGG

[0194] AGTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAAC

[0195] TCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTAT

[0196] ATAAGCAGAGCTGGTTTAGTGAACCGTCAGATCCGCTAGCGCTACCGGTCG

[0197] CACCATGGCCCAGTCCAAGCACGGCCTGACCAAGGAGATGACCATGAAG

[0198] TACCGCATGGAGGGCTGCGTGGACGGCCACAAGTTCGTGATCACCGGCGA

[0199] GGGCATCGGCTACCCCTTCAAGGGCAAGCAGGCCATCAACCTGTGCGTGG

[0200] TGGAGGGCGGCCCCTTGCCCTTCGCCGAGGACATCTTGTCCGCCGCCTTCA

[0201] TGTACGGCAACCGCGTGTTCA

[0202] The sequencing peak graph indicates that the peak graph of the target gene is in the red box, and the comparison results indicate that SRCSHRNA shRNA2 is sequenced correctly and has no point mutation ( Figure 3 ).

[0203] 2.1.3SRCshRNAshRNA3 sequencing results and identification

[0204] Sequencing sequence: The underlined part is the inserted target gene fragment

[0205] AGGAGATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAG GATCG

[0206] CGGCTGCAGATTGTCAATAATTCAAGAGATTATTGACAATCTGCAGCC

[0207] GCTTTTTT AATTCTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCAT

[0208] AGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTG

[0209] GCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTC

[0210] CCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTT

[0211] ACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTAC

[0212] GCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAG

[0213] TACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCAT

[0214] CGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAG

[0215] CGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGG

[0216] AGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAAC

[0217] TCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTAT

[0218] ATAAGCAGAGCTGGTTTAGTGAACCGTCAGATCCGCTAGCGCTACCGGTCG

[0219] CACCATGGCCCAGTCCAAGCACGGCCTGACCAAGGAGATGACCATGAAG

[0220] TACCGCATGGAGGGCTGCGTGGACGGCCACAAGTTCGTGATCACCGGCGA

[0221] GGGCATCGGCTACCCCTTCAAGGGCAAGCAGGCCATCAACCTGTGCGTGG

[0222] TGGAGGGCGGCCCCTTGCCCTTCGCCGAGAAATCTTGTTCCGCCGCCTCCTG

[0223] TACGGCAACCGCGTGTCCCCGAGTACCCCAGGAATCGTCAATACTTCAAAA

[0224] TCCTGCCCGCCGGTAACCTGGGACCGTCCTTCTGGTCG

[0225] The sequencing peak graph indicates that the peak graph of the target gene is in the red box, and the comparison results indicate that SRCSHRNA shRNA3 is sequenced correctly and has no point mutation ( Figure 4 ).

[0226] After RTEC cells were transiently transfected with plasmids, the transfection efficiency reached 90% after 48 hours, no obvious impurities under white light, and strong fluorescence characteristics were visible under fluorescence. After 293T cells were transiently transfected with plasmids, the transfection efficiency reached 95% after 48 hours, no obvious impurities under white light, and strong fluorescence characteristics were visible under fluorescence. Figure 5 ). After QPCR testing, SRCshRNA1 had the best knockdown effect, so TESC SHRNA1 was selected for subsequent experiments ( Figure 5 ).

[0227] 2.2. In vitro BV2 cell model of cerebral hemorrhage and determination of OXA concentration

[0228] After CCK8 detection, the optimal Hemin concentration for cells was 10 μM, and the action time was 3 hours. The optimal Hemin concentration for BV2 cells was 30 μM, and the action time was 3 hours, so the above drug concentrations were used for subsequent experiments ( Figure 7). After CCK8 detection, the optimal OrexinA concentration for cells was 0.001μM, and the action time was 12h; the optimal Orexin concentration for BV2 cells was 0.001μM, and the action time was 12h, so the above drug concentrations were used for subsequent experiments ( Figure 7 ).

[0229] 2.3 Biological effects of OXA in the ferroptosis environment

[0230] Compared with the no-load group, the pure OXA in SCR - There was no effect of reversing cytochrome C levels in the OXA group. After the use of the ferroptosis inhibitor Ferostatin-1, cytochrome C was significantly upregulated (P < 0.0001). After treatment with the ferroptosis activator Erastin, OXA can upregulate cytochrome C (P < 0.05), but compared with the ferroptosis activation state, cytochrome C is still at a low level. When cells are in the environment of OXA and Ferostatin-1 at the same time, the biochemical level of cytochrome C does not change significantly ( Figure 8 ). The effect of OXA on Fe is mainly to downregulate the biochemical level of Fe (P < 0.05), while in the presence of Ferostatin-1, OXA mainly increases the biochemical Fe level (P < 0.0001), but OXA does not affect the total iron binding capacity. At the same time, MDA results found that OXA can significantly downregulate the lipid peroxidation environment of in vitro cerebral hemorrhage simulated by Haemin (MDA, P < 0.0001), even in the presence of the ferroptosis activator Erastin, OXA can still downregulate the biochemical level of MDA (P < 0.05) ( Figure 8 )2.4Exploration of the potential mechanism of OXA regulating ferroptosis

[0231] After the cells were treated with hemin, the expression of FAK mRNA was upregulated, with a significant statistical difference (P < 0.01). After OXA intervention, the expression of FAK mRNA was downregulated, with a very significant statistical difference (P < 0.0001). After SRC gene inhibition, the expression of FAK mRNA did not change significantly after the cells were treated with hemin, but after OXA intervention, the expression of FAK mRNA was downregulated, with a very significant statistical difference (P < 0.001). After the BV 2 cells were treated with hemin, the expression of FAK mRNA was upregulated, with a very significant statistical difference (P < 0.0001). After OXA intervention, the expression of FAK mRNA was downregulated, with a very significant statistical difference (P < 0.0001). After SRC gene inhibition, FAK mRNA expression was upregulated after hemin treatment of BV2 cells, with a very significant statistical difference (P < 0.0001). After OXA intervention, FAK mRNA expression was downregulated, with a very significant statistical difference (P < 0.0001) ( Fig. 9 ).

[0232] After the cells were treated with hemin, the expression of PI3K mRNA did not change. After OXA intervention, the expression of PI3K mRNA also did not change. After SRC gene inhibition, the expression of PI3K mRNA did not change significantly after hemin treatment of cells, and after OXA intervention, the expression of PI3K mRNA did not change. After hemin treatment of BV2 cells, PI3K mRNA expression was upregulated, with statistical significance (P < 0.05). However, after OXA intervention, the expression of PI3K mRNA did not change. After SRC gene inhibition, the expression of PI3K mRNA did not change significantly after hemin treatment of BV2 cells, and after OXA intervention, the expression of PI3K mRNA did not change ( Fig.10 ).

[0233] For normal cell lines, in the presence of ferroptosis agonists, PI3K mRNA did not change significantly, but after OXA treatment, the business changed significantly. After SRC intervention, OXA-treated cells upregulated PI3K mRNA, with a significant statistical difference (P < 0.001). In the presence of agonists, OXA-treated cells upregulated PI3K mRNA, with a significant statistical difference (P < 0.001). From the protein level, after SRC interference, OXA can downregulate the expression level of PI3K protein in cells treated with hemin, with a significant statistical difference (P < 0.001) ( Fig.11).

[0234] After the cells were treated with hemin, the expression of ERK1 mRNA was upregulated, with extremely significant statistical differences (P < 0.001). After OXA intervention, the expression of ERK1 mRNA was downregulated, with statistical differences (P < 0.05). After SRC gene inhibition, the expression of ERK1 mRNA was upregulated after the cells were treated with hemin, with very extremely significant statistical differences (P < 0.0001). After OXA intervention, the expression of ERK1 mRNA was downregulated, with very extremely significant statistical differences (P < 0.0001). After the BV2 cells were treated with hemin, the expression of ERK1 mRNA was upregulated, with very extremely significant statistical differences (P < 0.0001). After OXA intervention, the expression of ERK1 mRNA was downregulated, with very extremely significant statistical differences (P < 0.0001). After SRC gene inhibition, ERK1 mRNA expression was upregulated after hemin treatment of BV2 cells, with a very significant statistical difference (P < 0.0001). After OXA intervention, ERK1 mRNA expression was downregulated, with a very significant statistical difference (P < 0.0001) ( Fig.12 ).

[0235] From the protein level, after SRC transfection, OXA can down-regulate the expression level of ERK1 protein in cells treated with hemin, with a significant statistical difference (P < 0.001) ( Fig.13 ).

[0236] After the cells were treated with hemin, the expression of map2k2 mRNA did not change. After OXA intervention, the expression of map2k2 mRNA was downregulated, with a very significant statistical difference (P < 0.0001). After SRC gene inhibition, the expression of map2k2 mRNA was upregulated after the cells were treated with hemin, with a very significant statistical difference (P < 0.0001). After OXA intervention, the expression of map2k2 mRNA was downregulated, with a very significant statistical difference (P < 0.0001). After the cells were treated with hemin, the expression of map2k2 mRNA did not change. After OXA intervention, the expression of map2k2 mRNA was downregulated, with a very significant statistical difference (P < 0.0001). After SRC gene inhibition, the expression of map2k2 mRNA was upregulated after the cells were treated with hemin, with a very significant statistical difference (P < 0.0001). After OXA intervention, the expression of map2k2 mRNA was downregulated, with a very significant statistical difference (P < 0.0001) ( Fig.14 ).

[0237] After the cells were treated with hemin, there was no change in the expression of MEK mRNA. After OXA intervention, the expression of MEK mRNA was upregulated, with a significant statistical difference (P < 0.01). After SRC gene inhibition, there was no significant change in the expression of MEK mRNA after the cells were treated with hemin. After OXA intervention, there was no significant change in the expression of MEK mRNA. After hemin treatment of BV2 cells, there was no change in the expression of MEK mRNA. After OXA intervention, there was no change in the expression of MEK mRNA. After SRC gene inhibition, there was no change in the expression of MEK mRNA after hemin treatment of BV2 cells. After OXA intervention, the expression of MEK mRNA was downregulated, with a significant statistical difference (P < 0.01) ( Fig.15 ).

[0238] After the cells were treated with hemin, there was no change in ERK2 mRNA expression. After OXA intervention, there was no change in ERK2 mRNA expression. After SRC gene inhibition, there was no change in ERK2 mRNA expression after hemin treatment of cells. After OXA intervention, there was no change in ERK2 mRNA expression. After hemin treatment of BV2 cells, ERK2 mRNA expression was upregulated, with a very significant statistical difference (P < 0.0001). After OXA intervention, ERK2 mRNA expression was downregulated, with a very significant statistical difference (P < 0.0001). After SRC gene inhibition, there was no change in ERK2 mRNA expression after hemin treatment of BV2 cells. After OXA intervention, there was no change in ERK2 mRNA expression ( Fig.16 ).

[0239] In summary, the present invention provides for the first time the use of Orexin-A in inhibiting lipid peroxidation. The use of Orexin-A provided by the present invention shows its potential in reducing cell damage, inhibiting ferroptosis and regulating neuroinflammation.

Claims

1. Application of Orexin-A in inhibiting lipid peroxidation.

2. The use of Orexin-A in inhibiting lipid peroxidation according to claim 1, characterized in that: The Orexin-A is orexin-A.

3. The use of Orexin-A in inhibiting lipid peroxidation according to claim 1, characterized in that: The inhibition of lipid peroxidation refers to the inhibition of lipid peroxidation caused by cerebral hemorrhage.

4. The use of Orexin-A in inhibiting lipid peroxidation according to claim 1, characterized in that: The aspect of inhibiting lipid peroxidation is the aspect of preparing drugs and reagents for inhibiting lipid peroxidation.

5. Application of Orexin-A in the preparation of drugs for cerebral hemorrhage.

6. Application of Orexin-A in the preparation of drugs that inhibit ferroptosis.

7. Application of Orexin-A in the preparation of drugs for inhibiting SRC gene expression.

8. Application of Orexin-A in the preparation of drugs for downregulating the expression of FAK and ERK1 proteins.

9. Application of Orexin-A in the preparation of drugs for inhibiting the expression level of MDA (malondialdehyde).

10. Application of Orexin-A in the preparation of drugs for reducing ROS production.

Images